Quercetin reduces nuclear Nrf2 and increases NFkB in bovine aortic endothelial cells challenged with palmitate

Elevated circulating fatty acids can cause oxidative stress and impair endothelial function, leading to cardiovascular disease. Quercetin, a flavonoid in fruits and vegetables, has been found to lower blood pressure in human and animal models, likely through protecting endothelial cell function. The aim of this study was to determine if quercetin protects endothelial cells challenged by a palmitate-induced oxidative state by activating Nrf2, an endogenous regulator of antioxidant defense. We hypothesized that increased Nrf2 activation by quercetin will prevent NFκB activation and result in lower inflammation in palmitate challenged cells. Confluent bovine aortic endothelial cells (BAECs) were treated with 1 μM quercetin and 500 μM palmitic acid either separately or concurrently for five hours. Nrf2 translocation, reactive oxygen species production (ROS), NFκB translocation, and mRNA expression of inflammatory markers were determined. Treatment with quercetin or palmitate alone increased nuclear translocation of Nrf2. However, concurrent treatment with quercetin and palmitate reduced Nrf2 back to control levels. There were no differences in ROS production between any treatment groups. NFκB nuclear translocation was increased with palmitate treatment alone and after co-treatment with palmitate and quercetin. mRNA expression of IL-8 and MCP-1 (markers of inflammation) increased after palmitate and after concurrent treatment with palmitate and quercetin. In conclusion, quercetin reduced nuclear Nrf2 during palmitate treatment, but exacerbated NFκB activation. Our data indicate that co-treatment of quercetin and palmitate prevents the activation of Nrf2, thereby increasing NFκB translocation and expression of inflammatory genes. These results do not support our initial hypothesis.

QUERCETIN REDUCES NUCLEAR NRF2 AND INCREASES NFκB IN BOVINE AORTIC ENDOTHELIAL CELLS CHALLENGED WITH PALMITATE by Emma Louise Toolson A thesis submitted to the faculty of The University of Utah in partial fulfillment of the requirements for the degree of Master of Science in Nutrition College of Health The University of Utah August 2016 Copyright © Emma Louise Toolson 2016 All Rights Reserved The Univers i ty of Utah Graduate School STATEMENT OF THESIS APPROVAL The thesis of Emma Louise Toolson has been approved by the following supervisory committee members: Thunder Jalili , Chair 4/22/2016 Date Approved Anandh Babu Pon Velayutham , Member 4/22/2016 Date Approved Joan Benson , Member 4/22/2016 Date Approved and by Julie Metos , Chair of the Department of Nutrition and by David B. Kieda, Dean of The Graduate School. ABSTRACT Elevated circulating fatty acids can cause oxidative stress and impair endothelial function, leading to cardiovascular disease. Quercetin, a flavonoid in fruits and vegetables, has been found to lower blood pressure in human and animal models, likely through protecting endothelial cell function. The aim of this study was to determine if quercetin protects endothelial cells challenged by a palmitate-induced oxidative state by activating Nrf2, an endogenous regulator of antioxidant defense. We hypothesized that increased Nrf2 activation by quercetin will prevent NFκB activation and result in lower inflammation in palmitate challenged cells. Confluent bovine aortic endothelial cells (BAECs) were treated with 1 μM quercetin and 500 μM palmitic acid either separately or concurrently for five hours. Nrf2 translocation, reactive oxygen species production (ROS), NFκB translocation, and mRNA expression of inflammatory markers were determined. Treatment with quercetin or palmitate alone increased nuclear translocation of Nrf2. However, concurrent treatment with quercetin and palmitate reduced Nrf2 back to control levels. There were no differences in ROS production between any treatment groups. NFκB nuclear translocation was increased with palmitate treatment alone and after co-treatment with palmitate and quercetin. mRNA expression of IL-8 and MCP-1 (markers of inflammation) increased after palmitate and after concurrent treatment with palmitate and quercetin. In conclusion, quercetin reduced nuclear Nrf2 during palmitate iv treatment, but exacerbated NFκB activation. Our data indicate that co-treatment of quercetin and palmitate prevents the activation of Nrf2, thereby increasing NFκB translocation and expression of inflammatory genes. These results do not support our initial hypothesis. TABLE OF CONTENTS ABSTRACT ....................................................................................................................... iii LIST OF FIGURES ........................................................................................................... vi ACKNOWLEDGMENTS ................................................................................................ vii INTRODUCTION .............................................................................................................. 1 Materials ................................................................................................................. 4 Cell culture .............................................................................................................. 4 Cell treatment .......................................................................................................... 4 Nuclear extraction ................................................................................................... 6 Detection of reactive oxygen species ...................................................................... 7 Western blot ............................................................................................................ 7 mRNA expression ................................................................................................... 8 RESULTS ......................................................................................................................... 10 Quercetin dose response experiments ................................................................... 10 Quercetin stimulates Nrf2 translocation in palmitate impaired endothelial cells 10 Reactive oxygen species ....................................................................................... 11 Quercetin increases NFκB translocation ............................................................... 11 Quercetin increases inflammation in palmitate treated BAECs ........................... 11 DISCUSSION ................................................................................................................... 19 REFERENCES ................................................................................................................. 24 LIST OF FIGURES 1 Nrf2 translocation…………………………………………………………….. 13 2 Fold change in reactive oxygen species………………………………………. 14 3 Cytosolic NFκB translocation……………………………………………….... 15 4 Nuclear NFκB translocation………………………………………………….. 16 5 Ratio of nuclear NFκB to cytosolic NFκB……………………………………. 17 6 mRNA expression of inflammatory and adhesion molecules………………… 18 ACKNOWLEDGMENTS Thank you to my committee for their time and countless hours of mentoring me in more ways than I can say. Thank you to my friends and family for their endless support and encouragement. INTRODUCTION The endothelium, cells lining blood vessels of the body, play a critical role in the pathology of cardiovascular disease (CVD). Healthy endothelial cells produce nitric oxide (NO), which is generated from the combination L-arginine, oxygen, and NADPH, and produced by the enzyme endothelial nitric oxide synthase (eNOS). NO leads to relaxed smooth muscles, vasodilation in resistant vessels, and reduced blood pressure. When smooth muscle cells detect NO, guanylate cyclase is activated, which then results in cyclic guanosin-5'-monophosphate (cGMP) mediated vasodilation (1, 2). However, in the presence of oxidative stress, NO can react with superoxide anion (O2 -), forming the potent cytotoxin, peroxynitrite (ONOO-). Oxidative damage may cause eNOS to become uncoupled and disrupt electrons associated with eNOS, leading to increased O2 - and decreased NO production. Reduced NO production and/or bioavailability is characteristic of endothelial dysfunction and a key event in atherosclerosis, hypertension, and diabetes. Vascular dysfunction is a serious clinical problem that predisposes an individual to various cardiovascular risks such as heart attack and stroke. Elevated plasma levels of free fatty acids are an indicator of visceral adiposity and are often seen in patients with metabolic syndrome (3). High levels of free fatty acids are thought to arise through increased hepatic VLDL synthesis and may contribute to atherosclerosis. Free fatty acids, specifically palmitate at varying concentrations and incubation times, have been shown to increase reactive oxygen species production in 2 endothelial cells (4-6). In cultured endothelial cells, free fatty acids induce expression of adhesion molecules, like VCAM, and inflammatory cytokines (3, 7). Nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) is a transcription factor that upregulates proinflammatory chemokines, cytokines, and adhesion molecules in response to such inflammatory stimuli. As a result, chronic activation of NFκB contributes to atherosclerosis (8, 9). During oxidative stress, transcription factor nuclear factor erythroid 2-related factor-2 (Nrf2) is activated to increase transcription of antioxidant enzymes and manage oxidative stress. Nrf2 is a transcription factor that translocates to the nucleus when a cell is under oxidative stress, and binds to the antioxidant response element (ARE) to then transcribe antioxidant enzymes, such as HO-1 (hemoxygenase). When Nrf2 is silenced, proinflammatory markers are elevated, suggesting greater NFκB activation (10). Increased amounts of ROS have been found to increase phosphorylation of IκBα︎ protein levels (a marker of IKKβ-NFκB signaling) (11). Various kinases, such as ERK, PKC delta, PI3K, and AMPK, have been found to activate Nrf2 (12). Similarly, nutrients have been found to activate Nrf2 translocation, one being quercetin. Quercetin has been studied in high doses and varying cell lines, such as hepatocytes and neuronal cells; however, quercetin stimulated Nrf2 activation has not been studied in endothelial cells (12-14). Our preliminary research demonstrated that quercetin can reduce oxidative stress and prevent impaired NO bioavailability in endothelial cells challenged by hyperglycemic conditions. Polyphenols such as quercetin may attenuate such oxidative damage in an Nrf2-dependent manner (12, 15, 16). It has been proposed that the phenolic 3 hydroxyl groups in polyphenols may act as direct antioxidants, but recent studies suggest that polyphenols may also be able to activate Nrf2 (12, 17). Because reduced NO is an important characteristic of dysfunctional endothelial cells, quercetin treatment may be a promising approach to prevent or treat endothelial dysfunction. It is possible that Nrf2 activation is a key mechanistic event conferring antioxidant protection and subsequent rescue of NO in endothelial cells challenged by hypertriglyceridemia or hyperglycemia. For this study, we hypothesized that quercetin would activate Nrf2 in cells challenged with hypertriglyceridemia. Additionally, we postulated that quercetin would reduce NFκB and inflammatory genes it transcribes due to NFκB acting as a link between Nrf2 and the inflammatory state of endothelial cells. MATERIALS AND METHODS Materials Quercetin was purchased from Sigma Chemical (St. Louis, MO). Bovine aortic endothelial cells (BAECs) were from Lonza and generously donated by Dr. Dave Symons. All other reagents were purchased from Sigma-Aldrich unless otherwise stated. Cell culture BAECs were cultured in Dulbecco's Modified Eagle's Medium (DMEM) containing 10% fetal bovine serum (FBS), 1% penicillin/streptomycin, and a pH of 7.4. BAECs were cultured in a controlled, humidified environment consisting of 5% CO2, 95% O2, and at 37°C. Media was refreshed daily. At a confluence of approximately 60- 80%, cells in T75 or T150 flasks were split and transferred to appropriately sized flasks or plates for further growth or treatment. Cell treatment From a T75 flask, cells were split into two T150 flasks for further growth or into plates for experiments. Cells were detached from flasks by adding 0.5% trypsin-EDTA (GIBCO, Carlsbad, California). Flasks were thoroughly washed with 0.5% trypsin according to the surface area of the flask [e.g., for a T75 flask (75 cm2) 2 - 2.5 ml trypsin was used; a 100 mm petri plate (44 cm2) 1 ml trypsin was used]. Trypsin was aspirated 5 and cells were treated again with 0.5% trypsin. Flasks with trypsinized cells were incubated at 37°C with 5% CO2 and 95% O2 for five minutes. Cells were then checked under a microscope to ensure all were detached from the flask. Once cells were detached, the appropriate volume of DMEM medium was added to trypsinized cells and allocated accordingly. BAECs were treated between passage three and six. In each sample group, there were four to eight groups depending on the aim of the experiment. Groups included: BSA (bovine serum albumin), BSA + quercetin, BSA + palmitate, BSA + palmitate + quercetin. BSA (Desert Biologicals, Sandy, UT) was used to make palmitate soluble in solution and acted as a control. Prior to treatment, BAECs were serum starved for 4-12 hours in serum and supplement free medium. BAECs were serum starved for 4-12 hours due to collaborators having success serum starving anywhere from 4 to 12 hours. Additionally, literature suggests a range of duration of serum free treatment is appropriate for BAECs (18, 19). BAECs were treated concurrently with 1 μM quercetin, a physiologically relevant dose, 500 μM palmitic acid for five hours in DMEM media with 1% FBS. Palmitate was coupled to fatty-acid free BSA in a ratio 2 mol/L palmitate to 1 mol/L BSA. After polyphenol and high fat treatment, BAECs were washed twice with ice cold PBS (Gibco, Carlsbad, CA). Plates were then stored in -80°C or harvested. Cells were cultured to yield a sample size of three to six for each group, depending upon the experiment done. Lysis buffer consisted of RIPA lysis buffer (Fisher, Carlsbad, CA), protease inhibitor cocktail (Sigma), and phosphatase inhibitor cocktail (Sigma) to harvest the proteins. While on ice, plates with lysis buffer were put on a shaker for 15 minutes. Next, plates were thoroughly scraped to ensure cell detachment. Lysate was then aspirated into 6 a pipet and put in labeled eppendorf tubes. Each sample of lysate was sonicated three times for five seconds each. After which, samples were centrifuged at 4°C and 13,500 rpm for 10 minutes to separate the pellet from supernatant. Supernatant was removed from pellet and put into new eppendorf tubes. A BCA protein assay kit (Thermo Scientific, Waltham, MA) was used to determine protein concentrations of samples. Sample lysate was then stored in -80°C or used for experiments. Nuclear extraction A nuclear extraction kit was purchased from Epigentek. BAECs were grown to 70-80% confluence in DMEM with 10% FBS. Media was removed and cells were washed twice with PBS. Four ml of PBS was added to plates, scraped, and put in a 15 ml conical tube. Cells were centrifuged for five minutes at 1,000 rpm. Supernatant was discarded and pellet was resuspended in 200 μl nuclear extraction reagent per 106 cells. Nuclear extraction reagent contained dithiothreitol (DTT) and a protease inhibitor cocktail (PIC). Cells were incubated on ice for 10 minutes, vortexed vigorously for 10 seconds and then centrifuged for one minute at 12,000 rpm. Cytoplasmic protein fraction was quantified and used for western blots. Pellet of nuclear extract was resuspended in two volumes of a second nuclear extract reagent (about 10 μl per 106 cells). The extract was incubated on ice for 15 minutes and vortexed for five seconds every three minutes. Extracts were further sonicated three times, five seconds each, to increase nuclear protein extraction. Suspension was centrifuged for 10 minutes at 14,000 rpm and 4°C. Supernatant was 7 collected and saved for further application. Nuclear and cytosolic lysates were then probed for Nrf2 or NFκB to determine nuclear translocation. Detection of Reactive Oxygen Species (ROS) A cell-based assay (Fisher, Carlsbad, CA) was used to detect hydroxyl, peroxyl, and other ROS within BAECs. The assay uses the cell-permeable fluorogenic probe: 2', 7' dichlorodihydrofluorescein diacetate (DCFH-DA). After five hours of palmitate or quercetin exposure, media in each well was aspirated, cells were detached with trypsin and treated with 10 μM DCF diluted in PBS with 0.2% FBS. After 30 minutes, fluorescence, and therefore ROS production, was measured using a plate reader at wavelengths of 485nm (excitation) and 528nm (emission). Ten minutes of 10 mM H2O2 was used as positive control. Western blot Samples were prepared by diluting three parts sample to one part sample buffer, which consisted of 4x Laemmli sample buffer (Bio-Rad, Hercules, CA) and DTT. Samples were loaded into a SDS polyacrylamide gel with a gradient range of 4-20%. Samples were loaded at a concentration of 30-40 μg per lane. Electrophoresis was run at a constant of 40 milliamps for approximately two hours. After electrophoresis, proteins in gels were transferred to nitrocellulose membranes via a Turbo Transfer (Bio-Rad, Hercules, CA) for 10 minutes at 25 V and 2.5 A constant. Bands were checked via incubation with 0.1% Ponceau red dye for ten minutes. Membranes were blocked for one hour with Odyssey Blocking Buffer (Licor, 8 Lincoln NE) to prevent nonspecific binding of primary and/or secondary antibodies. Next, membranes were incubated overnight at 4 °C or for one hour at room temperature on a rocker with primary antibodies at a dilution of 1:1000. The following primary antibodies were used: NFκB (Cell Signaling, mouse, cat. no. 6956S), Nrf2 (Abcam, rabbit, cat. no. 76026), Histone 3 (Abcam, rabbit, cat. no. 4729), and actin (Santa Cruz, rabbit, catalog number: sc-1616-R). Membranes were washed with PBS-T three times, five minutes each. Membranes were then incubated in secondary antibodies for one hour in a UV protected container, at room temperature. Secondary antibodies were purchased from Licor and were either goat anti-rabbit (cat. no: 926-68071) or goat anti-mouse (cat. no. 926-32210). Secondary antibodies were diluted in 10 ml Odyssey Blocking Buffer (Licor, Lincoln NE) with 10% Tween20 to yield a 1:5000 dilution. Membranes were washed with PBS-T and then scanned with a Licor infrared scanner to quantify band densities. mRNA expression BAECs were grown to 80-90% confluence and treated as previously stated. mRNA were isolated with Qiagen RNasey Plus Mini Kit (Valenica, CA). Concentration of mRNA in each sample were quantified using the nanodrop method. mRNA was used to synthesize cDNA, again using Qiagen qPCR reagents such as genomic DNA buffer, reverse transcriptase buffer and primer mix. After cDNA synthesis, SYBR Green was added to samples in order to detect desired mRNA targets. Expression of the following adhesion and inflammatory markers were measured: ICAM-1 (intracellular adhesion molecule 1), VCAM (vascular cell adhesion prtein 1), E-selectin, IL-8 (interleukin-8), 9 MCP1 (monocyte chemoattractant protein-1). All bovine specific primers were manufactured in the University of Utah Core Facilities and generously donated by Dr. Dave Symons (see Table 1 for forward and reverse sequences used). GAPDH was synthesized by Applied Biosystems and used to normalize all endpoints. Threshold cycles (Ct's) were quantified for each target as previously described (20). Table 1. Primer sequences. Bovine specific primers and their sequences used for qPCR experiments Gene Primer sequence (5'-3') ICAM-1 For GCCAGCGACCACAGGAGCAACT Rev GCCCAGAGCACCCAAGATGAGG IL-8 For TGGGCCACACTGTGAAAAT Rev TCATGGATCTTGCTTCTCAGC MCP-1 For CAAGTCGCCTGCTGCCTATAC Rev AGAGGGCAGTTAGGGAAAGC E-SELECTIN For GCAGCCATCAGCCATCCTCA Rev GGCAGCATCCCAGACCAGTGT GAPDH For GGCGTGAACCACGAGAAGTATAA Rev CCCTCCACGATGCCAAAGT RESULTS Quercetin dose response experiments The concentration of quercetin used in this study was based on preliminary dose response experiments to measure Nrf2 activation. Quercetin was incubated at 0, 0.1, 1, and 10 μM concentrations to determine the optimum dose that results in Nrf2 activation. The lowest effective dose was 1 μM, and was subsequently used throughout the study. A time dose experiment was also done with quercetin at 1 μM. Two time points, three hours and six hours post-quercetin treatment (1 μM) were tested. There was greater Nrf2 activation at six hours vs. three (data not shown). The concentration and duration of palmitate (500 μM, 5 hours) was based on previous literature (5). Quercetin stimulates Nrf2 translocation in palmitate impaired endothelial cells To determine Nrf2 activation, we examined Nrf2 translocation from the cytosol to nucleus in quercetin and palmitate treated BAECs. Five hours of quercetin treatment significantly increased Nrf2 nuclear translocation compared to baseline. Palmitate treatment alone also increased nuclear Nrf2 translocation compared to baseline. After concurrent treatment with palmitate and quercetin, Nrf2 translocation decreased to control levels, and was significantly lower than quercetin and palmitate only treated cells (Figure 1). 11 Reactive oxygen species ROS was measured using the fluorescent probe DCFH-DA. Compared to control conditions, quercetin treatment did not change ROS levels nor did palmitate incubation (Figure 2). Co-incubation of quercetin and palmitate were also similar to control (Figure 2). Quercetin increases NFκB translocation NFκB activation was determined by nuclear translocation of NFκB in quercetin and palmitate treated BAECs. Cytosolic (Figure 3) and nuclear (Figure 4) NFκB was assessed and normalized to loading controls, after which a ratio of nuclear to cytosolic NFκB was calculated (Figure 5). Cytosolic levels of NFκB were similar between all conditions (Figure 3). Nuclear levels of NFκB were similar between control, quercetin, and palmitate treated conditions (Figure 4). However, nuclear levels of NFκB were increased when quercetin was co-incubated with palmitate (Figure 4). There were no differences in the ratio of nuclear to cytosolic NFκB (a measure of nuclear translocation / activation) between control and quercetin treated groups. There was a trend (P=0.068) for greater nuclear to cytosolic ratio of NFκB in palmitate treated cells (Figure 5). There was a significant increase in nuclear to cytosolic ratio of NFκB in cells co-treated with quercetin and palmitate (Figure 5). Quercetin increases inflammation in palmitate treated BAECs To determine the effect of quercetin on inflammatory markers and adhesion molecules, mRNA expression was measured for ICAM, E-selectin, IL-8, and MCP1. 12 Expression of ICAM and E-Selectin was similar across all groups (Figure 6). Both IL-8 and MCP-1 expression were similar after quercetin treatment, but significantly increased by palmitate. Simultaneously treating with quercetin and palmitate also resulted in increased IL-8 and MCP1 expression (Figure 6). 13 Figure 1. Nrf2 translocation. Nrf2 translocation from the cytosol to the nucleus in bovine aortic endothelial cells treated with quercetin, palmitate, or both for five hours. Different letters denote significant differences; p < 0.05; n=4. 14 Figure 2. Fold change in reactive oxygen species. Average fold change in reactive oxygen species in bovine aortic endothelial cells treated with 1 μM quercetin (Q) or 500 μM palmitate (P) for five hours. 15 Figure 3. Cytosolic NFκB translocation. Translocation of NFκB in bovine aortic endothelial cells treated with quercetin or palmitate for five hours. Different letters denote statistically significance. p < 0.05 (n=4). 16 Figure 4. Nuclear NFκB translocation. Nuclear translocation of NFκB in bovine aortic endothelial cells treated with quercetin or palmitate for five hours. n = 4. Different letters denote statistically significance. p < 0.05 17 Figure 5. Ratio of nuclear NFκB to cytosolic NFκB. Ratio of nuclear NFκB to cytosolic NFκB in bovine aortic endothelial cells treated with quercetin (Q) or palmitate (P) for five hours. n = 4. Different letters denote statistical significance. p < 0.05 18 Figure 6. mRNA expression of inflammatory and adhesion molecules. mRNA expression of inflammatory and adhesion molecules in bovine aortic endothelial cells treated for three to five hours with 1 μM quercetin, 500 μM palmitate. Different letters denote significant difference; P < 0.05. (n = 3) DISCUSSION In this study, we found that co-incubation with quercetin (1 μM) and palmitate (500 μM) reduces Nrf2 translocation and increases NFκB in bovine aortic endothelial cells. Additionally, we found an increase in proinflammatory cytokines and chemokines (IL8 and MCP1) with palmitate and quercetin. Proper function of endothelial cells helps maintain cardiovascular health; however, a dysfunctional endothelium contributes to cardiovascular disease. To this end, understanding the molecular action of quercetin on endogenous cellular antioxidant defense and inflammation is required before future recommendations can be made regarding dietary intake of quercetin and treatment strategies employing this flavonoid. In this study, we found an increased translocation of Nrf2 with quercetin and palmitate treatment (Figure 1). This is consistent with other studies that have found activation of Nrf2 with both protective and damaging reagents, such as sulforaphane, TNFα, and palmitic acid (21-23). However, there are no data regarding Nrf2 in quercetin treated endothelial cells. Nrf2 may be activated by polyphenols in different cell lines than were used in our study (24). For instance, in hepatocytes, quercetin increased Nrf2 translocation in a dose-dependent manner and thus prevented proteasomal degradation of Nrf2 (14). In this case, as well as in our study, quercetin may be acting as an electrophile to increase nuclear translocation of Nrf2 binding to the antioxidant response element (ARE) on promoter regions. More specifically, quercetin has been 20 reported to have an inhibitory action by preventing ubiquitination and thus degradation of Nrf2 (14). When palmitate and quercetin were given simultaneously, there was a marked decrease in Nrf2 translocation (Figure 1). This suggests that downstream from Nrf2, transcription of antioxidant enzymes would be reduced and risk for oxidative damage to the endothelium increased. This has been shown in myocytes where gene silencing of Nrf2 resulted in increased oxidative stress and decreased transcription of antioxidant genes (25). It has been hypothesized that oxidants, like high concentrations of palmitic acid, and electrophiles stimulate Nrf2 and can modify cysteine residues on Kelch-like ECH-associated protein 1 (Keap1), a regulatory subunit of Nrf2, causing a conformational change in Keap1 and thereby eliciting dissociation of Nrf2 from Keap1 (26). It is also postulated that rather than modifying cysteine residues on Keap1, oxidants or electrophiles mediate proteasomal degradation of Keap1 and thus de novo synthesis of Nrf2 (14, 27). We speculate that quercetin may act as an electrophile in our model, thereby suggesting a potential explanation as to why Nrf2 increased with quercetin treatment. However, it is unclear why the combination of quercetin and palmitate reduced Nrf2 activation back to control levels. Nrf2 and NFκB can be regulated by the same kinase-p38 mitogen-activated protein kinase (MAPK) (28, 29). As a result, perhaps co-treatment activated p38 and led to no Nrf2 activation. NFκB is a transcription factor that plays a major role in upregulating pro-inflammatory cytokines, chemokines, leukocyte adhesion molecules, and inflammatory enzymes (30, 31), which can mediate atherosclerosis. When there is a chronic excess of inflammatory molecules, such as during diabetes or hypertriglyceridemia, the 21 endothelium becomes dysfunctional and atherosclerosis develops (31). The most abundant form of NFκB is a p50/p65 heterodimer and is associated with a cytoplasmic inhibitory protein, IκBα, in un-stimulated states. When cells are exposed to inflammatory stimulants, inhibitor κB kinase (IKKβ) phosphorylates and degrades IκBα, followed by nuclear translocation and activation of p50/p65 (32). Once in the nucleus, p50/p65 binds to promoters for NFκB-dependent adhesion marker/inflammatory genes, such as ICAM, E-selectin, IL-8, and MCP-1, and regulates genes involved in atherosclerosis (33, 34). It was unexpected that in our study we observed an increase in NFκB translocation when cells were treated concurrently with palmitate and quercetin (Figure 5). The literature suggests that polyphenols, in general, have a protective affect and inhibit NFκB and thereby downstream cytokines and chemokines (35, 36). Based on our results, however, perhaps quercetin is acting through a different pathway than outlined above given that quercetin co-treatment with palmitate failed to improve inflammatory markers and NFκB signaling. We speculate that since Nrf2 was downregulated by co-treatment of quercetin and palmitate, the resultant potential impairment in cellular antioxidant defense may have led to greater NFκB translocation. Activation of NFκB has been reported to increase transcription of endothelin-1, ICAM-1, E-selectin, VCAM-1, and pro-inflammatory cytokines like IL-1, IL-6, and tumor necrosis factor-α (37). Similarly, we found an increase in mRNA expression of IL- 8 and MCP-1 when cells were in the presence of palmitate. However, when BAECs were co-treated with quercetin and palmitate, expression of IL-8 and MCP1 remained elevated, similar to levels observed with palmitate alone. It is plausible that the unchanged status of Nrf2 after co-treatment of quercetin and palmitate led to cellular conditions that 22 favored NFκB activation (Figure 5). Previous studies have reported a similar finding in Nrf2 knockout mice that demonstrate an increase in p65-NFκB as well as increased expression of inflammatory genes downstream from NFκB (38). The link between inadequate Nrf2 activation and NFκB could be via ROS burden in the cell. Production of ROS by various stimuli, such as high fat or hyperglycemic conditions, can activate NFκB (39, 40). While we did not observe any changes in oxidative stress in our study to support this idea, it should be noted that the high degree of variability between our experimental trials made it difficult to obtain consistent results. Therefore, we cannot rule out the presence of elevated oxidative stress based on our data, and the potential for it to activate NFκB. In summary, we have shown that quercetin can increase Nrf2 activation. This effect may be due to quercetin acting as an electrophile to enhance binding of Nrf2 to the ARE. Additionally, we found a decrease in nuclear Nrf2 when BAECs were co-treated with palmitate and quercetin. We also found that palmitate and the combination of quercetin and palmitate increases translocation of NFκB and mRNA expression of IL-8 and MCP-1. Taken together, this also may be due to cross talk between Nrf2 and NFκB. Although a mechanism of cross talk between the two transcription factors have not been completely elucidated, especially in endothelial cells, theories in other cell lines have been tested. For instance, Nrf2 is inhibited by p65 in that both compete for the transcriptional co-activator CBP (CREB-binding protein) (41). CBP has been shown to interact with two domains of Nrf2, leading to acetylation and activation of Nrf2. On the other hand, CBP has shown to prefer binding to phosphorylated p65 (41). Additionally, NFκB recruits HDAC3 (histone deacetylase 3), which causes hypoacetylation and 23 impedes activation of the Nrf2 pathway (9). Further studies need to be done in endothelial cells to determine quercetin's effect on the cross talk between Nrf2 and NFκB. REFERENCES 1. Grassi D, Desideri G, Ferri C. Flavonoids: antioxidants against atherosclerosis. Nutrients 2010;2(8):889-902. doi: 10.3390/nu2080889. 2. Hirase T, Node K. Endothelial dysfunction as a cellular mechanism for vascular failure. American journal of physiology Heart and circulatory physiology 2012;302(3):H499-505. doi: 10.1152/ajpheart.00325.2011. 3. Staiger K, Staiger H, Weigert C, Haas C, Haring HU, Kellerer M. Saturated, but not unsaturated, fatty acids induce apoptosis of human coronary artery endothelial cells via nuclear factor-kappaB activation. Diabetes 2006;55(11):3121-6. doi: 10.2337/db06-0188. 4. Kim JE, Song SE, Kim YW, Kim JY, Park SC, Park YK, Baek SH, Lee IK, Park SY. Adiponectin inhibits palmitate-induced apoptosis through suppression of reactive oxygen species in endothelial cells: involvement of cAMP/protein kinase A and AMP-activated protein kinase. The Journal of endocrinology 2010;207(1):35-44. doi: 10.1677/joe-10-0093. 5. Lu Y, Qian L, Zhang Q, Chen B, Gui L, Huang D, Chen G, Chen L. Palmitate induces apoptosis in mouse aortic endothelial cells and endothelial dysfunction in mice fed high-calorie and high-cholesterol diets. Life sciences 2013;92(24- 26):1165-73. doi: 10.1016/j.lfs.2013.05.002. 6. Guo XD, Zhang DY, Gao XJ, Parry J, Liu K, Liu BL, Wang M. Quercetin and quercetin-3-O-glucuronide are equally effective in ameliorating endothelial insulin resistance through inhibition of reactive oxygen species-associated inflammation. Molecular nutrition & food research 2013;57(6):1037-45. doi: 10.1002/mnfr.201200569. 7. Shrestha C, Ito T, Kawahara K, Shrestha B, Yamakuchi M, Hashiguchi T, Maruyama I. Saturated fatty acid palmitate induces extracellular release of histone H3: a possible mechanistic basis for high-fat diet-induced inflammation and thrombosis. Biochemical and biophysical research communications 2013;437(4):573-8. doi: 10.1016/j.bbrc.2013.06.117. 8. Gareus R, Kotsaki E, Xanthoulea S, van der Made I, Gijbels MJ, Kardakaris R, Polykratis A, Kollias G, de Winther MP, Pasparakis M. Endothelial cell-specific 25 NF-kappaB inhibition protects mice from atherosclerosis. Cell metabolism 2008;8(5):372-83. doi: 10.1016/j.cmet.2008.08.016. 9. Buelna-Chontal M, Zazueta C. Redox activation of Nrf2 & NF-kappaB: a double end sword? Cellular signalling 2013;25(12):2548-57. doi: 10.1016/j.cellsig.2013.08.007. 10. Ganesh Yerra V, Negi G, Sharma SS, Kumar A. Potential therapeutic effects of the simultaneous targeting of the Nrf2 and NF-kappaB pathways in diabetic neuropathy. Redox biology 2013;1:394-7. doi: 10.1016/j.redox.2013.07.005. 11. Maloney E, Sweet IR, Hockenbery DM, Pham M, Rizzo NO, Tateya S, Handa P, Schwartz MW, Kim F. Activation of NF-kappaB by palmitate in endothelial cells: a key role for NADPH oxidase-derived superoxide in response to TLR4 activation. Arteriosclerosis, thrombosis, and vascular biology 2009;29(9):1370-5. doi: 10.1161/atvbaha.109.188813. 12. Yang JH, Shin BY, Han JY, Kim MG, Wi JE, Kim YW, Cho IJ, Kim SC, Shin SM, Ki SH. Isorhamnetin protects against oxidative stress by activating Nrf2 and inducing the expression of its target genes. Toxicology and applied pharmacology 2014;274(2):293-301. doi: 10.1016/j.taap.2013.10.026. 13. Shi Y, Liang XC, Zhang H, Wu QL, Qu L, Sun Q. Quercetin protects rat dorsal root ganglion neurons against high glucose-induced injury in vitro through Nrf- 2/HO-1 activation and NF-kappaB inhibition. Acta pharmacologica Sinica 2013;34(9):1140-8. doi: 10.1038/aps.2013.59. 14. Tanigawa S, Fujii M, Hou DX. Action of Nrf2 and Keap1 in ARE-mediated NQO1 expression by quercetin. Free radical biology & medicine 2007;42(11):1690-703. doi: 10.1016/j.freeradbiomed.2007.02.017. 15. Speciale A, Anwar S, Canali R, Chirafisi J, Saija A, Virgili F, Cimino F. Cyanidin-3-O-glucoside counters the response to TNF-alpha of endothelial cells by activating Nrf2 pathway. Molecular nutrition & food research 2013;57(11):1979-87. doi: 10.1002/mnfr.201300102. 16. Ungvari Z, Bailey-Downs L, Gautam T, Jimenez R, Losonczy G, Zhang C, Ballabh P, Recchia FA, Wilkerson DC, Sonntag WE, et al. Adaptive induction of NF-E2-related factor-2-driven antioxidant genes in endothelial cells in response to hyperglycemia. American journal of physiology Heart and circulatory physiology 2011;300(4):H1133-40. doi: 10.1152/ajpheart.00402.2010. 17. Ungvari Z, Bagi Z, Feher A, Recchia FA, Sonntag WE, Pearson K, de Cabo R, Csiszar A. Resveratrol confers endothelial protection via activation of the antioxidant transcription factor Nrf2. American journal of physiology Heart and circulatory physiology 2010;299(1):H18-24. doi: 10.1152/ajpheart.00260.2010. 26 18. Kim HS, Montana V, Jang HJ, Parpura V, Kim JA. Epigallocatechin gallate (EGCG) stimulates autophagy in vascular endothelial cells: a potential role for reducing lipid accumulation. The Journal of biological chemistry 2013;288(31):22693-705. doi: 10.1074/jbc.M113.477505. 19. Zhang Q, Jiang Y, Toutounchian JJ, Soderland C, Yates CR, Steinle JJ. Insulin-like growth factor binding protein-3 inhibits monocyte adhesion to retinal endothelial cells in high glucose conditions. Molecular vision 2013;19:796-803. 20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif) 2001;25(4):402-8. doi: 10.1006/meth.2001.1262. 21. Xue M, Qian Q, Adaikalakoteswari A, Rabbani N, Babaei-Jadidi R, Thornalley PJ. Activation of NF-E2-related factor-2 reverses biochemical dysfunction of endothelial cells induced by hyperglycemia linked to vascular disease. Diabetes 2008;57(10):2809-17. doi: 10.2337/db06-1003. 22. Rushworth SA, Shah S, MacEwan DJ. TNF mediates the sustained activation of Nrf2 in human monocytes. Journal of immunology (Baltimore, Md : 1950) 2011;187(2):702-7. doi: 10.4049/jimmunol.1004117. 23. Fratantonio D, Speciale A, Ferrari D, Cristani M, Saija A, Cimino F. Palmitate-induced endothelial dysfunction is attenuated by cyanidin-3-O-glucoside through modulation of Nrf2/Bach1 and NF-kappaB pathways. Toxicology letters 2015;239(3):152-60. doi: 10.1016/j.toxlet.2015.09.020. 24. Boesch-Saadatmandi C, Loboda A, Wagner AE, Stachurska A, Jozkowicz A, Dulak J, Doring F, Wolffram S, Rimbach G. Effect of quercetin and its metabolites isorhamnetin and quercetin-3-glucuronide on inflammatory gene expression: role of miR-155. The Journal of nutritional biochemistry 2011;22(3):293-9. doi: 10.1016/j.jnutbio.2010.02.008. 25. Kumar RR, Narasimhan M, Shanmugam G, Hong J, Devarajan A, Palaniappan S, Zhang J, Halade GV, Darley-Usmar VM, Hoidal JR, et al. Abrogation of Nrf2 impairs antioxidant signaling and promotes atrial hypertrophy in response to high-intensity exercise stress. Journal of translational medicine 2016;14(1):86. doi: 10.1186/s12967-016-0839-3. 26. Wakabayashi N, Dinkova-Kostova AT, Holtzclaw WD, Kang MI, Kobayashi A, Yamamoto M, Kensler TW, Talalay P. Protection against electrophile and oxidant stress by induction of the phase 2 response: fate of cysteines of the Keap1 sensor modified by inducers. Proceedings of the National Academy of Sciences of the United States of America 2004;101(7):2040-5. doi: 10.1073/pnas.0307301101. 27. Kobayashi A, Kang MI, Watai Y, Tong KI, Shibata T, Uchida K, Yamamoto M. Oxidative and electrophilic stresses activate Nrf2 through inhibition of 27 ubiquitination activity of Keap1. Molecular and cellular biology 2006;26(1):221- 9. doi: 10.1128/mcb.26.1.221-229.2006. 28. Guo RM, Xu WM, Lin JC, Mo LQ, Hua XX, Chen PX, Wu K, Zheng DD, Feng JQ. Activation of the p38 MAPK/NF-kappaB pathway contributes to doxorubicin-induced inflammation and cytotoxicity in H9c2 cardiac cells. Molecular medicine reports 2013;8(2):603-8. doi: 10.3892/mmr.2013.1554. 29. Sun GY, Chen Z, Jasmer KJ, Chuang DY, Gu Z, Hannink M, Simonyi A. Quercetin Attenuates Inflammatory Responses in BV-2 Microglial Cells: Role of MAPKs on the Nrf2 Pathway and Induction of Heme Oxygenase-1. PloS one 2015;10(10):e0141509. doi: 10.1371/journal.pone.0141509. 30. Valen G, Yan ZQ, Hansson GK. Nuclear factor kappa-B and the heart. Journal of the American College of Cardiology 2001;38(2):307-14. 31. Savoia C, Schiffrin EL. Vascular inflammation in hypertension and diabetes: molecular mechanisms and therapeutic interventions. Clinical science (London, England : 1979) 2007;112(7):375-84. doi: 10.1042/cs20060247. 32. Kim F, Tysseling KA, Rice J, Gallis B, Haji L, Giachelli CM, Raines EW, Corson MA, Schwartz MW. Activation of IKKbeta by glucose is necessary and sufficient to impair insulin signaling and nitric oxide production in endothelial cells. Journal of molecular and cellular cardiology 2005;39(2):327-34. doi: 10.1016/j.yjmcc.2005.05.009. 33. Yerneni KK, Bai W, Khan BV, Medford RM, Natarajan R. Hyperglycemia-induced activation of nuclear transcription factor kappaB in vascular smooth muscle cells. Diabetes 1999;48(4):855-64. 34. Bartchewsky W, Jr., Martini MR, Masiero M, Squassoni AC, Alvarez MC, Ladeira MS, Salvatore D, Trevisan M, Pedrazzoli J, Jr., Ribeiro ML. Effect of Helicobacter pylori infection on IL-8, IL-1beta and COX-2 expression in patients with chronic gastritis and gastric cancer. Scandinavian journal of gastroenterology 2009;44(2):153-61. doi: 10.1080/00365520802530853. 35. Guo W, Wise ML, Collins FW, Meydani M. Avenanthramides, polyphenols from oats, inhibit IL-1beta-induced NF-kappaB activation in endothelial cells. Free radical biology & medicine 2008;44(3):415-29. doi: 10.1016/j.freeradbiomed.2007.10.036. 36. Wahyudi S, Sargowo D. Green tea polyphenols inhibit oxidized LDL-induced NF-KB activation in human umbilical vein endothelial cells. Acta medica Indonesiana 2007;39(2):66-70. 37. Goldin A, Beckman JA, Schmidt AM, Creager MA. Advanced glycation end products: sparking the development of diabetic vascular injury. Circulation 2006;114(6):597-605. doi: 10.1161/circulationaha.106.621854. 28 38. Cuadrado A, Martin-Moldes Z, Ye J, Lastres-Becker I. Transcription factors NRF2 and NF-kappaB are coordinated effectors of the Rho family, GTP-binding protein RAC1 during inflammation. The Journal of biological chemistry 2014;289(22):15244-58. doi: 10.1074/jbc.M113.540633. 39. Bierhaus A, Schiekofer S, Schwaninger M, Andrassy M, Humpert PM, Chen J, Hong M, Luther T, Henle T, Kloting I, et al. Diabetes-associated sustained activation of the transcription factor nuclear factor-kappaB. Diabetes 2001;50(12):2792-808. 40. Kim JA, Montagnani M, Chandrasekran S, Quon MJ. Role of lipotoxicity in endothelial dysfunction. Heart failure clinics 2012;8(4):589-607. doi: 10.1016/j.hfc.2012.06.012. 41. Wardyn JD, Ponsford AH, Sanderson CM. Dissecting molecular cross-talk between Nrf2 and NF-kappaB response pathways. Biochemical Society transactions 2015;43(4):621-6. doi: 10.1042/bst20150014.