Activation of transient receptor potential ankyrin-1 by wood smoke particulate material

Exposure to wood smoke particulate matter (WSPM) has been linked to exacerbation of pre-existing respiratory conditions such as asthma, development of chronic obstructive pulmonary disease (COPD), and premature deaths. While it is clear that WSPM exposure is hazardous to human health, the molecular and cellular mechanisms through which it causes these adverse respiratory effects are not well understood. Transient receptor potential ankyrin-1 (TRPA1) is a cation channel that is expressed in sensory neurons, small airway epithelial cells, smooth muscle cells, and fibroblasts. TRPA1 has been implicated as a mediator of toxicity for several combustion-derived particulate materials (cdPM), including diesel exhaust (DEP) and cigarette smoke (CS). The hypothesis of this project was that WSPM would selectively activate TRPA1 through direct binding to ligand binding sites, including sites of covalent binding by electrophiles, and/or mechanical contact, which would then initiate cellular processes that culminate in pulmonary inflammation, lung injury, and respiratory dysfunction. Pine and mesquite PM were generated in the laboratory. These PM activated TRPA1 in a manner similar to DEP and CS in all cell lines tested: TRPA1 over-expressing HEK-293, primary mouse trigeminal (TG) neurons, and human alveolar adenocarcinoma (A549) cells. TRPA1 activation by WSPM was attenuated by a TRPA1 antagonist, HC-030031, in both A459 cells and TG neurons. Differential activation of TRPA1, as a function of particle size, demonstrated that respirable PM≤2.5 μm were most potent. Additionally, several known chemical components of WSPM were TRPA1 agonists. Both WSPM and agathic acid activated TRPA1 primarily though the electrophile/oxidant sensing site, while 3,5-ditert-butylphenol activated TRPA1 through the menthol-binding site. This study establishes WSPM as a potent and selective activator of TRPA1 and outlines a specific biochemical mechanism for how WSPM and associated chemical components activate TRPA1. These results provide key insights into how one could potentially develop therapeutics to reduce WSPM toxicity in the respiratory tract.

ACTIVATION OF TRANSIENT RECEPTOR POTENTIAL ANKYRIN-1 BY WOOD SMOKE PARTICULATE MATERIAL by Darien Shapiro A Senior Honors Thesis Submitted to the Faculty of The University of Utah In Partial Fulfillment of the Requirements for the Honors Degree in Bachelor of Science In Biology Approved: ____________________ Dr. Christopher A. Reilly Supervisor, Department of Pharmacology and Toxicology ____________________ Dr. Neil J. Vickers Chair, Department of Biology ____________________ Dr. Darryl L. Kropf Department Honors Advisor ____________________ Dr. Sylvia D. Torti Dean, Honors College May 2012 ABSTRACT Exposure to wood smoke particulate matter (WSPM) has been linked to exacerbation of pre-existing respiratory conditions such as asthma, development of chronic obstructive pulmonary disease (COPD), and premature deaths. While it is clear that WSPM exposure is hazardous to human health, the molecular and cellular mechanisms through which it causes these adverse respiratory effects are not well understood. Transient receptor potential ankyrin-1 (TRPA1) is a cation channel that is expressed in sensory neurons, small airway epithelial cells, smooth muscle cells, and fibroblasts. TRPA1 has been implicated as a mediator of toxicity for several combustion-derived particulate materials (cdPM), including diesel exhaust (DEP) and cigarette smoke (CS). The hypothesis of this project was that WSPM would selectively activate TRPA1 through direct binding to ligand binding sites, including sites of covalent binding by electrophiles, and/or mechanical contact, which would then initiate cellular processes that culminate in pulmonary inflammation, lung injury, and respiratory dysfunction. Pine and mesquite PM were generated in the laboratory. These PM activated TRPA1 in a manner similar to DEP and CS in all cell lines tested: TRPA1 over-expressing HEK-293, primary mouse trigeminal (TG) neurons, and human alveolar adenocarcinoma (A549) cells. TRPA1 activation by WSPM was attenuated by a TRPA1 antagonist, HC-030031, in both A459 cells and TG neurons. Differential activation of TRPA1, as a function of particle size, demonstrated that respirable PM≤2.5 μm were most potent. Additionally, several known chemical components of WSPM were TRPA1 agonists. Both WSPM and agathic acid activated TRPA1 primarily though the electrophile/oxidant sensing site, while 3,5-ditert- ii butylphenol activated TRPA1 through the menthol-binding site. This study establishes WSPM as a potent and selective activator of TRPA1 and outlines a specific biochemical mechanism for how WSPM and associated chemical components activate TRPA1. These results provide key insights into how one could potentially develop therapeutics to reduce WSPM toxicity in the respiratory tract. iii TABLE OF CONTENTS ABSTRACT…………………………………………………….………………………...ii LIST OF TABLES………………………………………………………………………...v LIST OF FIGURES……………………………………………….……………………...vi INTRODUCTION………………………………………………………………………...1 Introduction to Particulate Matter…………………………………………………………1 Epidemiology of PM Exposure……………………………………………………………2 Wood Smoke Particulate Matter………………………………………………………......3 TRPA1…………………………………………………………………………………….6 A Role for TRPA1 in Neurogenic Inflammation…………………………………………7 A Role for TRPA1 in Non-Neurogenic Inflammation……………………………………9 TRPA1 as a Mediator of Air Particle Toxicity…………………………………………..10 Research Objectives…………………………………….………………………………..11 MATERIALS AND METHODS………………………………………………………...12 RESULTS………………………………………………………………………………..25 DISCUSSION……………………………………………………………………………41 CONCLUSIONS………………………………………………………………………...48 REFERENCES…………………………………………………………………………..49 iv LIST OF TABLES Table 1…………………………………………………………………………………...17 Table 2…………………………………………………………………………………...35 v LIST OF FIGURES Figure 1…………………………………………………………………………………..13 Figure 2…………………………………………………………………………………..14 Figure 3…………………………………………………………………………………..15 Figure 4…………………………………………………………………………………..19 Figure 5…………………………………………………………………………………..21 Figure 6…………………………………………………………………………………..26 Figure 7…………………………………………………………………………………..27 Figure 8…………………………………………………………………………………..29 Figure 9…………………………………………………………………………………..31 Figure 10…………………………………………………………………………………32 Figure 11…………………………………………………………………………………34 Figure 12…………………………………………………………………………………39 Figure 13…………………………………………………………………………………40 vi INTRODUCTION Introduction to Particulate Matter Particulate matter (PM) is a complex mixture of solids, absorbed chemicals, and condensed liquid, and is the visible component of air pollution. Suspended particulate components of air pollution are generally separated into different size fractions based on their aerodynamic diameter (Dockery & III, 1994). The coarse fraction of PM is classified as particles having diameters from 2.5-30 microns. This fraction is characterized by often having a basic pH and usually results from poor or incomplete combustion of solid and liquid fuels, crustal suspension and road wear, and pollen spikes. When inhaled, particles in this fraction greater than 5 microns are expected to deposit in the mouth, nasal passages, and upper airways, where they are swallowed or expelled by mucociliary clearance and coughing. In contrast, the fine fraction of PM is defined as particles ranging from 0.12.5 microns in diameter, and is often acidic. Fine particles typically arise from combustion sources (Dockery, 1994; Pope III, 2000a) including vehicle exhaust, and wood/biomass combustion (Nogueira, 2009), where they are often formed from condensation of semi volatile chemical by-products onto the ultra-fine particle soot fraction (which is defined as particles having a diameter smaller than 0.1 microns)(Naeher et al., 2007). Fine PM are particularly of interest for several reasons. The effect of gravity on these relatively small PM is much less significant than for larger objects. For this reason, these PM are very stable in the environment and can be transported long distances away (often hundreds of kilometers) from their source by wind (Naeher et al., 2007). During formation, fine PM are expected to aggregate later than larger PM, so they are expected to have more volatile and toxic chemicals absorbed to their surface (S. S. Leonard et al., 2007) and larger overall surface area per unit volume (Kocbach Bolling et al., 2009). The toxic chemicals on the surface of fine PM are particularly relevant because of their ability to penetrate deep into the lung. When inhaled, fine PM are small enough that they can penetrate into the lower airways of the lung, reaching the bronchioles and alveoli. Here, particles bypass the lung’s natural defensive mechanism, clearance via macrophage endocytosis or the mucociliary escalator/clearance (Dockery & III, 1994). For those particles that remain in the lung, the potentially hazardous chemicals adhered to their surface are expected to induce pulmonary inflammation, involving pro-inflammatory cytokine release, and to alter cardiac autonomic function (Ill, 2000) to produce a wide variety of deleterious health endpoints. Epidemiology of PM Exposure Exposure to PM is increasingly being linked to serious adverse health effects in humans. Moderate increases in PM levels have been associated with increased mortality and morbidity, while single incidences of high PM levels have been associated with increases in hospital admissions for cardiopulmonary morbidity and general decreases in lung function which can last 1-2 weeks following the exposure (Dockery & III, 1994). PM exposure is associated with decreases in both lower, and to a smaller extent, upper respiratory tract function (Dockery & III, 1994). Typical respiratory symptoms associated 2 with altered lower respiratory tract function include wheezing, dry cough, chest discomfort, and shortness of breath, while symptoms of upper respiratory tract dysfunction include sinusitis, sore throat, wet cough, runny nose, and hay fever. Individuals with compromised lung function, including the elderly, infants, and those with pre-existing lung conditions such as asthma and chronic bronchitis, are at particular risk for developing adverse effects associated with PM exposure (Ill, 2000). For these populations, PM exposure has been shown to exacerbate many pre-existing conditions such as asthma, chronic bronchitis, and chronic obstructive pulmonary disease (COPD) [2,3], which can lead to increased hospitalizations and even death (Albalak, Frisancho, & Keeler, 1999; Anderson et al., 1995; Bruce, Perez-Padilla, & Albalak, 2000; Epton et al., 2008; Fairley, 1990; Fullerton et al., 2011; III, 2000; Ill, 2000; Pope III, 2000a; Schei et al., 2004; Sood et al., 2010). Wood Smoke Particulate Matter Wood smoke particulate matter (WSPM) is the most common form of environmental PM in many areas (Mei Zheng, Glen R. Cass, James J. Schauer, & Edgerton, 2002; Naeher et al., 2007; Sheesley, Schauer, Zheng, & Wang, 2007), contributing 10-40% to the total fine PM mass in many large cities (Kocbach Bolling et al., 2009), particularly in the winter months. Worldwide, the burning of wood and other biomass accounts for 10% of energy use by humans (Naeher et al., 2007). This is particularly relevant for the nearly 2.4 billion homes in less developed countries that use biomass fuels as their primary fuel source for cooking and heating (Laumbach & Kipen, 2012). For such populations, women and children who spend the more at home are 3 particularly at risk for respiratory diseases associated with WSPM exposure, as these homes often have poor ventilation, resulting in indoor concentrations of WSPM thousands of times higher than typical outdoor exposure (Laumbach & Kipen, 2012). Studies of this population have identified WSPM as a leading cause of chronic obstructive pulmonary disease (COPD) in adults and as a contributor to lower respiratory infections in children, with an estimated 1.5 million deaths each year attributable to WSPM and related biomass PM exposure (Laumbach & Kipen, 2012). WSPM exposure has also been associated with increased risk of pneumonia, a higher incidence of tuberculosis (Laumbach & Kipen, 2012), cataracts, lung cancer, and asthma (Albalak et al., 1999; Epton et al., 2008; Fullerton et al., 2011; Kocbach Bolling et al., 2009; S. S. Leonard et al., 2007; Naeher et al., 2007; Schei et al., 2004). In pregnant mothers, increases in WSPM and carbon monoxide levels has been linked to increased infant mortality, low birth weight, and increased incidences of premature births (Bruce et al., 2000; Šrám, Binková, Dejmek, & Bobak, 2005). Wood is made up of primarily cellulose and lignin, with small amounts of other organic molecules. Due to the nature of most fires, combustion of wood is typically inefficient, resulting in the release of many toxic byproducts including carbon monoxide, polycyclic aromatic hydrocarbons (PAHs), benzene, and various α,β-unsaturated aldehydes (Naeher et al., 2007). These chemicals start out as vapors or ultrafine particulate matter, but within seconds condense in cooler air to form fine PM (S. S. Leonard et al., 2007; Naeher et al., 2007) with many incomplete combustion products adhering to the surface of a given particle. 4 The high levels of α,β-unsaturated aldehydes and reactive PAHs on WSPM have been shown to form radicals and reactive oxygen species (ROS), including the generation of the oxidant hydrogen peroxide (Danielsen et al., 2010; S. S. Leonard et al., 2007; Stephen S. Leonard et al., 2000). Exposure to these reactive species is often associated with increased production and release of the pro-inflammatoy cytokines IL-8 and TNF-α, which can activate the transcription factor NFκB (Karlsson, Ljungman, Lindbom, & Moller, 2006; Kocbach, Namork, & Schwarze, 2008) leading to systemic inflammatory responses. Additionally, inhalation of WSPM has been linked to lipid peroxidation, DNA damage, and lung cell death (Danielsen et al., 2010; Danielsen, Loft, Kocbach, Schwarze, & Moller, 2009; Karlsson et al., 2006; S. S. Leonard et al., 2007; Stephen S. Leonard et al., 2000). While it is clear that WSPM possesses a threat to human health, the molecular basis through which it causes adverse effects is not well defined. Several receptors have been shown to regulate the acute toxicity of inhaled PM, including Toll-like receptor 4 (TLR4) [6,7], epidermal growth factor receptor (ErbB1), and macrophage scavenger receptor MARCO [8-13]. However these receptors are not expressed in all cells of the lung that initially come in contact with inhaled PM (e.g., epithelial cells and sensory nerves often lack TLR4 and MACRO), and therefore cannot account for all of the documented adverse responses of the respiratory tissue to cdPM. Thus, it is necessary to further investigate how WSPM, like other forms of cdPM, affects various cells of the respiratory tract through the identification of more specific and universal molecular sensors that may potentially mediate the acute and/or long-term deleterious effects of WSPM in the respiratory tract. 5 TRPA1 Transient receptor potential (TRP) channel proteins are ion channels that are widely expressed in mammals. Many of these channels are highly expressed in sensory neurons, including those that innervate the respiratory tract, where they can function as environmental sensors [14-16]. TRP ankyrin-1 (TRPA1) is activated by compounds found in horseradish, mustard oil, and cinnamon oil, and is expressed in the hair cells of the ear, peripheral sensory c-fiber neurons, and about 20-35% of sensory neurons that innervate the respiratory tract. It is a tetramer with 17 N-terminal ankyrin repeats (Bessac & Jordt, 2008). TRPA1 can be activated through two well established agonist binding sites and possibly by mechanical interactions with insoluble particles (Howard & Bechstedt, 2004). The first site, referred to as the 3CK site, involves direct binding of electrophilic chemicals or oxidants to amino acids C621, C641, C665, and K710 in the intracellular Nterminal domain, causing a conformational change to open the channel (Bessac & Jordt, 2008; Macpherson et al., 2007). The second site, referred to as the ST site, involves the binding of menthol and related compounds to residues S873 and T874 (Xiao et al., 2008). The activation of TRPA1 in sensory nerves of the respiratory tract has been shown to induce coughing and irritation (Birrell et al., 2009), while activation of TRPA1 on nonneuronal cells causes cells to produce pro-inflammatory mediators that regulate inflammation and a loss of cell viability (Nassini et al., 2012); both sensory nerves and epithelial cells are critical for respiratory tract homeostasis and aberrant activation of TRPA1 in these cells can promote respiratory toxicity. 6 A Role for TRPA1 in Neurogenic Inflammation The body has a variety of mechanisms to detect and expel harmful noxious airborne chemicals from the respiratory tract. As chemicals are inhaled through the nose, they are surveyed by the trigeminal (TG) neurons. This functions as the first line of defense against noxious chemicals, producing pain, irritation, and sneezing when noxious chemicals are detected (Bessac & Jordt, 2008) to rid the airways of these chemicals before they reach the lungs. As these chemicals penetrate deeper into the airways they are exposed to a natural store of glutathione (GSH), uric acid, and lipoic acid, which functions to neutralize and reduce the effects of the chemicals (Bessac & Jordt, 2010). Despite these mechanisms, many harmful chemicals still reach the lower airways at a high enough concentration to affect the resident lung cells., particularly when associated with particles. The lower airways contain two populations of somatic sensory nerves, the stretch receptors, called the A-δ fibers, and C-fibers, or nociceptors (Thomas Taylor-Clark & Bradley J. Undem, 2006). Activation of A-δ fibers, which are myelinated and have relatively large diameters, produces a fast, sharp pain. C-fibers are unmyelinated, have smaller diameters than A-δ fibers, and are activated with a slow velocity to produce slow, burning pain (Bessac & Jordt, 2010). While both fibers are relevant in sensation, noxious chemicals typically reach C-fibers faster since they are not myelinated (Bessac & Jordt, 2008). Airway C-fibers often express TRPV1 and are responsive to capsaicin treatment. Among this population of TRPV1 expressing C-fibers, 30-40% also express TRPA1 (Bessac & Jordt, 2008, 2010), and have been shown to be activated by the TRPA1 7 agonist mustard oil, which leads to pain and neurogenic inflammation (Bessac & Jordt, 2008). TRPA1 is also activated by a wide variety of oxidants, α,β-unsaturated aldehydes and reactive PAHs expected to be present in airborne PM (Taylor-Clark et al., 2008) When TRPA1 is activated in these neurons by exogenous chemicals, a response cascade is activated which results in several endpoints. First, signaling is relayed to the brain to take appropriate systemic measures, including a decrease in respiratory drive, cough, and bronchoconstriction (Bessac & Jordt, 2010). Second, TRPA1 causes the release of inflammatory neuropeptides substance P (SP) and calcitonin gene-related peptide (CGRP) (Bessac & Jordt, 2010; Jordt et al., 2004; Nassini et al., 2012). SP binds the tachykinin receptor NK1, while CGRP binds the calcitonin receptor-like receptor (CRLR). Together, these neuropeptides modulate neurogenic inflammation by increasing bronchoconstriction, promoting immune cell infiltration, vasodilation, and plasma extravasation (Bessac & Jordt, 2010; Jordt et al., 2004). TRPA1 may also be activated endogenously to produce these same results. Protease activated receptor 2 (PAR2) is a G-protein coupled receptor (GPCR) which has been shown to play a role in response to inflammation, repair, and related tissue injury (Dai et al., 2007). PAR2 agonists have been demonstrated to release SP and CGRP, probably indirectly through a mechanism that enhances the activation of TRPA1. When PAR2 is activated, it causes phospholipase-C (PLC) to be activated. A well-known function of PLC is to cleave phosphatidylinositol 4,5-bisphosphate (PIP2) into diacylglycerol (DAG) and inositol triphosphate (IP3) to produce further downstream effects. In this case, PIP2 blocks activation of TRPA1. When PIP2 is cleaved by PLC, TRPA1 can experience enhanced activation by a broad array of stimuli (Dai et al., 2007; 8 Jordt et al., 2004; Thomas Taylor-Clark & Bradley J. Undem, 2006). It is interesting to note that the second messenger calcium also activates TRPA1. Thus, a small activation of TRPA1 can increase intracellular calcium levels, which can then activate TRPA1 even further, uncoupling the response form the original stimulus (Bessac & Jordt, 2008). Production of IP3 can also activate TRPA1 indirectly by opening calcium channels on the endoplasmic reticulum (Jordt et al., 2004). Activation of TRPA1 in C-fibers and TG neurons can result in neurogenic inflammation. Low level stimulation elicits responses that can expel oxidants from the lung and protect the alveoli from harmful chemicals, including sneezing, coughing, mucous production, and upper airway inflammation (Bessac & Jordt, 2010). At significantly high concentrations of chemical exposure, activation of C-fibers produces pain, resistance to airflow by bronchospasm, uncontrollable coughing, secretion of mucous, and upper airway inflammation (Bessac & Jordt, 2010). Neurogenic responses at this level function to protect the alveoli, but often cause lung and tissue damage themselves, with multiple repeated exposures of this sort compounding the neurogenic responses and contributing to the risk of asthma attack or development of airway diseases such as occupational asthma, COPD, and reactive airway dysfunction syndrome (Bessac & Jordt, 2010). A Role for TRPA1 in Non-Neurogenic Inflammation While neurogenic inflammation in the lungs can be mediated by TRPA1 activation, non-neurogenic inflammation in the lung is also mediated through TRPA1. TRPA1 is also expressed in fibroblasts, epithelial, and smooth muscle cells in the lung. In 9 these cells, it has been demonstrated that TRPA1 activation causes release of the proinflammatory cytokine IL-8 among others (Nassini et al., 2012). IL-8 mediates nonneurogenic inflammation by stimulating neutrophil chemotaxis and adhesion to lung capillary walls, which exhibit increased permeability as a result of the effects of CGRP and SP binding to their receptors (Ghasemi, Ghazanfari, Yaraee, Faghihzadeh, & Hassan, 2011). TRPA1 as a Mediator of Air Particle Toxicity A series of recent studies have established an essential role for TRPA1 in chemosensation of environmental PM. TRPA1 was sshown to be the sole molecular mediator of acrolein toxicity, an α,β-unsaturated aldehyde commonly found in smoke, in the respiratory tract (Bautista et al., 2006). This study demonstrated that neurons from TRPA1 knockout mice were unable to respond to acrolein. Shortly after, it was discovered that TRPA1 is also activated by the oxidizing agents hypochorite and hydrogen peroxide (Bessac et al., 2008). This led to the investigation of TRPA1 as a potential mediator of cdPM, which is rich in oxidizing agents and α,β-unsaturated aldehydes. TRPA1 has since been shown to have essential roles in chemosensation of several cdPM, including cigarette smoke through α,β-unsaturated aldehydes (Andre et al., 2008), and as a mediator of neurogenic inflammation associated with exposure to the electrophilic components in DEP (Deering-Rice et al., 2011). 10 Research Objectives It is known that WSPM is a combustion by-product rich in reactive electrophilic chemicals including α,β-unsaturated aldehydes, quinoids, and other oxygenated polycyclic aromatic hydrocarbons (oxy-PAHs) (Danielsen et al., 2010). The ability of TRPA1 to respond to wide variety of compounds including the oxidizing agents in many forms of cdPM makes TRPA1 a prime candidate for acting as a molecular sensor for WSPM in airway sensory neurons and airway epithelium, as well as a likely early mediator of the adverse affects caused by WSPM in the respiratory tract. This idea is supported by the published role of TRPA1 in CS and DEP sensation, which are both chemically similar to WSPM (Baraldi, Preti, Materazzi, & Geppetti, 2010). In the present study, it was hypothesized that TRPA1 would be selectively activated by WSPM through direct binding of chemical binding sites including the menthol binding site, covalent modification by electrophiles, and/or mechanical contact with the insoluble components of WSPM, representing a direct pathway leading to acute pulmonary inflammation, injury, and respiratory dysfunction. This study aimed to establish TRPA1 as a key molecular mediator of WSPM toxicity by demonstrating specific activation of TRPA1 by WSPM in both neuronal and non-neuronal lung cells. It also explored particle potency as a function of size, yielding data suggesting that respirable PM <5 microns are more potent TRPA1 agonists as a result of having more toxic chemicals on a per/mass basis, and increased ability to activate TRPA1. Finally, this study determined whether the 3CK or ST binding sites on TRPA1 were the major site in which WSPM and associated chemical components activated TRPA1, which may help tailor effective therapeutic treatments for WSPM pneumotoxicity. 11 MATERIALS AND METHODS Chemicals: All chemicals used in this project were purchased from SigmaAldrich (St. Louis, MO), unless otherwise specified. Agathic acid, dihydroagathic acid, isocupressic acid abietic acid, dehydroabietic acid, and tetrahydroagathic acid were provided by the USDA Poisonous Plants Research Laboratory, Logan, UT. Preparation of WSPM: Size fractionated WSPM was generated in the laboratory as previously described by Shapiro et al (Shapiro et al., 2013). Briefly, a 90 x 2.7 cm i.d. steel tube was inserted into electric furnace (Blue M, New Columbia, PA) and heated to 750oC. A ~10 g sample of either Austrian pine or dry mesquite was inserted into the tube, with combustion occurring an average of 3 seconds after insertion. The resulting smoke was exposed to dilution air at 0.7 L/min to cool the smoke and mimic the natural environment in a smoke plume. The WSPM was then collected in an Andersen cascade impactor (ThermoAndersen, Smyrna GA), with each stage collecting a specific diameter range of WSPM, as shown in Figure 1. The resulting WSPM recovered from the cascade impactor plates was an oily, tar-like substance mixed with carbonaceous particles (Figure 2). To completely collect the WSPM, the cascade impactor plates were washed with a minimum volume of 100% ethanol and dried under filtered air. The particles were then stored in the dark at -20oC. Preparation of other cdPM: DEP was collected from the tailpipe of a 2004 Ford F350 “black smoker” and was extracted in EtOH as previously described (Deering-Rice et al., 2011). The collected DEP EtOH residue was produced with an oily, tar-like consistency, similar to the consistency of the WSPM and CS used in this study. The 12 Figure 1: Schematic representation of the device used to collect wood smoke particulate material (WSPM). Reprinted with permission from (Shapiro et al., 2013). Copyright 2013, American Chemical Society. 13 Figure 2: Anderson cascade impactor stages (silver collection disks) showing the relative mass and size distribution of pine PM collected for this study. The residue on the stages indicate deposited WSPM with the black denoting highest concentrations of particle, brown (medium), and silver is the lowest. Reprinted with permission from (Shapiro et al., 2013). Copyright 2013, American Chemical Society. 14 Figure 3: Schematic representation of the device used to collect Cigarette Smoke (CS). Reprinted with permission from (Shapiro et al., 2013). Copyright 2013, American Chemical Society. 15 method for isolating CS is outlined in Figure 3 and was conducted in a collaborating lab, using the Massachusetts Standard smoking Regimen and a single port smoking machine with unblocked vent holes and 3R4F reference cigarettes (from the University of Kentucky Tobacco Health Research Institute). Both the CS and DEP residues were collected into a pre-weighed tube for accurate measurement of particle residue mass. Preparation of Particle Treatment Solutions: Liquid suspensions of WSPM, DEPEtOH, and CS were created for cell treatment. The dry particles stored at -20oC were resuspended to a concentration of 115-230 mg/mL in DMSO. This stock was then used for further dilutions in LHC-9 medium (Invitrogen) to the concentrations used for treatments, with the final DMSO concentration being below 1% (v/v) for all treatments. Particle concentrations for treatment were chosen for their ability to induce robust and specific activation of TRPA1, while still being low enough to allow GSH to reduce electrophilic species in the sample allowing significant reduction of potency of activation for wild-type TRPA1. The working concentrations for each study are outlined in Table 1. Cloning: HEK-293 cell lines were generated to selectively over-express various human TRP channels prior to my entry into the lab, as previously described for TRPA1 TRPC4α, TRPM8, TRPV2, TRPV4 (Deering-Rice et al., 2011), and TRPV1 (Reilly et al., 2003). Generation of the TRPA1 ST Mutant: For screening studies with the TRPA1 ST mutant, over-expressing cell lines were not generated. Rather, HEK-293 cells were transiently transfected with the mutant TRPA1 DNA ~48 hours prior to each assay. Generation of the TRPA1 ST mutant, which is a loss of function mutant for the mentholbinding site on TRPA1 (Xiao et al., 2008), was performed using the QuickChange XL 16 Table 1: Particle concentrations used for the studies in this thesis. 17 site-directed mutagenesis kit (Stratagene, La Jolla, CA) as recommended by the manufacturer using the following primers: TRPA1-S873V/T874L (+) 5’GTTGGAGGTAATTTTGAAAACTTTGTTGAGGGTTTTAGTTGTATTTATCTTCCT TCTTCTGGCTTTT-3’; and (-) 5’-AAAAGCCAGAAGAAGGAA GATAAATACAACTAAAACCCTCAACAAAGTTTTCAAAATTACCTCCAA C-3’. Transient Transfection: Transient transfection of HEK-293 cells with the TRPA1 ST mutant and wild-type TRPA1 is outlined in Figure 4. Lipofectamine 2000 (Invitrogen) was used for transfection. Transfection was conducted as described in Figure 4. The first incubation allows for OPTI-MEM to form micelles, while combination of the plasmid and lipofectamine allows the Lipofectamine micelles to encapsulate the plasmid. 50 µL of this plasmid mixture was added to confluent HEK-293 cells in a 96well plate at a concentration of 175 ng/well. 50 µL of “recovery media” (DMEM:F12 supplemented with 5% FBS) was added ~ 3 hours prior to transfection for a partial recovery from transfection. ~24 hours after transfection, the media was replaced with 150 µL of recovery media and the cells were allowed to grow for an additional 24 hours before they were used for calcium assays. Cell Culture: HEK-293 cells (ATCC; Rockville, MD) and HEK-293 cells stably over-expressing various TRP channels were grown in a humidified cell culture hood at 37oC with a 95% air:5% CO2 atmosphere. HEK-293 cell lines were grown in DMEM:F12 media containing 5% fetal bovine serum. Human adenocarcinoma (A549) cells (ATCC; Rockville, MD), were grown in DMEM containing 5% FBS. For sub-culturing, all cell lines were incubated with trypsin for three minutes to detach cells from the growth flask. 18 Figure 4: Transient transfection protocol. (A) TRPA1 plasmid was combined in OPTIMEM media and incubated for five minutes in the dark at room temperature. (B) The Lipofectamine and plasmid were combined at a ratio of 2:1 lipid:DNA and incubated together for 20 minutes at room temperature. (C and D) 50 µL of this plasmid mixture was then added to confluent HEK-293 cells in a 96-well plate at a concentration of 175 ng/well. 19 Cells were then resuspended in the correct growth medium, counted, and plated into new flasks. Calcium Imaging Assays: For calcium imaging assays, cells were plated in 96 well plates coated in 1% gelatin (for HEK-293 cells only) and grown to 80-90% confluence. Cells were then loaded with Fluo 4-AM dye solution diluted 1:1 with LHC-9 (HEK-293 cells) or calcium buffer (1X HBSS, 20 mM HEPES, pH 7.3; A549 cells) containing probenicid (1mM). The cells were incubated in the dark for one hour at 37°C (HEK-293 cells) or room temperature (A549 cells) to allow the Fluo 4-AM dye to enter the cells, where it is subsequently cleaved by esterases and trapped in the cells and acts as a flourogenic calcium ion chelator. Cells were then washed with LHC-9 media or calcium buffer (for HEK-293 and A549 cells, respectively) containing 1 mM probenecid and 0.75 mM trypan red (ATT Bioquest) and incubated at 37°C (HEK-293 cells) or room temperature (A549 cells) for 30 minutes. For calcium assays, 25 uL of treatment solution containing particles and other agonists was added to 50 uL of media in the 96 well plate for treatments. Agonists were made at 3X concentrations with the final concentration reaching the cells being the reported 1X treatment concentration. When used, HC030031, a selective antagonist of TRPA1, was added to the wash buffer for NOVOStar assays or immediately before and with agonist/particle treatments for microscope-based assays. Activation of TRP channels was measured as the relative change in intracellular florescence as caused by Ca2+ influx into the cell and subsequent binding to Fluo 4-AM dye to produce fluorescence. Thus, TRP channel activation can be measured by measuring changes in cellular fluorescence (Figure 5). These changes in fluorescence were quantified using either fluorescence micrographs for microscope-based calcium 20 Ca ++ Fluo-4-AM TRPA1 ER Ca ++ Fluo-4-AM Ca TRPA1 Nucleus esterase ++ Fluo-4 Ca - Fluo-4 ++ - Figure 5: A schematic depicting calcium assays with Flou-4-AM. Fluo 4-AM dye enters the cells, where it is subsequently cleaved by esterases and trapped in the cells. Trypan red and probenecid function as efflux inhibitors to prevent Fluo-4 AM dye from leaking out of the cell, while trypan red additionally functions to decrease background during the assay. TRP channel activation causes Ca2+ influx into the cell. Fluo 4-AM is able to bind to Ca2+ and fluoresce. Thus, TRP channel activation can be measured by measuring changes in cellular fluorescence. 21 assays or using a NOVOStar fluorescence plate reader (BMG Labtech; Offenberg, Germany). For microscope-based assays, cells were treated with particles followed by treatment with ionomycin (10 µM) to produce the maximum possible calcium flux. Data were collected as the maximum response to treatment normalized to the response obtained with ionomycin. For mechanistic studies, data was additionally normalized to the AITC response for each construct. For NOVOStar fluorescence plate reader assays, data was represented as the maximum change in cellular fluorescence after subtraction of untreated wells. Mouse Trigeminal Neuron Calcium Imaging Assays: Primary mouse trigeminal (TG) neurons were chosen as a general model for responses of pulmonary sensory neurons to WSPM. TG were isolated from 3-week old C57B1/6 mice as described (Light et al., 2008). Briefly, the mice were anesthetized with isoflurane and euthanized by cervical dislocation. The TG neurons were then isolated and placed into Hank’s balanced salt solution. Each TG was then cut in half and treated with trypsin for a 12-minute incubation. Cells were then washed with MEM (Invitrogen) containing 10% fetal bovine serum (Hyclone), 2.4% glucose, 1% glutamax (Invitrogen), and 1% penicillin/ streptomycin (Atlanta Biological B2110). The TG neurons were then disrupted by trituration using a series of four fire-polished glass pipettes of decreasing diameter. Cells were then pre-plated at 37 °C for one hour to remove debris and non-neuronal cells. All cells not attached to the pre-plating dish were then collected and centrifuged at 110 x g for 5 minutes, resuspended, and plated into poly-L-lysine treated 8 well plates containing a silicone ring to decrease the diameter of the plate but allowing for larger volumes of media to be added to the well. 30 µL of cells were placed into a 0.5-mm-diameter 22 opening in the center of a 4-mm-thick silicone ring placed in each well. One hour after plating, 500 uL of media containing 10 ng/mL GDNF (glial-derived neurotrophic factor; Preprotech 450-10) was added to each well. 24 hours after plating, cells were prepared for calcium imaging assays by loading with Fura-2 AM (Molecular Probes) for one hour. Fura-2 AM dye enters the cells in a manner similar to Fluo-4 AM dye as described above and in Figure 5. TG neurons were then washed with 500 uL media oxygenated to pH 7.4 that lacked ATP (145 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM citrate, 10 mM glucose, 10 mM MES, 10 mM HEPES). Changes in fluorescence were measured using the Meta Imaging Series Metafluor program (Universal Imaging). All treatments/agonists and antagonists were added in a sequential manner. Two pipettes were used, one to aspirate media from the cells and one to place new media/ treatment on the cells and add buffer between treatments. Pine PM was prepared at concentrations shown in Table 1 in LHC-9 containing 0.2% v/v DMSO and 0.2% v/v ethanol. Cells were treated with pine PM, then buffer treated with 50 µM AITC to identify neurons expressing TRPA1, then treated with KCl (50 mM) to identify the neurons. For studies with TRPA1 antagonists, HC-030031 (50 µM) was added 30 second prior to treatment with pine, added as part of each wash buffer, and in the pine and AITC treatments. For analysis, only neurons (identified by response to KCl) were used and data was represented as a percentage of total neurons responding to each treatment relative to their response to KCl. qPCR Analysis of TRPA1 Expression in Human Cells: qPCR analysis of TRPA1 expression was conducted as previously described (Shapiro et al., 2013). Expression values for TRPA1 were normalized to expression values of β2-microglobulin (β2M). Primers used for qPCR were as follows: Primer sequences were: β2M (+) 5’ – 23 GATGAGTATGCCTGCCGTGTG – 3’ and (-) 5’ – CAATCCAAATGCGGCATCT – 3’; human TRPA1 (+) 5’ – TCACCATGAGCTAGCAGACTATTT – 3’ and (-) 5’ – GAGAGCGTCCTTCAGAATCG – 3’. Statistical Analysis: Values represent the mean ± SEM unless otherwise stated. One-way or two-way ANOVA with post-testing at the 95% confidence interval was used to determine significance, as indicated in each figure legend. 24 RESULTS Figure 2 shows the distribution of pine PM on the cascade impactor used during WSPM production. The collected WSPM can be visualized as the dark material on the silver impactor plates. The majority of PM were in the fine particle range, collected on stages 5 and 6, and corresponded to particles between 0.65 and 2.1 microns. The least amount of PM collected corresponded to the coarse particle size, collected on stages 1 and 2, and had diameters ranging between 4.7-10 microns. An identical pattern of deposition was observed for mesquite WSPM, with a less oily, more carbonaceous particle (data not shown). Pine and mesquite WSPM on stage 5 (1.1-2.1 μm) were chosen for initial screening and activation studies due to the abundance of material collected in this size range. A screen of the activation of various TRP channels by pine and mesquite WSPM revealed that TRPA1 and TRPV3 were significantly activated by both pine and mesquite WSPM. Small, but non-significant activation by pine and mesquite WSPM was observed for TRPC4α, M2 and V2, as compared to the positive controls carbamoyl choline, H2O2, and Δ9-tetrahydrocannabinol, respectively. There was no activation by WSPM observed for TRPM8, V1, or V4 as compared to icilin, nonivamide, and GSK 1016790A, respectively (Figure 6). The concentration-response relationship for TRPA1 activation by WSPM and two chemically similar cdPM was evaluated (Figure 7A). For this experiment, TRPA1 overexpressing HEK-293 cells were treated with suspensions of pine and mesquite WSPM, CS, and DEP-EtOH. Each particle was treated at concentrations of 0, 0.58, 1.15, and 2.3 25 * % ionomycin 100 * ** * 50 * * * * * 3 * * Positive Control Pine Mesquite 2 1 4 TR PV 3 TR PV 2 TR PV TR PV 2 8 TR PM TR PM 1 4α TR PC TR PA 1 N.D. N.D. 0 Figure 6: Activation screen of TRP channels by pine PM (0.73 mg/mL) and mesquite PM (0.73 mg/mL) compared to the prototypical agonist for each channel. Data are the percent maximum response elicited by ionomycin (10 μM) with the vehicle control subtracted. (*) Indicates p<0.05 using ANOVA test. 26 A 250 DEP-EtOH Pine CSC Mesquite ∆Fmax (RFU) 200 * 150 * 100 * 50 0 0.0 *,^ * *,^ *,^ ,° .58 1.15 2.3 Particle Concentration (mg/mL) Change in Fluorescence (RFU) B 3.5 3.0 CSC DEP-EtOH Pine Mesquite 2.5 Treatment 1.15 mg/mL 2.0 1.5 Baseline 1.0 0.5 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 Time (s) Figure 7: (A) Quantitative comparison of TRPA1-mediated calcium flux in human TRPA1-overexpressing HEK-293 cells using pine PM, mesquite PM, cigarette smoke (CS), and diesel exhaust particle-ethanol extract (DEP-EtOH) at different concentrations. Data were collected using a NOVOStar plate reader, blank subtracted, and expressed as the maximum change in cellular fluorescence. (*) Represents a statistical difference relative to DEP-EtOH, (^) indicates a difference relative to pine PM, and (o) represents a difference relative to CS using two-way ANOVA with Bonferroni post-test, p<0.05. (B) Kinetic comparison of TRPA1 activation by 1.15 mg/mL pine PM, mesquite PM, CS, and DEP-EtOH. Reprinted with permission from (Shapiro et al., 2013). Copyright 2013, American Chemical Society. 27 mg/mL. The most potent cdPM was DEP-EtOH. Pine and CS responded with similar intermediate potency, and mesquite WSPM had the lowest potency of particles tested. The concentration of 1.15 mg/mL was chosen to evaluate the kinetics of TRPA1 activation by each cdPM, (Figure 7B). Changes in intracellular calcium content were measured for 72 seconds. During the measurement, DEP-EtOH, reached a maximum change in florescence. Although pine and CS did not reach a maximum by 72 seconds, at longer time periods both cdPM produced the same maximum response as DEP-EtOH. Mesquite WSPM did not reach the same maximum at this dose. To further investigate the differences between pine and mesquite WSPM, activation of TRPA1 was investigated using all WSPM size fractions collected. The change in intracellular calcium resulting from TRPA1 activation in TRPA1 overexpressing HEK-293 cells was measured when cells were treated with 0.73 mg/mL pine from the different stages of the cascade impactor (Figure 8). All pine PM smaller than 1.1 µm activated TRPA1 to the same extent as the prototypical TRPA1 agonist, AITC (150 µM). Overall, as the diameter of the particles increased, the ability to activate TRPA1 decreased. By mass, particles less than 1.1 µm were the most potent activators of TRPA1, followed by particles from 1.1 to 4.7 µm. All pine particles greater than 4.7 µm did not activate TRPA1 significantly compared to the negative control, LHC-9. In comparison, mesquite PM with a diameter less than 2.1 µm were the most potent, while all mesquite particles larger than 4.7 µm did not activate TRPA1 (data not shown), following the same general trend as pine PM. Both TRPA1 and TRPV3 were robustly activated by WSPM (Figure 6). Therefore, TRPV3 activation as a function of particle size was also briefly 28 4 * ∆Fmax (RFU) * * 3 * * 2 * 1 5.8-10 4.7-5.8 3.3-4.7 2.1-3.3 1.1-2.1 0.65-1.1 0.43-0.65 AITC LHC-9 0 Pine Smoke PM Size (0.73 mg/mL) Figure 8: Comparison of TRPA1 activation by different size fractions of pine PM, ranging from 0.43 µm (left) to 10 µm (right), at 0.73 mg/mL in TRPA1-overexpressing HEK-293 cells. LHC-9 represents the vehicle control. AITC (150 µM) was used as the positive control and to determine the maximum value for TRPA1-dependent calcium flux. Data were collected using a NOVOStar plate reader and are expressed as the maximum change in cellular fluorescence (RFU). *Indicates a significant response (p<0.01 using one-way ANOVA and Dunnett’s post-test) compared to vehicle control. Reprinted with permission from (Shapiro et al., 2013). Copyright 2013, American Chemical Society. 29 investigated (Figure 9). Changes in intracellular calcium was measured in TRPV3 overexpressing HEK-293 cells when treated with 0.73 mg/mL of pine PM. Activation of TRPV3 followed the same basic trends as TRPA1 activation by pine PM, with PM <2.1 µm being the most potent. Pine PM below 2.1 µm did not activate TRPV3 significantly more than LHC9. As observed with TRPA1, ability to activate TRPV3 decreased as particle diameter increased. Due to its relative ability to activate TRPA1 and TRPV3 and the high abundance of this material, WSPM from stage 5 (1.1-2.1 µm) was chosen for the remainder of the studies. To assess TRPA1 activation in a model that is relevant to the lungs, the selectivity of pine PM for TRPA1 was studied in isolated mouse TG neurons, which are a general model for human airway C-fiber sensory neurons. Calcium flux was measured using Fura-2 AM. TG neurons were treated with pine WSPM at concentrations of 0.0, 0.023, 0.073, and 0.23 mg/mL. Calcium flux occurred in a concentration-dependant manner (Figure 10A), with responses comparable to that of the prototypical TRPA1 agonist, AITC (50 µM). To determine the part of this response that was attributable to TRPA1, the concentration of 0.073 mg/mL of pine was used to treat TG neurons in the present of the selective TRPA1 antagonist HC-030031 (Figure 10B). The percent reduction in response when co-treating with HC-030031 (50 µM) represents the amount of the total response attributable to TRPA1 activation. Co-treatment with pine reduced the inhibited the response ~90%, which was greater than the ~75% inhibition observed for AITC. The selectivity of TRPA1 was also measured in A549 cells to model non-neuronal cells that express TRPA1 in the lungs. First, it was confirmed by 30 100 * * % ionomycin 80 * 60 * 40 20 N.D. N.D. N.D. N.D. C L ar HC va 9 ca 0. r o 43 l -0 . 0. 65 65 -1 . 1. 1 12. 2. 1 13. 3. 3 34. 4. 7 75. 8 5. 810 0 Figure 9: Comparison of TRPV3 activation by different size fractions of pine PM, ranging from 0.43 µm (left) to 10 µm (right), at 0.73 mg/mL in TRPA1-overexpressing HEK-293 cells. LHC-9 represents the vehicle control. Carvacrol (300 µM) was used as the positive control and to determine the maximum value for TRPA1-dependent calcium flux. Data were collected using a NOVOStar plate reader and are expressed as the maximum change in cellular fluorescence (RFU). *Indicates a significant response (p<0.01 using one-way ANOVA and Dunnett’s post-test) compared to vehicle control 31 35 * 30 25 B Percentage of KCl Response (%) Percentage of KCl Response (%) A * 20 15 10 5 0 50 0.023 0.073 0.230 + HC- 40 30 20 * 10 0 0.000 - HC-0 AITC (50 µM) Pine (mg/mL) Figure 10: (A) Concentration-response analysis for pine PM-induced calcium flux, using Fura-2, in isolated mouse TG neurons. Each data point represents the mean ± SEM value from TG neurons isolated from ≥ three animals. *Indicates a significant increase (p<0.01 using one-way ANOVA and Dunnett’s post-test) in response versus vehicle control. (B) Inhibition of AITC (50 µM)- and pine PM (0.073 mg/mL)-induced calcium flux by the selective TRPA1 antagonist HC-030031 (50 µM). Cells were imaged using the Meta Imaging Series Metafluor program and data are expressed as percentage of maximum response in viable neurons elicited by KCl (50 mM). Each data point represents the mean ± SEM response from ≥ three animals. *Indicates a significant inhibition of calcium flux by HC-030031 (p<0.01 using two-way ANOVA with Bonferroni post-test). Reprinted with permission from (Shapiro et al., 2013). Copyright 2013, American Chemical Society. 32 Pine ( Agonist quantitative PCR that TRPA1 mRNA was expressed by A549 cells (Figure 11A). The expression levels were compared to expression in TRPA1 over-expressing HEK-293 cells and un-transfected HEK-293 cells. Calcium flux in A549 cells was measured in cells treated with various concentrations of pine PM, specifically 0.73, 1.5, and 2.3 mg/mL, and AITC (200 µM). The calcium flux responses were confirmed as being the result of TRPA1 activation by co-treatment with 200 µM HC-030031, which reduced responses nearly ~100%, with the exception of pine PM at 2.3 mg/mL. These data suggest that at this high dose, there is either a non-specific response of A549 cells to pine PM, or other WSPM sensitive calcium channels are activated by pine PM. TRPV1, M8, V3, and V4 are also expressed by A549 cells. With the exception of TRPV3, all of these channels were non-responsive to either pine or mesquite PM at this same concentration (data not shown). Thus this TRPA1-independant response may be due to activation of TRPV3. To investigate the mechanism by which WSPM activates TRPA1, a screen of a diverse group of chemicals representing several major classes of combustion by-products found in wood smoke particles (i.e., fatty acids, aldehydes, ketones, resin acids, furans) were selected for screening as TRPA1 agonists. Selections were based on the relative abundance of the chemical in wood smoke emissions (Jordan & Seen, 2005a; J. J. Schauer, M. J. Kleeman, G. R. Cass, & B. R. T. Simoneit, 2001b) and commercial availability. Additionally, pine needle toxins (Gardner, Molyneux, James, Panter, & Stegelmeier, 1994; Gardner, Pnater, & James, 1999), which show unique side effects upon exposure, were selected and screened for TRP channel activation. The structures of the various chemicals tested and the results for TRPA1 activation are shown in Table 2. 33 6000 Copies TRPA1 per 10,000 B2M A 3000 50 40 30 20 10 0 TRPA1-OE HEK-293 HEK-293 120 - HC-030031 + HC-030031 (200 µM) 100 ∆Fmax (RFU) B A549 80 60 40 20 N.D. 0 AITC (200µM) N.D. Pine (0.73 mg/mL) * Pine (1.5 mg/mL) Pine (2.3 mg/mL) Figure 11: (A) Expression of TRPA1 mRNA in A549 cells. qPCR analysis of TRPA1 expression in TRPA1-overexpressing (TRPA1-OE) HEK-293, A549, and HEK-293 cells. N.D.=none detected. (B) Inhibition of AITC (200 µM)- and pine PM (0.73, 1.5, and 2.3 mg/mL)-induced calcium flux in A549 cells by HC-030031 (200 µM). Data were collected using a NOVOStar plate reader, blank subtracted, and expressed as the maximum rate of change in cellular fluorescence. *Indicates a significant inhibition of calcium flux by HC-030031 (p<0.05 using two-way ANOVA with Bonferroni post-test). Reprinted with permission from (Shapiro et al., 2013). Copyright 2013, American Chemical Society. 34 Table 2: Quantitative analysis of TRPA1 activation (calcium flux) in TRPA1overexpressing HEK-293 cells by representative chemical components of WSPM (250 µM). *Changes in cellular fluorescence were determined microscopically as described in the materials and methods section. Data were blank subtracted and expressed as the percentage of maximum cellular response elicited by ionomycin (10 µM) and normalized to the positive control for TRPA1, AITC (150 µM). N.D. = none detected. Non-specific indicates a comparable response between TRPA1-overexpressing HEK-293 and normal (control) HEK-293 cells. ^Indicates significant difference between HEK-293 and TRPA1 over-expressing HEK-293 cells (p<0.05 using two-way ANOVA with Bonferroni post-test). Reprinted with permission from (Shapiro et al., 2013). Copyright 2013, American Chemical Society. 35 Coniferaldehyde, However, the 3,5-ditert-butylphenol, and aldehydes furfural, perinaphthenone activated TRPA1. 5-hydroxymethylfurfural, glyoxal, 4- hydroxybenzaldehyde, and vanillin did not. The fatty acid, palmitic acid, also failed to activate TRPA1. The resin acids agathic acid and isocupressic acid were TRPA1 agonists, but structurally related abietic acid, dehydroabietic acid, dihydroagathic acid, and tetrahydroagathic acid were not. Isopimaric acid caused extensive calcium flux in both HEK-293 and TRPA1-overexpressing HEK-293 cells and, thus, was not concluded to be a specific TRPA1 agonist. In work not conducted by the author of this study, vanillin, 4-hydroxybenzaldehyde, coniferaldehyde, 5-hydroxymethylfurfural, furfural, glyoxal, perinaphthenone and several other aldehydes and ketones reported to be constituents of WSPM (Bari, 2009; Bergauff, 2008; Fine, Cass, & Simoneit, 2001; Jordan & Seen, 2005a; J. J. Schauer, M. J. Kleeman, G. R. Cass, & B. R. Simoneit, 2001a; Simoneit, 2000) were verified by mass spectrometry in the pine and mesquite PM samples as their 2,4-dinitrophenylhydrazone conjugates (Shapiro et al., 2013). The characteristics of some of the compounds present in WSPM that also activate TRPA1 suggest a second mechanism of action, which does not involve the known electrophilic binding site. From previous studies (Deering-Rice et al., 2011) formaldehyde, acrolein, naphthalene, and hydroquinone, known components of WSPM (Jordan & Seen, 2005a; Schauer et al., 2001b), activate TRPA1 through the electrophilic binding site. However, 3,5-ditert-buytlphenol and other non-electrophilic compounds most likely activate TRPA1 through the known menthol/propofol-binding site. The relative contributions of the electrophile (Hinman, Chuang, Bautista, & Julius, 2006; Macpherson et al., 2007) and the menthol binding sites (Macpherson et al., 2007; Xiao et 36 al., 2008) in WSPM activation of TRPA1 was assessed using the ST mutant, abbreviated ST due to the substitution of serine 873 to valine and threonine 874 to leucine, which results in loss of function for the menthol/propofol binding site, and glutathione (GSH), which should ameliorate activation of TRPA1 via the electrophilic binding site, by preemptively binding WSPM-associated electrophiles prior to cell treatment. Samples of pine and mesquite WSPM were assessed for TRPA1 activation in this manner. For pine PM, concentrations of 0.09 mg/mL, 0.12 mg/mL, and 0.24 mg/mL were tested. For mesquite PM, concentrations of 0.19 mg/mL, 0.37 mg/mL, and 0.73 mg/mL were tested. For both pine and mesquite WSPM, there was no difference between responses observed with the wild-type channel and the ST mutant. However, for both particle types, as concentration increased, the ability of GSH to reduce responses decreased, suggesting that at higher concentrations of WSPM, either GSH looses ability to completely eliminate electrophiles in the samples or responses are occurring though mixed and non-specific mechanisms (Figure 12). Activation by 0.09 mg/mL pine PM and 0.19 mg/mL mesquite PM were compared to activation of TRPA1 by the pine needle toxin agathic acid (75 µM) and 3,5ditert-butylphenol (250 µM). Samples were prepared 10 minutes prior to treatment with and without 20 mM GSH. Treatments were exposed to HEK-293 cells transiently transfected with either TPRA1 wild-type (WT) or the TRPA1 ST mutant. WSPM samples incubated with GSH showed significant loss of potency for TRPA1 on both TRPA1 WT channels and the ST mutant. There was no significant difference for WSPM activation of TRPA1 WT or the TRPA1 ST mutant. There was also no significant difference for WSPM+GSH activation of either wild-type TRPA1 or the TRPA1 ST 37 mutant (Figure 13). Agathic acid showed a small decrease in potency in the TRPA1 ST mutant as compared to TRPA1 WT. Agathic acid samples incubated with GSH showed complete loss of potency for TRPA1 on both TRPA1 WT and TRPA1 ST. 3,5-ditertbutylphenol showed no reduction of potency for samples incubated with GSH, but activation of the ST mutant showed significant loss of potency compared to activation of wild-type TRPA1 (Figure 13). Taken together, these data suggest that activation of TRPA1 by pine, mesquite, and agathic acid is primarily through covalent modification at the electrophile binding site, while activation by 3,5-ditert-butylphenol is primarily through the menthol-binding site. 38 % AITC per Construct A 100 80 60 WT Pine WT Pine+GSH ST Pine ST Pine+GSH 40 * 20 * * 0 0.09 mg/mL % AITC per Construct B 100 80 60 0.12 mg/mL 0.24 mg/mL WT Mesquite WT Mesquite+GSH ST Mesquite ST Mesquite+GSH * 40 20 * * 0 0.19 mg/mL 0.73 mg/mL Figure 12: Mechanism of TRPA1 activation by various doses of WSPM. Responses were compared using HEK-293 cells transiently transfected with either wild-type TRPA1 or TRPA1 ST mutant plasmids. Treatments were with and without pre-incubation of the PM/agonist for 10 min with 20 mM GSH. Changes in cellular fluorescence were determined microscopically. The data are blank subtracted and expressed as the percentage of maximum cellular fluorescence elicited by ionomycin (10 µM) and normalized to the positive control for TRPA1, AITC (150 µM). (A) Elucidation of the mechanism of activation of TRPA1 by pine PM at multiple concentrations, 0.09, 0.12, and 0.24 mg/mL. (B) Elucidation of the mechanism of activation of TRPA1 by mesquite PM at multiple doses, 0.19, 0.37, and 0.73 mg/mL. *Indicates significant reduction in calcium flux due to GSH pre-treatment (p<0.05 using one-way ANOVA with Bonferroni post-test). 39 100 Mesquite PM (0.19 mg/mL) Pine PM (0.09 mg/mL) Agathic Acid (75 µM) 3,5-ditert-butylphenol (250 µM) 80 60 40 ** * * ** * TR T PA RP 1 A1 TR T +G PA RP SH 1- A1 ST -S +G T SH * TR T PA RP 1 A1 TR T +G PA RP SH 1- A1 ST -S +G T SH 0 * * TR T PA RP 1 A1 TR T +G PA RP SH 1- A1 ST -S +G T SH 20 TR T PA RP 1 A1 TR T +G PA RP SH 1- A1 ST -S +G T SH Percentage of AITC Response (%) 120 Figure 13: Elucidation of the mechanism of activation of TRPA1 by pine PM (0.09 mg/mL), mesquite PM (0.19 mg/mL), agathic acid (75 μM), and 3,5-ditert-butylphenol (250 µM). Responses were compared using HEK-293 cells transiently transfected with either wild-type TRPA1 or TRPA1 ST mutant plasmids. Treatments were with and without pre incubation of the PM/agonist for 10 min with 20 mM GSH. Changes in cellular fluorescence were determined microscopically. The data are blank subtracted and expressed as the percentage of maximum cellular fluorescence elicited by ionomycin (10 µM) and normalized to the positive control for TRPA1, AITC (150 µM). *Indicates significant reduction in calcium flux due to GSH pre-treatment (p<0.05 using one-way ANOVA with Bonferroni post-test). **Indicates a significant reduction in calcium flux between wild-type TRPA1 and the TRPA1 ST mutant (p<0.05 using one-way ANOVA and Bonferroni post-test). Reprinted with permission from (Shapiro et al., 2013). Copyright 2013, American Chemical Society. 40 DISCUSSION Exposure to ambient cdPM, especially WSPM, is increasingly being recognized as a cause of many adverse health effects in humans. Many studies have reported increased hospitalization rates due to exacerbation of pre-existing diseases such as asthma, and increased rates of chronic bronchitis, respiratory infection, chronic obstructive pulmonary disease (COPD), and premature death when investigating the effects of PM on human health (Laumbach & Kipen, 2012; Naeher et al., 2007; Noonan, Ward, Navidi, & Sheppard, 2012; Schei et al., 2004). This work identifies TRPA1 as a selective molecular sensor for WSPM in lung cells, which are representative of human airway sensory neurons and cells that express TRPA1. Therefore, TRPA1 may have an important role in the control of respiratory responses to WSPM exposure, and it may be possible to develop therapeutic targets for TRPA1 to protect individuals who are at high risk for developing adverse health effects (e.g., asthmatics, children, elderly) when exposed to WSPM and related cdPM. Environmental particulate matter is a complex mixture of solids, absorbed gasses, and liquid. The adverse health effects associated with WSPM exposure are normally correlated with smaller PM (PM2.5) and are generally formed from combustion derived sources (Dockery, 1994; Pope III, 2000a) including combustion of fossil fuels, vehicle exhaust, and wood combustion (Nogueira, 2009). The formation of PM2.5 occurs later during the combustion process, so it is expected to have more volatile and toxic chemicals absorbed to its surface (S. S. Leonard et al., 2007), which may explain the observed correlation with PM2.5 and adverse reparatory outcomes. The vast majority of 41 WSPM collected for this study were fine PM with diameters less than 2.1 microns (Figure 2). Ambient WSPM is generally derived from a variety of sources including seasonal wild fires and home heating (Dockery, 1994; Laumbach & Kipen, 2012; Naeher et al., 2007; Noonan et al., 2012; Pope III, 2000b). The resulting particles are made up of mostly fine PM which can be stably transported long distances away from its source by wind (Dockery, 1994; Laumbach & Kipen, 2012; Naeher et al., 2007; Pope III, 2000b). This is supported by data from various source appointment studies of environmental PM, which often find tracers for wood/biomass smoke PM, regardless of proximity to a WPSM source (Bari, 2009; Bergauff, 2008; Fine et al., 2001; Jordan & Seen, 2005a; Laumbach & Kipen, 2012; Naeher et al., 2007; Schauer et al., 2001a; Simoneit, 2000). Therefore, it is possible that TRPA1 may contribute to the development of adverse health effects associated with episodes of high air pollution levels, especially if the event is expected to increase WSPM, such as forest or range fires, or cold weather that increases instances of burning inefficient wood/biomass fireplaces and stoves (Laumbach & Kipen, 2012; Naeher et al., 2007; Noonan et al., 2012). The organic fraction of WSPM has been shown to be the most potent form of the WSPM particle (Danielsen et al., 2009; Kocbach et al., 2008). This fraction was collected for each size of WSPM and screened for TRP channel activation. Not surprisingly, TRPA1 was more potently activated by WSPM particles with a smaller diameter (PM2.5). Additionally, chemicals found on these PM2.5 fractions tended to be the most potent activators of TRPA1 (Figure 8). Interestingly, PM of this size are also expected to be more toxic due to their ability to deposit deeper in the lung than larger particles, reaching 42 the alveoli and bronchi, rather than being deposited into the upper airways (S. S. Leonard et al., 2007; Pope III, 2000a). This is the first time that WSPM has been shown to activate TRP channels. However, this finding is not surprising, as the toxic effects of several other cdPM including CS (Andre et al., 2008) and DEP (Deering-Rice et al., 2011) have been linked to TRPA1 activation. Since these cdPM share many common chemical components with WSPM, including formaldehyde, acrolein, and naphthalene (Jordan & Seen, 2005b), it is expected that WSPM will activate TRPA1. Not only did WSPM activate TRPA1 as predicted, but it also activated TRPC4α, M2, and V2, and V3, which have yet to be established as “PM sensors”. In the respiratory tract, TRPA1 is expressed by neuronal cells, including both trigeminal and vagal sensory neurons that express TRPV1, SP, CGRP, and NKA (Bessac & Jordt, 2008; Thomas Taylor-Clark & B. J. Undem, 2006; Taylor-Clark et al., 2008). TRPA1 is also expressed in non-neuronal cells in the lung, including fibroblasts, epithelial, and smooth muscle cells in the lung (Nassini et al., 2012). In the lungs, known agonists for TRPA1 activate vagal sensory nerves to produce cough, bronchoconstriction, and the release of SP, CGRP, and NKA, which causes neurogenic inflammation. In this study, mouse primary TG neurons were chosen to model these observed responses of human vagal sensory nerves to TRPA1 agonists. Support for this model comes from Lee et al., whose work demonstrated that neurogenic inflammation in TG and vagal sensory fibers takes place via the same pathway (Lee & Widdicombe, 2001). It was demonstrated that pine PM induced calcium flux in TG neurons via TRPA1 in a concentrationdependent manner (Figure 10A and 10B). These data suggest that WSPM may lead to 43 neurogenic inflammation in the lungs. These conclusions are supported by research of Andre et al which demonstrated that TRPA1 mediates neurogenic inflammation of cigarette smoke through the α,β-unsaturated aldehydes crotonaldehyde and acrolein (Andre et al., 2008). This finding is additionally supported by the work of Deering-Rice et al which established TRPA1 as the mediator of neurogenic inflammation caused by the electrophilic components of DEP (Deering-Rice et al., 2011). A549 cells were used to determine the activation of TRPA1 in non-neuronal lung cells. This study demonstrates a TRPA1 mediated calcium flux in A549 cells, especially at low pine PM concentrations (Figure 11B), which are more relevant to human exposures. TRPA1 activation in A549 cells and other non-neuronal lung cells has been shown to release IL-8 (Nassini et al., 2012), supporting a possible role for TRPA1 in WSPM induced pulmonary toxicity via non-neurogenic inflammation. Taken together, these data from mouse TG neurons and A549 cells support the hypothesis that TRPA1 is directly activated by WSPM in the respiratory tract and this activation may play a role in the occurrence of the common adverse effects of WSPM in humans. The activation of TRPV3 as a cellular sensor of WSPM was only briefly investigated. TRPV3 is expressed in epithelial cells in the lung, and is also expressed in A549 cells that were used in this study (data not shown). Ongoing studies and data from this study suggest that the activation of TRPV3 may have a limited role in the sensing of environmental WSPM based on the apparent high-dose threshold required to activate it in lung cells, relative to TRPA1. However, activation of TRPV3 may explain the nonspecific response observed at higher doses of pine PM in A549 cells (Figure 11B). 44 While the data presented by this thesis support a role for TRPA1 in mediating WSPM pneumotoxicity, the role of oxidant-mediated lung injury through reactive oxygen species (ROS) present in WSPM to promote pulmonary inflammation and injury is overwhelmingly emphasized in the literature (Barregard et al., 2008; Danielsen et al., 2010; Danielsen et al., 2009; Kocbach et al., 2008; Stephen S. Leonard et al., 2000). Although this study does not specifically test this mechanism, it is possible that TRPA1 may also be involved in this process of lung injury through oxidative processes. The inhalation of PM2.5, specifically WSPM, has been demonstrated to induce oxidative stress and inflammation of the lower airways in humans (Barregard et al., 2008). Additionally, several studies have demonstrated the potential of WSPM to increase oxidative DNA damage and induce lipid peroxidation (Danielsen et al., 2009; Stephen S. Leonard et al., 2000). Several by-products of this oxidative damage, including 4-HNE (Trevisani et al., 2007) and 4-oxononenal (Taylor-Clark et al., 2008), are TRPA1 agonists. Therefore, further research must be done to determine the roles of activation of TRPA1 directly by chemicals on WSPM versus the activation of TRPA1 by by-products of oxidative damage. TRPA1 is differentially activated by the two types of WSPM examined, as demonstrated by the radically different concentration responses for pine and mesquite WSPM (Figure 7). This difference is most likely due to differences in the chemical composition of each WSPM type. Pine, which is an oily wood containing many resinous acids (Caligiani, Palla, & Bernardelli, 2006) and mesquite, which is a dry wood used for smoking, should combust to yield different chemical species. Additionally, during the collection process, it was noted that pine burned to produce a more oil-like substance 45 whereas mesquite produced a more carbonaceous tar-like material, though it was burned under the same conditions. Table 2 shows various known chemicals in WSPM. Agathic acid, isocupressic acid, tetrahydroagathic acid, dihydroagathic acid, dehydroabeitic acid, and abietic acid are pine specific compounds. These various compounds were shown to activate TRPA1 with different potencies and potentially different modes of activation. Finally, TRPA1 has three known mechanisms for activation: An electrophile/oxidant-sensitive site;(Hinman et al., 2006; Macpherson et al., 2007) a site which is selective for menthol and related compounds (Xiao et al., 2008); and a disputed mechanosensitive mechanism (Deering-Rice et al., 2012; Deering-Rice et al., 2011). Some of the known chemical components activate TRPA1 through electrophilic interaction, for example the pine needle toxin agathic acid (Figure 13), while chemicals such as 3,5-ditert-butylphenol activate TRPA1 via the menthol-binding site (Xiao et al., 2008). Both WSPM activated TRPA1 predominantly through the electrophile-binding site (Figure 12 and 13). Based on these results, and supporting results published for DEP (Deering-Rice et al., 2011), and CS (Andre et al., 2008), it is probable that most TRPA1 activating cdPM also activate through the electrophilic binding site. However, the conclusion that cdPM will activate primarily TPRA1 through the electrophilic binding site cannot be generalized to all situations. While many cdPM are chemically similar (Bari, 2009; Bergauff, 2008; Fine et al., 2001; Jordan & Seen, 2005a; Naeher et al., 2007; Schauer et al., 2001a; Simoneit, 2000), there is still much variation in their chemical makeup, and they often differ with respect to their biological activity in different cell, organ, and animal models, or in humans. For example, this study provides evidence that CS, DEP, and two different types of WSPM have different potencies as 46 TRPA1 agonists (Figure 7A and 7B). There are even enough differences in the chemicals adhered to different sizes of PM that each size fraction was shown to have different potency as TRPA1 agonists (Figure 8). This suggests that small differences in the chemical makeup of the starting material can contribute to differences in combustion products and therefore different abilities to act as TRPA1 agonists. Due to the presence of different diverse chemicals on each WSPM and related PM, different PM sensitive ion channels should be studied in addition to TRPA1 (Andre et al., 2008; Deering-Rice et al., 2011; Hazari et al., 2011; Mukhopadhyay et al., 2011; Willis, Liu, Ha, Jordt, & Morris, 2011), including TRPV1 (Costa et al., 2010; Deering-Rice et al., 2012), TRPM8 (Deering-Rice et al., 2011), and TRPV4 (Deering-Rice et al., 2011; Li et al., 2011) in cell, organ, and animal models, and humans. In addition, that the precise chemical composition of the PM being evaluated should be more carefully studied, so that a more accurate knowledge of mechanisms of biological activity can be gained. 47 CONCLUSION The results of this study suggest a potentially important role for TRPA1 in the regulation of pulmonary neurogenic and non-neurogenic responses to WSPM and associated adverse effects on the respiratory system. Exposure to ambient PM, including WSPM, poses a threat to human health, and is increasingly being linked with serious adverse health effects, including increased respiratory related hospitalizations and exacerbation of pre-existing conditions such as asthma, COPD, chronic bronchitis, and death (Albalak et al., 1999; Bruce et al., 2000; Fullerton et al., 2011; Pope III, 2000a; Schei et al., 2004; Sood et al., 2010; Šrám et al., 2005). Due to the serious nature of this problem, and the realistic assumption that some types of PM emissions will never be completely eradicated (e.g. WSPM), it is of increasing importance to discover specific molecular targets upon which various PM acts. The results of this study and several others suggest that TRPA1 plays a central role in mediating neuronal and epithelial responses to various PM, including DEP, WSPM, and cigarette smoke (Andre et al., 2008; Deering-Rice et al., 2011). Discovery of a channel that mediates cellular responses to a wide range of chemicals like TRPA1 is a critical development in the study of PM exposure, as such a versatile molecular mediator could be an important drug target for developing specific treatments to protect individuals from the adverse effects caused by a variety of cdPM such as WSPM. 48 References Albalak, R., Frisancho, A. R., & Keeler, G. J. (1999). Domestic Biomass Fuel Combustion and Chronic Bronchitis in Two Rural Bolivian Villages. Thorax, 54, 1004-1008. Anderson, H. R., Limb, E. S., Bland, J. M., Ponce de Leon, A., Strachan, D. P., & Bower, J. S. (1995). Health Effects of an Air Pollution Episode in London, December 1991. Thorax, 50, 1188-1193. Andre, E., Campi, B., Materazzi, S., Trevisani, M., Amadesi, S., Massi, D., . . . Patacchini, R. (2008). Cigarette smoke-induced neurogenic inflammation is mediated by alpha,beta-unsaturated aldehydes and the TRPA1 receptor in rodents. J Clin Invest, 118(7), 2574-2582. Baraldi, P. G., Preti, D., Materazzi, S., & Geppetti, P. (2010). Transient receptor potential ankyrin 1 (TRPA1) channel as emerging target for novel analgesics and anti-inflammatory agents. J Med Chem, 53(14), 5085-5107. Bari, M. A., Baumbach, G., Kuch, B., Scheffknecht, G. (2009). Wood Smoke as a Source of Particle-Phase Organic Compounds in Residential Areas. Atmospheric Environment, 43, 4722-4732. Barregard, L., Sallsten, G., Andersson, L., Almstrand, A. C., Gustafson, P., Andersson, M., & Olin, A. C. (2008). Experimental exposure to wood smoke: effects on airway inflammation and oxidative stress. Occup Environ Med, 65(5), 319324. Bautista, D. M., Jordt, S. E., Nikai, T., Tsuruda, P. R., Read, A. J., Poblete, J., . . . Julius, D. (2006). TRPA1 mediates the inflammatory actions of environmental irritants and proalgesic agents. Cell, 124(6), 1269-1282. Bergauff, M., Ward, T., Noonan, C., and Palmer C.P. (2008). Determination and Evaluation of Selected Organic Chemical Tracers for Wood Smoke in Airborne Particulate Matter. International Journal of Environmental Analytical Chemistry, 88(7), 473-486. Bessac, B. F., & Jordt, S. E. (2008). Breathtaking TRP channels: TRPA1 and TRPV1 in airway chemosensation and reflex control. Physiology (Bethesda), 23, 360370. Bessac, B. F., & Jordt, S. E. (2010). Sensory detection and responses to toxic gases: mechanisms, health effects, and countermeasures. Proc Am Thorac Soc, 7(4), 269-277. Bessac, B. F., Sivula, M., von Hehn, C. A., Escalera, J., Cohn, L., & Jordt, S. E. (2008). TRPA1 is a major oxidant sensor in murine airway sensory neurons. [Research Support, N.I.H., Extramural Research Support, Non-U.S. Gov't]. J Clin Invest, 118(5), 1899-1910. doi: 10.1172/JCI34192 Birrell, M. A., Belvisi, M. G., Grace, M., Sadofsky, L., Faruqi, S., Hele, D. J., . . . Morice, A. H. (2009). TRPA1 agonists evoke coughing in guinea pig and human volunteers. Am J Respir Crit Care Med, 180(11), 1042-1047. Bruce, N., Perez-Padilla, R., & Albalak, R. (2000). Indoor Air Pollution in Developing Countries: A Major Environmental and Public Health Challenge. World Health Organization, 78(9), 1078-1092. 49 Caligiani, A., Palla, G., & Bernardelli, B. (2006). GC-MS analysis of hashish samples: a case of adulteration with colophony. J Forensic Sci, 51(5), 1096-1100. doi: 10.1111/j.1556-4029.2006.00202.x Costa, S. K., Kumagai, Y., Brain, S. D., Teixeira, S. A., Varriano, A. A., Barreto, M. A., . . . Muscara, M. N. (2010). Involvement of sensory nerves and TRPV1 receptors in the rat airway inflammatory response to two environment pollutants: diesel exhaust particles (DEP) and 1,2-naphthoquinone (1,2-NQ). Arch Toxicol, 84(2), 109-117. doi: 10.1007/s00204-009-0427-x Dai, Y., Wang, S., Tominaga, M., Yamamoto, S., Fukuoka, T., Higashi, T., . . . Noguchi, K. (2007). Sensitization of TRPA1 by PAR2 contributes to the sensation of inflammatory pain. J Clin Invest, 117(7), 1979-1987. Danielsen, P. H., Loft, S., Jacobsen, N. R., Jensen, K. A., Autrup, H., Ravanat, J. L., . . . Moller, P. (2010). Oxidative stress, inflammation, and DNA damage in rats after intratracheal instillation or oral exposure to ambient air and wood smoke particulate matter. Toxicol Sci, 118(2), 574-585. Danielsen, P. H., Loft, S., Kocbach, A., Schwarze, P. E., & Moller, P. (2009). Oxidative damage to DNA and repair induced by Norwegian wood smoke particles in human A549 and THP-1 cell lines. Mutat Res, 674(1-2), 116-122. Deering-Rice, C. E., Johansen, M. E., Roberts, J. K., Thomas, K. C., Romero, E. G., Lee, J., . . . Reilly, C. A. (2012). Transient receptor potential vanilloid-1 (TRPV1) is a mediator of lung toxicity for coal fly ash particulate material. Mol Pharmacol, 81(3), 411-419. Deering-Rice, C. E., Romero, E. G., Shapiro, D., Hughen, R. W., Light, A. R., Yost, G. S., . . . Reilly, C. A. (2011). Electrophilic components of diesel exhaust particles (DEP) activate transient receptor potential ankyrin-1 (TRPA1): a probable mechanism of acute pulmonary toxicity for DEP. Chem Res Toxicol, 24(6), 950-959. Dockery, D. W. (1994). Acute Respiratpry Effects of Particulate Air Pollution. Annual Review of Public Health, 15, 107-132. Dockery, D. W., & III, C. A. P. (1994). Acute Respiratpry Effects of Particulate Air Pollution. Annu. Rev. Public Health, 15, 107-132. Epton, M. J., Dawson, R. D., Brooks, W. M., Kingham, S., Aberkane, T., Cavanagh, J. A., . . . Brown, L. (2008). The Effect of Ambient Air Pollution on Respiratory Health of School Children: A Panel Study. [Research Support, Non-U.S. Gov't]. Environ Health, 7, 16. doi: 10.1186/1476-069X-7-16 Fairley, D. (1990). The Relationship of Daily Mortality to Suspended Particulates in Santa Clara County, 1980-1986. Environmental Health Perspecitves, 89, 159168. Fine, P. M., Cass, G. R., & Simoneit, B. R. (2001). Chemical characterization of fine particle emissions from fireplace combustion of woods grown in the northeastern United States. Environ Sci Technol, 35(13), 2665-2675. Fullerton, D. G., Suseno, A., Semple, S., Kalambo, F., Malamba, R., White, S., . . . Gordon, S. B. (2011). Wood Smoke Exposure, Poverty and Impaired Lung Function in Malawian Adults. The International Journal of Tuberculosis and Lung Disease, 15(3), 391-398. 50 Gardner, D. R., Molyneux, R. J., James, L. F., Panter, K. E., & Stegelmeier, B. L. (1994). Ponderosa Pine Needle-Induced Abortion in Beef Cattle: Identification of Isocupressic Acid as the Principal Active Compound. Journal of Agricultural Food Chemistry, 42, 756-761. Gardner, D. R., Pnater, K. E., & James, L. F. (1999). Pine Needle Abortion in Cattle: Metabolism of Isocupressic Acid. Journal of Agricultural Food Chemistry, 47, 2891-2897. Ghasemi, H., Ghazanfari, T., Yaraee, R., Faghihzadeh, S., & Hassan, Z. M. (2011). Roles of IL-8 in ocular inflammations: a review. Ocul Immunol Inflamm, 19(6), 401412. Hazari, M. S., Haykal-Coates, N., Winsett, D. W., Krantz, Q. T., King, C., Costa, D. L., & Farraj, A. K. (2011). TRPA1 and sympathetic activation contribute to increased risk of triggered cardiac arrhythmias in hypertensive rats exposed to diesel exhaust. Environ Health Perspect, 119(7), 951-957. Hinman, A., Chuang, H. H., Bautista, D. M., & Julius, D. (2006). TRP channel activation by reversible covalent modification. Proc Natl Acad Sci U S A, 103(51), 1956419568. Howard, J., & Bechstedt, S. (2004). Hypothesis: a helix of ankyrin repeats of the NOMPC-TRP ion channel is the gating spring of mechanoreceptors. Curr Biol, 14(6), R224-226. III, C. A. P. (2000). Epidemiology of Fine Particulate Air Pollution and Human Health: Biologic Mechanisms and Who's at Risk? Environmental Health Perspectives, 108(4), 713. Ill, C. A. P. (2000). Epidemiology of Fine Particulate Air Pollution and Human HealthBiologic Mechanisms and Who's at Risk? Environ Health Perspect, 108(4), 713-723. Jordan, T. B., & Seen, A. J. (2005a). Effect of Airflow Setting on the Organic Composition of Woodheater Emissions. Eviron Sci Technol, 39(10), 36013610. Jordan, T. B., & Seen, A. J. (2005b). Effect of Airflow Setting on the Organic Composition of Woodheater Emissions Environmental Scienc Technology, 39(10), 3601-3610. Jordt, S.-E., Bautista, D. M., Chuang, H.-h., McKemy, D. D., Zygmunt, P. M., Ho, E. D., . . . Julius, D. (2004). Mustard oils and cannabinoids excite sensory nerve fibres1 through the TRP channel ANKTM1. Nature (427), 260-265. Karlsson, H. L., Ljungman, A. G., Lindbom, J., & Moller, L. (2006). Comparison of genotoxic and inflammatory effects of particles generated by wood combustion, a road simulator and collected from street and subway. Toxicol Lett, 165(3), 203-211. Kocbach, A., Namork, E., & Schwarze, P. E. (2008). Pro-inflammatory potential of wood smoke and traffic-derived particles in a monocytic cell line. Toxicology, 247(2-3), 123-132. Kocbach Bolling, A., Pagels, J., Yttri, K. E., Barregard, L., Sallsten, G., Schwarze, P. E., & Boman, C. (2009). Health effects of residential wood smoke particles: the importance of combustion conditions and physicochemical particle properties. Part Fibre Toxicol, 6, 29. 51 Laumbach, R. J., & Kipen, H. M. (2012). Respiratory health effects of air pollution: update on biomass smoke and traffic pollution. J Allergy Clin Immunol, 129(1), 3-11; quiz 12-13. Lee, L.-Y., & Widdicombe, J. G. (2001). Modulation of Airway Sensitivity to Inhaled Irritants: Role of Inflammatory Mediators. Environ Health Perspect, 109(4), 585-589. Leonard, S. S., Castranova, V., Chen, B. T., Schwegler-Berry, D., Hoover, M., Piacitelli, C., & Gaughan, D. M. (2007). Particle size-dependent radical generation from wildland fire smoke. Toxicology, 236(1-2), 103-113. Leonard, S. S., Wang, S., Shi, X., Jordan, B. S., Castranova, V., & Dubick, M. A. (2000). Wood Smoke Particles Generate Free Radicals and Cause Lipid Peroxidation, DNA Damage, NFκB Activation and TNF-α Release in Macrophages. Toxicology, 150, 147-157. Li, J., Kanju, P., Patterson, M., Chew, W. L., Cho, S. H., Gilmour, I., . . . Liedtke, W. (2011). TRPV4-mediated calcium influx into human bronchial epithelia upon exposure to diesel exhaust particles. Environ Health Perspect, 119(6), 784793. Light, A. R., Hughen, R. W., Zhang, J., Rainier, J., Liu, Z., & Lee, J. (2008). Dorsal root ganglion neurons innervating skeletal muscle respond to physiological combinations of protons, ATP, and lactate mediated by ASIC, P2X, and TRPV1. J Neurophysiol, 100(3), 1184-1201. Macpherson, L. J., Dubin, A. E., Evans, M. J., Marr, F., Schultz, P. G., Cravatt, B. F., & Patapoutian, A. (2007). Noxious compounds activate TRPA1 ion channels through covalent modification of cysteines. Nature, 445(7127), 541-545. Mei Zheng, Glen R. Cass, James J. Schauer, & Edgerton, E. S. (2002). Source Apportionment of PM2.5 in the Southeastern United States Using SolventExtractable Organic Compounds as Tracers. Environ. Sci. Technol., 36, 23612371. Mukhopadhyay, I., Gomes, P., Aranake, S., Shetty, M., Karnik, P., Damle, M., . . . Khairatkar-Joshi, N. (2011). Expression of functional TRPA1 receptor on human lung fibroblast and epithelial cells. Journal of Receptors and Signal Transduction, 31(5), 350-358. doi: doi:10.3109/10799893.2011.602413 Naeher, L. P., Brauer, M., Lipsett, M., Zelikoff, J. T., Simpson, C. D., Koenig, J. Q., & Smith, K. R. (2007). Woodsmoke health effects: a review. Inhal Toxicol, 19(1), 67-106. Nassini, R., Pedretti, P., Moretto, N., Fusi, C., Carnini, C., Facchinetti, F., . . . Materazzi, S. (2012). Transient receptor potential ankyrin 1 channel localized to nonneuronal airway cells promotes non-neurogenic inflammation. PLoS One, 7(8), 424-454. Nogueira, J. B. (2009). Air Pollution and Cardiovascular Disease. Portuguese Journal of Cardiology, 28(6), 715-733. Noonan, C. W., Ward, T. J., Navidi, W., & Sheppard, L. (2012). A rural community intervention targeting biomass combustion sources: effects on air quality and reporting of children's respiratory outcomes. Occup Environ Med, 69(5), 354360. 52 Pope III, C. A. (2000a). Epidemiology of Fine Particulate Air Pollution and Human Health: Biologic Mechanisms and Who's at Risk? Environmental Health Perspectives, 4, 713-723. Pope III, C. A. (2000b). Epidemiology of Fine Particulate Air Pollution and Human Health: Biologic Mechanisms and Who's at Risk? Environ Health Perspect, 4, 713-723. Reilly, C. A., Taylor, J. L., Lanza, D. L., Carr, B. A., Crouch, D. J., & Yost, G. S. (2003). Capsaicinoids cause inflammation and epithelial cell death through activation of vanilloid receptors. Toxicol Sci, 73(1), 170-181. Schauer, J. J., Kleeman, M. J., Cass, G. R., & Simoneit, B. R. (2001a). Measurement of emissions from air pollution sources. 3. C1-C29 organic compounds from fireplace combustion of wood. Environ Sci Technol, 35(9), 1716-1728. Schauer, J. J., Kleeman, M. J., Cass, G. R., & Simoneit, B. R. T. (2001b). Measurement of Emissions from Air Pollution Sources. 3. C1-C29 Organic Compounds from Fireplace Combustion of Wood. Environ Sci Technol, 35(9), 1716-1728. Schei, M. A., Hessen, J. O., Smith, K. R., Bruce, N., McCracken, J., & Lopez, V. (2004). Childhood asthma and indoor woodsmoke from cooking in Guatemala. J Expo Anal Environ Epidemiol, 14 Suppl 1, 110-117. Shapiro, D., Deering-Rice, C. E., Romero, E. G., Hughen, R. W., Light, A. R., Veranth, J. M., & Reilly, C. A. (2013). Activation of Transient Receptor Potential Ankyrin1 (TRPA1) in Lung Cells by Wood Smoke Particulate Material. Chem Res Toxicol. Sheesley, R. J., Schauer, J. J., Zheng, M., & Wang, B. (2007). Sensitivity of molecular marker-based CMB models to biomass burning source profiles. Atmospheric Environment, 41(39), 9050-9063. doi: 10.1016/j.atmosenv.2007.08.011 Simoneit, B. R. T., Rogge, W.F., Lang, Q., and Jaffe, R. (2000). Molecular Characterization of Smoke from Campfire Burning of Pine Wood (Pinus elliottii). Chemosphere: Global Change Science, 2, 107-122. Sood, A., Petersen, H., Blanchette, C. M., Meek, P., Picchi, M. A., Belinsky, S. A., & Tesfaigzi, Y. (2010). Wood Smoke Exposure and Gene Promoter Methylation are Associated with Increased Risk for COPD in Smokers. [Research Support, N.I.H., Extramural Research Support, Non-U.S. Gov't]. Am J Respir Crit Care Med, 182(9), 1098-1104. doi: 10.1164/rccm.201002-0222OC Šrám, R. J., Binková, B., Dejmek, J., & Bobak, M. (2005). Ambient Air Pollution and Pregnancy Outcomes: A Review of the Literature. Environ Health Perspect, 113(4), 375-382. doi: 10.1289/ehp.6362 Taylor-Clark, T., & Undem, B. J. (2006). Transduction mechanisms in airway sensory nerves. J Appl Physiol, 101, 950-959. doi: 10.1152/japplphysiol.00222.2006.The Taylor-Clark, T., & Undem, B. J. (2006). Transdution Mechanisms in Airway Sensory Nerves. J Appl Physiol, 101, 950-959. doi: 10.1152/japplphysiol.00222.2006.The Taylor-Clark, T. E., McAlexander, M. A., Nassenstein, C., Sheardown, S. A., Wilson, S., Thornton, J., . . . Undem, B. J. (2008). Relative contributions of TRPA1 and 53 TRPV1 channels in the activation of vagal bronchopulmonary C-fibres by the endogenous autacoid 4-oxononenal. J Physiol, 586(14), 3447-3459. Trevisani, M., Siemens, J., Materazzi, S., Bautista, D. M., Nassini, R., Campi, B., . . . Geppetti, P. (2007). 4-Hydroxynonenal, an endogenous aldehyde, causes pain and neurogenic inflammation through activation of the irritant receptor TRPA1. Proc Natl Acad Sci U S A, 104(33), 13519-13524. Willis, D. N., Liu, B., Ha, M. A., Jordt, S. E., & Morris, J. B. (2011). Menthol attenuates respiratory irritation responses to multiple cigarette smoke irritants. FASEB J, 25(12), 4434-4444. Xiao, B., Dubin, A. E., Bursulaya, B., Viswanath, V., Jegla, T. J., & Patapoutian, A. (2008). Identification of transmembrane domain 5 as a critical molecular determinant of menthol sensitivity in mammalian TRPA1 channels. J Neurosci, 28(39), 9640-9651. 54