Regulation of uropathogenic Escherichia coli stress response and persistence in the urinary tract

Urinary tract infections (UTIs) afflict millions of individuals yearly, constituting a tremendous global health-care burden. The primary causative agents of UTIs are the gram-negative, rod-shaped bacteria, uropathogenic Escherichia coli (UPEC). These pathogens are motile and adhesive, with a proclivity to colonize diverse niches within the urinary tract; including the kidneys, bladder, and ureters. In the bladder, UPEC grow to high levels and often associate with the superficial epithelial cells lining the lumen. UPEC can invade these superficial epithelial cells to form intracellular reservoir populations, which are thought to be a source of recurrent, or relapsing, infections. The susceptibility of these intracellular UPEC populations was tested using a panel of commonly prescribed antibiotics in a murine model of UTI. Intracellular UPEC were found to persist despite treatment with host cell-permeable antibiotics such as sparfloxacin and ciprofloxacin that effectively sterilize the urine. In a follow-up study, UPEC reservoir populations were more effectively targeted by treating infected bladders with chitosan, a chitin-based bladder exfoliant, prior to sparfloxacin treatment. Although chitosan administration prior to antibiotic treatment significantly decreased UPEC titers, mice still exhibited some relapsing UTIs, suggesting that reservoirs still persist either within the bladder or in other host tissue. To further elucidate mechanisms of bacterial persistence within the urinary tract, several underappreciated bacterial factors were examined that were hypothesized to affect UPEC virulence, stress resistance, and persistence. iv Bacterial, small, non-coding RNAs (sRNAs) are posttranscriptional regulators of gene expression in most prokaryotes and were shown to contribute to a wide variety of UPEC stress response and virulence cascades. In a follow-up study, the putative UPEC sRNA repertoire was defined using RNA-Seq technologies and bioinformatic analyses. Several novel, candidate sRNA molecules were identified and characterized, one of which seemingly repressed UPEC virulence in the murine UTI model. In a second approach to define regulators of UPEC pathogenic behaviors, the tRNA modifying enzyme MiaA was identified as a global regulator of UPEC stress response and virulence. MiaA adds a prenyl group to A-37, adjacent to the anticodon, in a subset of tRNAs to modulate ribosome fidelity and frameshifting. MiaA expression in UPEC was responsive to several environmental stresses and deletion or overexpression of MiaA interferes with the stress resistance and virulence properties of UPEC. Taken together, this thesis defines the robust nature and resilience of intracellular UPEC reservoir populations and delineates sRNAs and MiaA as important regulators of stress resistance and persistence within the host.

REGULATION OF UROPATHOGENIC ESCHERICHIA COLI STRESS RESPONSE AND PERSISTENCE IN THE URINARY TRACT by Matthew George Blango A dissertation submitted to the faculty of The University of Utah in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Microbiology and Immunology Department of Pathology The University of Utah August 2012 Copyright © Matthew George Blango 2012 All Rights Reserved The Universi t y of Utah Graduate School STATEMENT OF DISSERTATION APPROVAL The dissertation of Matthew G. Blango has been approved by the following supervisory committee members: Matthew A. Mulvey , Chair May 9, 2012 Date Approved Brenda L. Bass , Member May 9, 2012 Date Approved Sherwood R. Casjens , Member May 9, 2012 Date Approved David J. Stillman , Member May 9, 2012 Date Approved John H. Weis , Member May 9, 2012 Date Approved and by Peter E. Jensen , Chair of the Department of Pathology and by Charles A. Wight, Dean of The Graduate School. ABSTRACT Urinary tract infections (UTIs) afflict millions of individuals yearly, constituting a tremendous global health-care burden. The primary causative agents of UTIs are the gram-negative, rod-shaped bacteria, uropathogenic Escherichia coli (UPEC). These pathogens are motile and adhesive, with a proclivity to colonize diverse niches within the urinary tract; including the kidneys, bladder, and ureters. In the bladder, UPEC grow to high levels and often associate with the superficial epithelial cells lining the lumen. UPEC can invade these superficial epithelial cells to form intracellular reservoir populations, which are thought to be a source of recurrent, or relapsing, infections. The susceptibility of these intracellular UPEC populations was tested using a panel of commonly prescribed antibiotics in a murine model of UTI. Intracellular UPEC were found to persist despite treatment with host cell-permeable antibiotics such as sparfloxacin and ciprofloxacin that effectively sterilize the urine. In a follow-up study, UPEC reservoir populations were more effectively targeted by treating infected bladders with chitosan, a chitin-based bladder exfoliant, prior to sparfloxacin treatment. Although chitosan administration prior to antibiotic treatment significantly decreased UPEC titers, mice still exhibited some relapsing UTIs, suggesting that reservoirs still persist either within the bladder or in other host tissue. To further elucidate mechanisms of bacterial persistence within the urinary tract, several underappreciated bacterial factors were examined that were hypothesized to affect UPEC virulence, stress resistance, and persistence. iv Bacterial, small, non-coding RNAs (sRNAs) are posttranscriptional regulators of gene expression in most prokaryotes and were shown to contribute to a wide variety of UPEC stress response and virulence cascades. In a follow-up study, the putative UPEC sRNA repertoire was defined using RNA-Seq technologies and bioinformatic analyses. Several novel, candidate sRNA molecules were identified and characterized, one of which seemingly repressed UPEC virulence in the murine UTI model. In a second approach to define regulators of UPEC pathogenic behaviors, the tRNA modifying enzyme MiaA was identified as a global regulator of UPEC stress response and virulence. MiaA adds a prenyl group to A-37, adjacent to the anticodon, in a subset of tRNAs to modulate ribosome fidelity and frameshifting. MiaA expression in UPEC was responsive to several environmental stresses and deletion or overexpression of MiaA interferes with the stress resistance and virulence properties of UPEC. Taken together, this thesis defines the robust nature and resilience of intracellular UPEC reservoir populations and delineates sRNAs and MiaA as important regulators of stress resistance and persistence within the host. In loving memory of Claire M. Bartsch and Marie G. Blango CONTENTS ABSTRACT ........................................................................................................... iii LIST OF TABLES .................................................................................................. ix LIST OF FIGURES ................................................................................................. x LIST OF ABBREVIATIONS AND ACRONYMS .................................................. xiii ACKNOWLEDGEMENTS ................................................................................... xiv Chapter 1. INTRODUCTION ............................................................................................ 1 Thesis Summary ............................................................................................ 8 References ..................................................................................................... 8 2. PERSISTENCE OF UROPATHOGENIC ESCHERICHIA COLI IN THE FACE OF MULTIPLE ANTIBIOTICS ............................................................ 12 Abstract ........................................................................................................ 13 Introduction ................................................................................................... 13 Materials and Methods ................................................................................. 14 Results ......................................................................................................... 15 Discussion .................................................................................................... 18 Acknowledgements ...................................................................................... 20 References ................................................................................................... 20 3. FORCED RESURGENCE AND TARGETING OF INTRACELLULAR UROPATHOGENIC ESCHERICHIA COLI RESERVOIRS .......................... 22 Abstract ........................................................................................................ 23 Introduction ................................................................................................... 24 Results ......................................................................................................... 28 Discussion .................................................................................................... 41 Materials and Methods ................................................................................. 46 Acknowledgements ...................................................................................... 51 References ................................................................................................... 52 vii 4. SMALL NONCODING RNAS REGULATE THE STRESS RESISTANCE AND VIRULENCE PROPERTIES OF UROPATHOGENIC ESCHERICHIA COLI ............................................................................................................. 56 Abstract ........................................................................................................ 57 Introduction ................................................................................................... 58 Materials and Methods ................................................................................. 60 Results and Discussion ................................................................................ 70 Concluding Remarks .................................................................................... 86 Acknowledgements ...................................................................................... 88 References ................................................................................................... 88 Supplemental Material .................................................................................. 97 5. IDENTIFICATION OF SMALL NONCODING RNAS IN UROPATHOGENIC ESCHERICHIA COLI ................................................................................... 99 Abstract ...................................................................................................... 100 Introduction ................................................................................................. 101 Results ....................................................................................................... 108 Discussion .................................................................................................. 141 Materials and Methods ............................................................................... 145 Acknowledgements .................................................................................... 151 References ................................................................................................. 152 6. BALANCED INPUT FROM THE TRNAPRENYLTRANSFERASE MIAA CONTROLS THE STRESS RESISTANCE AND VIRULENCE POTENTIAL OF UROPATHOGENIC ESCHERICHIA COLI ........................................... 159 Abstract ...................................................................................................... 160 Author Summary ........................................................................................ 161 Introduction ................................................................................................. 161 Results ....................................................................................................... 171 Discussion .................................................................................................. 191 Materials and Methods ............................................................................... 194 Acknowledgements .................................................................................... 203 References ................................................................................................. 203 Supplemental Material ................................................................................ 209 7. DISCUSSION ............................................................................................. 210 References ................................................................................................. 224 viii Appendix A. BACTERIAL LANDLINES: CONTACT-DEPENDENT SIGNALING IN BACTERIAL POPULATIONS ..................................................................... 228 B. UROPATHOGENIC ESCHERICHIA COLI INDUCES SERUM AMYLOID A IN MICE FOLLOWING URINARY TRACT AND SYSTEMIC INOCULATION ........................................................................................... 234 LIST OF TABLES Table PAGE 2.1 Antibiotics utilized in this study ................................................................. 15 2.2 Recurrence after antibiotic treatments in human studies .......................... 19 4.1 Bacterial strains and plasmids .................................................................. 61 4.2 Oligonucleotides employed during the study ............................................ 62 4.3 Tested sRNA molecules ........................................................................... 71 5.1 Broad scale sRNA identification studies ................................................. 102 5.2 Deep sequencing statistics ..................................................................... 111 5.3 Known sRNA in UTI89 ............................................................................ 113 5.4 Candidate sRNA ..................................................................................... 119 5.5 Target RNA predictions ........................................................................... 128 5.6 Strains and plasmids used in this study .................................................. 136 5.7 Oligonucleotides employed during the study .......................................... 137 6.1 Bacterial strains and plasmids ................................................................ 177 6.2 Oligonucleotides employed during the study .......................................... 195 LIST OF FIGURES FIGURE PAGE 1.1 UPEC pathogenesis .................................................................................... 4 2.1 Antibiotic effects on intracellular UPEC and host cell cytotoxicity ............. 16 2.2 Antibiotic effects on UPEC biofilms grown in vitro at 37°C in M9 medium 17 2.3 Antibiotic susceptibility of UPEC within mouse bladders .......................... 17 2.4 Antibiotic susceptibility of IBCs ................................................................. 18 3.1 Chitosan affects in vitro growth of UPEC .................................................. 29 3.2 Chitosan treatment results in increased biofilm formation and filamentous UPEC ........................................................................................................ 31 3.3 Chitosan treatment decreases BEC invasion despite increased association .................................................................................................................. 32 3.4 UPEC invades basal and intermediate bladder epithelial cells ................. 35 3.5 Chitosan treatment causes resurgence of UPEC reservoir into the bladder lumen ........................................................................................................ 36 3.6 Chitosan treatment coupled with antibiotic treatment reduces bacterial titers .......................................................................................................... 38 3.7 Chitosan and antibiotic treatment fails to prevent recurrence ................... 40 3.8 Model of UPEC action ............................................................................... 44 4.1 sRNAs modulate biofilm formation, swim motility, and stress resistance of UTI89 ........................................................................................................ 73 4.2 Spot 42 and MicC modulate oxidative stress resistance in UTI89 ............ 77 4.3 Deletion of spf alters key metabolic processes in UTI89 .......................... 82 xi 4.4 Spot 42 modulates interactions between UTI89 and host bladder cells ... 83 4.5 Spot 42 promotes the intracellular persistence of UTI89 in a murine model of UTI ............................................................................................. 84 4.S1 Metabolic profile of UTI89 and UTI89Δspf ................................................. 97 5.1 Experimental approach ........................................................................... 109 5.2 Identification of UPEC sRNAs ................................................................. 117 5.3 Genomic loci for each candidate sRNA .................................................. 120 5.4 Growth and biofilm formation of candidate knockouts ............................ 138 5.5 UsrB represses bladder colonization ...................................................... 142 6.1 UTI89ΔmiaA exhibits wild type growth despite severely altered metabolism ............................................................................................ 164 6.2 UTI89ΔmiaA grows poorly under stress conditions in a dose-dependent manner ................................................................................................... 173 6.3 MiaA protein level responds to stressors ................................................ 179 6.4 MiaA/B differentially regulate UPEC motility and biofilm formation ......... 180 6.5 MiaA promotes UPEC infection of a murine host .................................... 184 6.6 MiaA contributes to α-hemolysin formation, possibly through manipulation of host chaperone production ................................................................. 188 6.S1 miaA/B mutants exhibit no effects on host cell invasion, association, or intracellular replication ............................................................................ 209 7.1 Model of UPEC Pathogenesis ................................................................ 215 A.1 Model of the contact-dependent inhibition system ................................. 231 B.1 Induction and localization of SAA1/2 following inoculation of the bladder with UPEC .............................................................................................. 236 B.2 Quantification of SAA mRNA expression in response to UPEC ............. 237 xii B.3 ELISA of mouse sera at different time points after infection ................... 238 B.4 Growth of UTI89, F11, and MG1655 ± SAA ........................................... 239 B.5 Biofilm formation by the UPEC isolates UTI89 and F11 ± SAA .............. 239 LIST OF ABBREVIATIONS AND ACRONYMS A-37 ................................................................................................... Adenosine-37 ASN ..................................................................................... Acidified sodium nitrite BEC ....................................................................................... Bladder epithelial cell cAMP ................................................................. Cyclic adenosine monophosphate CDI ............................................................................. Contact-dependent inhibition CFU .......................................................................................... Colony forming unit CIP ...................................................................................................... Ciprofloxacin CoA ..................................................................................................... Coenzyme A CRP ...................................................................................... cAMP receptor protein DMSO ........................................................................................ Dimethyl sulfoxide EDTA ..................................................................... Ethylenediaminetetraacetic acid FOF ....................................................................................................... Fosfomycin GC\MS ................................................ Gas Chromatography \ Mass Spectroscopy GFP ................................................................................. Green fluorescent protein GrxB. ................................................................................................ Glutaredoxin 2 GSNO ...................................................................................... S-nitrosoglutathione HlyA ......................................................................................................... α-hemolysin IBC ....................................................................... Intracellular bacterial community IPTG ............................................................ Isopropyl β-D-1-thiogalactopyranoside LB ............................................................................................... Luria-Bertani broth LPS ........................................................................................... Lipopolysaccharide MES .............................................................. 2-(N-morpholino)ethanesulfonic acid mRNA ............................................................................................ Messenger RNA MV .................................................................................................. Methyl viologen ORF ......................................................................................... Open reading frame PanC ................................................................................ Pantothenate synthetase PBS ............................................................................... Phosphate Buffered Saline PCR ............................................................................... Polymerase chain reaction PFA ............................................................................................ Paraformaldehyde RNA-Seq ............................................................................. RNA deep sequencing RNA ................................................................................................ Ribosomal RNA tRNA .................................................................................................. Transfer RNA SAA .............................................................................................. Serum amyloid A SEM ........................................................................ Scanning electron microscopy SPX ...................................................................................................... Sparfloxacin sRNA .................................................................................. Small, non-coding RNA UPEC ..................................................................... Uropathogenic Escherichia coli UTI ........................................................................................ Urinary tract infection ACKNOWLEDGEMENTS I am greatly indebted to my mentor, Matt Mulvey, for his devotion and guidance during the course of my thesis research. His continual support, upbeat attitude, and reckless optimism were key to my success as both a researcher and as a human being. I would also like to thank all members of the lab, past and present, for their constructive criticism and motivation over the years. I am extremely grateful to my thesis committee, John, Brenda, Sherwood, and David, for their continual guidance and assurances along the way. It is also absolutely essential to thank Janis Weis and the Microbial Pathogenesis Training Grant for both funding and personal support. Janis is a wonderful ally and has always ben there to help when needed. I would like to thank our collaborators in Slovenia for their constant optimism and support. I would also like to extend my greatest gratitude to Kael Fischer for his continuous support and bioinformatics prowess. Without Kael, I would still be trying to get python to print my name. I would like to thank my mom for being continually supportive, loving, and critical-all wonderful traits which I would not trade for the world. I would also like to thank the rest of my family for everything they have done for me. My girlfriend Amelia also deserves great thanks for the many sacrifices she has made towards my research career. She has been great throughout this entire process. Finally, I xv would like to remember and thank those who are no longer with us who have helped me along the way. CHAPTER 1 INTRODUCTION 2 Escherichia coli is a Gram-negative, rod-shaped bacterium commonly found in the lower intestine of warm-blooded animals. In the intestine, commensal E. coli strains provide the host with essential vitamins and advantageous enzymes for digestion of metabolites. However, outside of the intestine, some E. coli strains can colonize diverse host niches to cause diseases ranging from neonatal meningitis to urinary tract infection (UTI) (31). Uropathogenic E. coli (UPEC) are the primary etiologic agent of UTI and rank among the most common bacterial infections (11, 12, 16). UTIs thus constitute a significant burden on the global health-care system, responsible for over 7.4 million physicians visits yearly, costing ~1.6 billion dollars in the U.S. alone (11, 12). UTIs can be divided into two major classes: acute uncomplicated UTIs are self-limiting infections, whereas chronic infections are highlighted by their persistent nature and frequent association with underlying anatomical and/or immunological problems. Acute cystitis commonly presents with symptoms such as dysuria (burning during urination), frequent urination, urgency, and pyuria (cloudy urine). Chronic UTIs display symptoms similar to acute infection, but are generally more resistant to antibiotic treatments, persist over longer periods of time, and are coincident with higher levels of recurrence. In general, 25-45% of women will have an additional UTI within six months of an initial infection (7). This high rate of recurrence occurs despite treatment with antibiotics; however, increased treatment duration has shown some promise in preventing recurrence (22, 30). Additionally, the causative strain for both the index and recurrent 3 infection are often genetically identical, suggestive of a UPEC reservoir population present within the urinary tract or elsewhere within the host (25). Persistent UPEC reservoirs that are protected from antibiotics and most host defenses are proposed to be an important cause of both chronic and recurrent, or relapsing, UTIs. In order to establish an infection, UPEC ascends into the bladder via the urethra and can replicate rapidly within the bladder lumen. A subpopulation of UPEC is able to adhere to and invade the large superficial epithelial cells that line the bladder lumen and take up residence (Figure 1.1) (10, 19, 20). Invasion of these superficial bladder cells occurs via a zipper-like endocytic mechanism, resulting in the uptake of UPEC within a membrane-bound vacuole. At this stage endocytosed UPEC may be trafficked back out of the epithelial cell into the bladder lumen, or enter into a late endosomal, lysosome-like compartment. These bacteria can form a long-lived-quiescent intracellular reservoir population that remains dormant and therefore less immunogenic. Alternatively, UPEC can replicate within the vacuole before breaking out into the cytoplasm, where they grow quite rapidly in conjunction with host cytokeratin intermediate filaments to form large intracellular bacterial communities (IBCs) (10, 15, 19). IBCs act as a dispersal system to propagate the infection throughout the bladder lumen, with bacteria replicating to upwards of ~5000 clones per IBC before causing disintegration of the host epithelial cell (2, 15). Dispersal from IBCs leads to reinoculation of the bladder lumen, seeding bacteria within neighboring and underlying epithelial cells. Exfoliation of bladder cells that contain IBCs may also 4 Figure. 1.1 UPEC pathogenesis UPEC are able to enter the bladder and replicate within the urine. A subpopulation of bacteria adheres to, and infrequently invades the host epithelium to form intracellular populations of UPEC within endocytic vesicles. UPEC may then remain quiescent or begin to replicate within the vacuole, and ultimately in the cytosol in conjunction with host factors to form an IBC, which is involved in further dissemination of the infection. promote the dispersion of UPEC outside of the host (24). Disruption of the host epithelium through IBC formation also facilitates bacterial penetration of the underlying intermediate and basal epithelial bladder cells, a process that is perpetuated by host immune mechanisms such as exfoliation of the bladder epithelium and the influx of neutrophils (10, 19). UPEC invasion of underlying tissues provides the bacteria with a stable niche due to the long half-life-roughly 52 weeks-of the urothelium (14). These entrenched, quiescent bacteria within the immature cells of the bladder are thought to form a reservoir capable of *(+,%&'() !"#$%&'() *-.) /01.) *(23,4$5565,3)7$%$3+'&3) /("$35;&(<).$55%) 869$3:4&,5).$55%) 5 reseeding the bladder lumen during chronic, recurrent, or relapsing infection. Once the reservoir population is established, subsequent rounds of infection occur as individual IBCs form, burst, and reinoculate the urinary tract. Establishment and maintenance of a persistent infection is achieved through the coordinated efforts of innumerable virulence factors and other systems, including those that affect bacterial motility, adhesion to and invasion of epithelial cells, environmental sensing, immune evasion, and stress responses. UPEC have a variety of virulence factors, including multiple iron scavenging systems, adhesive organelles, and toxins such as α-hemolysin and cytotoxic necrotizing factor to disrupt host membranes, release nutrients, and manipulate host-signaling cascades (9, 29). UPEC also possess distinct polysaccharide capsules and sugar moieties on their outer membrane to reduce immunogenicity and limit exposure to environmental assaults. Relative to non-pathogenic isolates, pathogenic strains commonly exhibit increased resistance to nutrient limitation and environmental stressors (29). As an example, bacterial pathogens may acquire multiple catalase genes to enhance resistance to oxidative stress or may encode numerous iron scavenging systems to obtain necessary iron from the environment or host (28). In addition to virulence factors, all bacteria must have mechanisms for obtaining energy from the environment. An elegant study by Alteri et. al. recently identified several metabolic systems-protein import, gluconeogenesis, and the tricarboxylic acid cycle-as indispensible for UPEC virulence in the urinary tract (1). Glycolysis, the pentose-phosphate pathway, and the Entner-Doudoroff 6 pathway, all of which provide the cell with energy through the generation of pyruvate, were dispensable for virulence during UTI in this study (1). The superfluous nature of these metabolic systems in the urinary tract is in contrast to their requirement in the intestinal tract, suggesting that the ability to utilize alternate energy sources and metabolic pathways significantly impacts the fitness of UPEC during a UTI. Metabolic intermediates also play a direct role in bacteria-to-bacteria signaling through processes like quorum sensing, where concentrations of metabolic breakdown products signal the bacterial population to undergo a specific behavior, such as biofilm formation (17). Similar to the mechanisms of quorum sensing, UPEC recognize host-produced metabolic compounds using them as a sort of molecular roadmap. Recognition of the amino acid D-serine, which is produced in abundance in the host urinary tract, signals UPEC to up-regulate pathways that optimize its growth, motility, and virulence within the bladder lumen (3, 23). Combined, these observations indicate complex interplay between bacterial metabolic processes, virulence, and niche recognition during the course of a UTI. In bacteria, a multitude of regulatory mechanisms are in place to control the expression of virulence factors, metabolic enzymes, and stress response proteins. These mechanisms range from altering promoter binding efficiency and transcription factor abundance to regulation by posttranslational modifications. One of the most common forms of bacterial regulation is the two-component system, where a membrane-bound histidine kinase senses environmental stimuli and transfers a signal to a response regulator, which in turn alters gene 7 expression. Posttranscriptional control of gene expression by small, non-coding RNAs (sRNAs) comprises another important regulatory mechanism. sRNAs, ranging in size from 50-500 nucleotides (nt), base-pair with cognate, target mRNA sequences, often in the presence of the RNA chaperone Hfq, and thereby influence mRNA translation and stability. sRNA molecules regulate diverse cellular activities, from outer membrane porin expression and basal metabolic function to stress response and virulence (4, 5, 8, 18). Most sRNA molecules appear to function primarily in fine-tuning gene expression (26). Contrasting with gene specific regulation by sRNA molecules are more global regulatory mechanisms such as translational control through tRNA modification. tRNAs can be modified with upwards of 100 different modifications, ranging from methylation marks to isoprenyl groups (21). Each of these modifications affects the process of translation differently, but most appear to affect translational rates and fidelity. Several tRNA modifying enzymes regulate large subsets of tRNA molecules and can have a substantial impact on protein expression (6, 13, 27). These modifying enzymes, such as MiaA and Tgt, are postulated to serve as global regulators of stress response (6, 13, 27). Regulation of these enzymes is hypothesized to enable rapid, broad-scale changes in response to environmental stresses directly altering protein abundance and, perhaps, functionality. Combined, sRNAs and tRNA modifying enzymes may provide bacteria with the ability to fine-tune gene expression to more precisely respond to environmental stimuli, optimizing metabolic activities, stress response pathways, and virulence. 8 Thesis Research Summary The thesis research compiled here aims to define molecular aspects of the UPEC reservoir population during infection of the urinary tract through the use of in vitro assays and a murine model of infection. Chapters 2 and 3 will relate research towards understanding the confounding issues of UTI recurrence, namely the inability to clear the UPEC reservoir population from the bladder. Chapters 4 and 5 will transition to the identification and characterization of sRNA regulatory networks in UPEC, highlighting contributions of specific sRNA molecules to stress response and persistence. Chapter 6 will then describe the interplay between translational regulation by the tRNA modifying enzyme MiaA, metabolic flexibility, and stress response during a UTI. Chapters 4 through 6 begin to elucidate the molecular mechanisms that enable UPEC to persist within the urinary tract, despite attacks from the host immune system and other harsh environmental stressors. Chapter 7 will synthesize the content of this thesis and provide extrapolations on what is to come in the field of UPEC pathogenesis. Finally, several appendices will delineate bacterial communication through direct interactions with their neighbors, as well as mechanisms used by the host to influence the outcome of infection. References 1. Alteri, C. J., S. N. Smith, and H. L. Mobley. 2009. Fitness of Escherichia coli during urinary tract infection requires gluconeogenesis and the TCA cycle. PLoS Pathog. 5:e1000448. 9 2. Anderson, G. G., K. W. Dodson, T. M. Hooton, and S. J. Hultgren. 2004. Intracellular bacterial communities of uropathogenic Escherichia coli in urinary tract pathogenesis. Trends Microbiol. 12:424-430. 3. Anfora, A. T., and R. A. Welch. 2006. DsdX is the second D-serine transporter in uropathogenic Escherichia coli clinical isolate CFT073. J. Bacteriol. 188:6622-6628. 4. Beisel, C. L., and G. Storz. 2011. The base-pairing RNA spot 42 participates in a multioutput feedforward loop to help enact catabolite repression in Escherichia coli. Molecular Cell 41:286-297. 5. Beisel, C. L., T. B. Updegrove, B. J. Janson, and G. Storz. 2012. Multiple factors dictate target selection by Hfq-binding small RNAs. EMBO J. 31(8):1961-74. 6. Bjork, G. R., J. U. Ericson, C. E. Gustafsson, T. G. Hagervall, Y. H. Jonsson, and P. M. Wikstrom. 1987. Transfer RNA modification. Annual Review of Biochemistry 56:263-287. 7. Blango, M. G., and M. A. Mulvey. 2010. Persistence of uropathogenic Escherichia coli in the face of multiple antibiotics. Antimicrob. Agents Chemother. 54:1855-1863. 8. Chen, S., A. Zhang, L. B. Blyn, and G. Storz. 2004. MicC, a second small-RNA regulator of Omp protein expression in Escherichia coli. J. Bacteriol. 186:6689-6697. 9. Dhakal, B. K., and M. A. Mulvey. 2012. The UPEC pore-forming toxin alpha-hemolysin triggers proteolysis of host proteins to disrupt cell adhesion, inflammatory, and survival pathways. Cell Host Microbe 11:58- 69. 10. Eto, D. S., J. L. Sundsbak, and M. A. Mulvey. 2006. Actin-gated intracellular growth and resurgence of uropathogenic Escherichia coli. Cellular Microbiology 8:704-717. 11. Foxman, B. 2003. Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Dis. Mon. 49:53-70. 12. Foxman, B. 1990. Recurring urinary tract infection: incidence and risk factors. Am. J. Public Health 80:331-333. 13. Hagervall, T. G., J. U. Ericson, K. B. Esberg, J. N. Li, and G. R. Bjork. 1990. Role of tRNA modification in translational fidelity. Biochimica et Biophysica acta 1050:263-266. 10 14. Hicks, R. M. 1975. The mammalian urinary bladder: an accommodating organ. Biol. Rev. Camb. Philos. Soc. 50:215-246. 15. Justice, S. S., C. Hung, J. A. Theriot, D. A. Fletcher, G. G. Anderson, M. J. Footer, and S. J. Hultgren. 2004. Differentiation and developmental pathways of uropathogenic Escherichia coli in urinary tract pathogenesis. Proc. Natl. Acad. Sci. U. S. A. 101:1333-1338. 16. Kaper, J. B., J. P. Nataro, and H. L. Mobley. 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2:123-140. 17. Kostakioti, M., M. Hadjifrangiskou, J. S. Pinkner, and S. J. Hultgren. 2009. QseC-mediated dephosphorylation of QseB is required for expression of genes associated with virulence in uropathogenic Escherichia coli. Mol. Microbiol. 73:1020-1031. 18. Moller, T., T. Franch, C. Udesen, K. Gerdes, and P. Valentin-Hansen. 2002. Spot 42 RNA mediates discoordinate expression of the E. coli galactose operon. Genes Dev. 16:1696-1706. 19. Mulvey, M. A., J. D. Schilling, and S. J. Hultgren. 2001. Establishment of a persistent Escherichia coli reservoir during the acute phase of a bladder infection. Infect. Immun. 69:4572-4579. 20. Mysorekar, I. U., and S. J. Hultgren. 2006. Mechanisms of uropathogenic Escherichia coli persistence and eradication from the urinary tract. Proc. Natl. Acad. Sci. U. S. A. 103:14170-14175. 21. Persson, B. C. 1993. Modification of tRNA as a regulatory device. Mol. Microbiol. 8:1011-1016. 22. Raz, R., and S. Boger. 1991. Long-term prophylaxis with norfloxacin versus nitrofurantoin in women with recurrent urinary tract infection. Antimicrob. Agents Chemother. 35:1241-1242. 23. Roesch, P. L., P. Redford, S. Batchelet, R. L. Moritz, S. Pellett, B. J. Haugen, F. R. Blattner, and R. A. Welch. 2003. Uropathogenic Escherichia coli use d-serine deaminase to modulate infection of the murine urinary tract. Mol. Microbiol. 49:55-67. 24. Rosen, D. A., T. M. Hooton, W. E. Stamm, P. A. Humphrey, and S. J. Hultgren. 2007. Detection of intracellular bacterial communities in human urinary tract infection. PLoS Med. 4:e329. 25. Russo, T. A., A. Stapleton, S. Wenderoth, T. M. Hooton, and W. E. Stamm. 1995. Chromosomal restriction fragment length polymorphism 11 26. Shimoni, Y., G. Friedlander, G. Hetzroni, G. Niv, S. Altuvia, O. Biham, and H. Margalit. 2007. Regulation of gene expression by small non-coding RNAs: a quantitative view. Mol. Syst. Biol. 3:138. 27. Urbonavicius, J., Q. Qian, J. M. Durand, T. G. Hagervall, and G. R. Bjork. 2001. Improvement of reading frame maintenance is a common function for several tRNA modifications. EMBO J. 20:4863-4873. 28. Vagrali, M. A. 2009. Siderophore production by uropathogenic Escherichia coli. Indian J. Pathol. Microbiol. 52:126-127. 29. Wiles, T. J., R. R. Kulesus, and M. A. Mulvey. 2008. Origins and virulence mechanisms of uropathogenic Escherichia coli. Exp. Mol. Pathol. 85:11-19. 30. Williams, G., and J. C. Craig. 2011. Long-term antibiotics for preventing recurrent urinary tract infection in children. Cochrane Database Syst. Rev:CD001534. 31. Yan, F., and D. B. Polk. 2004. Commensal bacteria in the gut: learning who our friends are. Curr. Opin. Gastroenterol. 20:565-571. CHAPTER 2 PERSISTENCE OF UROPATHOGENIC ESCHERICHIA COLI IN THE FACE OF MULTIPLE ANTIBIOTICS Reprint of: Blango, M.G. and Mulvey, M.A. (2010). Persistence of Uropathogenic Escherichia coli in the Face of Multiple Antibiotics. Antimicrobial Agents and Chemotherapy 54(5), 1855-1863. Reprint with permission of Antimicrobial Agents and Chemotherapy. 13 14 15 16 17 18 19 20 21 CHAPTER 3 FORCED RESURGENCE AND TARGETING OF INTRACELLULAR UROPATHOGENIC ESCHERICHIA COLI RESERVOIRS 23 Abstract Chitosan, a water-soluble, chitin-based derivative, selectively triggers exfoliation of superficial bladder epithelial cells. Chitosan-induced exfoliation of superficial cells was used as a tool to show that UPEC were able to invade and form reservoir populations in underlying intermediate and basal epithelial cells. Chitosan treatment of in vitro growing bacteria resulted in overly adhesive bacteria, which more efficiently formed biofilms and exhibited increased association to cultured 5637 bladder epithelial cells. Scanning electron micrographs of infected mouse bladders revealed high levels of often-filamentous bacteria on the bladder surface at 3 and 7 days after chitosan treatment, suggestive of increased resurgence and exit from their intracellular niche. Treatment of infected mouse bladders with chitosan and cell-permeable antibiotics, such as sparfloxacin and ciprofloxacin, resulted in enhanced removal of UPEC reservoir populations in the murine urinary tract. Despite near-complete clearance of UPEC from the bladder after treatment, these mice still displayed recurrent infections as determined by daily urine analysis over the course of two weeks following cessation of antibiotic treatment. It remains possible that nearby tissues, such as the ureters or vaginal mucosa, may harbor UPEC populations capable of re-colonizing the bladder following antibiotic treatment. Overall, chitosan treatment followed by ≥7 days of antibiotics offers a unique treatment regiment for removal of embedded reservoir populations in the bladder epithelium by forcing UPEC resurgence. Further research will refine the efficacy 24 of this treatment as a therapy for use in human patients with recurrent, or relapsing, urinary tract infections. Introduction The mammalian bladder mucosa, being comprised of a transitional epithelium (urothelium) and an underlying lamina propria, functions as a strong permeability barrier that keeps urine and other elements within the bladder lumen from entering surrounding tissues. The highly vascularized lamina propria merges with the submucosa, which in turn sits atop a layer of smooth muscle that is surrounded in part by a serosal covering and an adventitia made up of connective tissue. The urothelium itself is composed of layers of immature intermediate and basal bladder epithelial cells (BECs) underlying a single layer of much larger, terminally differentiated binucleate superficial cells that face the bladder lumen (13, 19, 22). Intermediate, and possibly basal BECs, move towards the apical surface and differentiate to fill vacancies created as superficial cells are shed (32). Normally, the urothelium has an especially slow turnover rate of 6-12 months, but upon injury and exfoliation of the superficial cells, the underlying immature cells are rapidly mobilized and differentiated (10). As they differentiate into superficial cells, intermediate cells undergo multiple changes, including marked increases in size, fusion with neighboring intermediate cells, and finally the redistribution of actin filaments to sites along basolateral surfaces (2, 19, 22, 32). The ability of urothelium to quickly regenerate itself when damaged is impressive, and likely reflects the importance of this mucosal barrier 25 in guarding against the uptake of unwanted metabolites and infiltrating microbial pathogens (10, 26). The sterility of the urinary tract is routinely challenged by a diversity of bacterial pathogens, which if not eliminated can result in the establishment of a urinary tract infection (UTI). Most UTIs are caused by strains of uropathogenic Escherichia coli (UPEC) (35). UPEC strains, which are often motile and encode numerous adhesive organelles and other virulence factors (35), likely originate in the colon, but can be introduced into the urinary tract via contamination of the urethra meatus and urethra, facilitated by poor hygiene, sexual intercourse, or anatomical defects (9). UTIs are often acute in nature, being associated with the transient detection of bacteria in urine and accompanying symptoms that can include pelvic pain, pyuria, dysuria, and the frequent, urgent need to urinate (8). Although often self-limiting or treatable with short-course antibiotics, UTIs are prone to recur in many individuals and can develop into chronic, long-term infections that can last from a few weeks to years. Occasionally, UPEC colonization of the bladder can also serve as a staging ground for the further spread of the pathogens into the kidneys and/or bloodstream. The capacity of many UPEC isolates to persist within the bladder and cause recurrent and chronic UTIs is facilitated by the ability of UPEC to bind and invade the urothelium (6, 23, 30, 34). UPEC utilize adhesive fibers known as type 1 pili to both attach to and invade BECs (6, 37). Internalized bacteria can be quickly shuttled back out of the host cells or trafficked into actin-bound, lysosome-like compartments where they can persist in a seemingly quiescent 26 state, sequestered away from the flow of urine and host immunosurveillance mechanisms (7, 23, 24). These quiescent bacteria are thought to serve as reservoirs for recurrent (or more accurately, relapsing) and chronic UTIs (7). Within terminally differentiated superficial BECs, UPEC can break into the host cytosol and rapidly grow in close association with cytokeratin intermediate filaments, forming large biofilm-like aggregates referred to as intracellular bacterial communities (IBCs) (1, 14, 24). Triggers that stimulate the development of IBCs, versus the establishment of quiescent intracellular reservoirs, are not entirely clear, but appear to be affected by the differentiation status of the host cell and the distribution of actin filaments (7). IBCs are not especially long-lived structures and are susceptible to disruption by antibiotics (3). The build-up and eventual dispersal (or shedding) of IBCs likely facilitates the spread of UPEC both within the urinary tract and to other hosts, promoting further rounds of acute and recurrent/relapsing infections (1, 24). Acute UTIs are commonly treated with short-course antibiotic regimens such as Bactrim (sulfamethoxazole/trimethoprim), nitrofurantoin, amoxicillin, or select fluoroquinolones, with relatively high success rates (12). Chronic UTIs respond poorly to short-course antibiotic treatments, which often fail to completely eliminate UPEC reservoir populations (3, 24, 29). Long-term antibiotic treatments show more promise, but come with a greater risk of side effects and development of antibiotic resistance, driving interest in alternative treatment options. A plethora of vaccine targets have so far yielded little clinical success in eradicating UPEC from the bladder. For example, vaccination attempts using 27 Solco-Urovac, a mix of 10 heat-inactivated uropathogenic strains was initially promising, but proved to be too allergenic for consistent, widespread usage (28). Other attempts at vaccine development have targeted conserved pathogenic elements such as capsule, LPS core antigen components, pili, and toxins such as α-hemolysin with limited success. Despite many years of intensive research and development, these vaccines provide only short-term protective immunity, suggesting a limited role of the adaptive immune system in fighting UTIs. Recent strategies aimed at targeting panels of pathogen-associated molecules are laying the groundwork for development of more efficacious vaccines, but the broad application and optimization of this approach remains distant (33). Novel therapeutic regimens will likely be needed to support current vaccinology efforts. Recently, using a mouse UTI model, we demonstrated that many antibiotics effectively sterilize the urine, while leaving intracellular UPEC reservoirs buried within the urothelium mostly untouched (3). The nonreplicating status of these bacteria, coupled with the barrier function of the urothelium, likely contributes to the recalcitrant nature of UPEC reservoirs. In this study, we explored the use of the linear polysaccharide chitosan as a tool to expose and better target UPEC reservoirs within the urothelium. Chitosan is a deacetylated form of chitin derived from shellfish. It is reported to have bactericidal activity, is naturally biodegradable by lysozyme, and is approved for use in human patients as a drug carrier molecule (21, 36). Chitosan is able to disrupt epithelial cell tight junctions, and its instillation into the bladder causes rapid exfoliation of the superficial cell layer of the urothelium without eliciting any overt signs of 28 inflammation (16, 32). Following chitosan administration via catheterization, the urothelium barrier function is restored within 7 days ((32) and personal communication P. Veranic). Here we show that chitosan can be used to remove the superficial cell layer in murine bladders, thereby stimulating the resurgence of UPEC from intracellular reservoirs within the immature layers of the urothelium. Chitosan had minimal effect on the growth of a UPEC reference isolate in broth culture, but did promote biofilm formation and the development of unusual tubules that linked individual bacteria. When used in association with antibiotics, chitosan allowed for more complete removal of the reservoir populations within the bladder, suggesting that chitosan may be valuable for the treatment of chronic and recurrent UTIs. Results Chitosan affects UPEC growth and biofilm formation In previous reports, chitosan has been shown to inhibit the growth of some bacterial strains (21). To assess the effect of chitosan on UPEC, the reference UPEC cystitis isolate UTI89 was grown shaking at 37°C in modified M9 minimal media supplemented with 0.02, 0.002, or 0.0002% chitosan or with buffer (phosphate buffer, pH 4.5) alone. Growth of UTI89 in the presence of 0.02% chitosan was delayed by over 1 h, but was otherwise unimpeded (Fig 3.1A and data not shown). In microtiter plate-based assays with static cultures, chitosan greatly enhanced biofilm formation by UTI89 in a dose-dependent fashion (Fig 3.1B). Growth of bacteria on glass coverslips in the presence of 0.002% chitosan 29 Figure 3.1 Chitosan affects in vitro growth of UPEC (A) Growth of UTI89 in the presence of increasing concentrations of chitosan (0.0002, 0.002, 0.02%) or equal volumes of pH 4.5 phosphate buffer. Graph is from representative data collected from one of three experiments done in triplicate. Error bars were negligible and not shown for clarity. (B) In vitro biofilm formation of UTI89 incubated with increasing concentrations of chitosan or buffer as described above. Data was combined as three separate experiments performed in quadruplicate. Error bars indicate standard error of the mean with P = ***<0.001. Mock Buffer 0.00002 0.0002 0.002 0.0 0.5 1.0 1.5 2.0 % Chitosan *** *** Absorbance562 A B 0 10 20 30 0.0 0.2 0.4 0.6 0.8 1.0 UTI89 0.0002% 0.002% Buffer 0.02% Chitosan Time (h) O.D.600 30 caused UTI89 to form large aggregates that were not apparent with lower concentrations of chitosan or with buffer alone (Fig. 3.2A-D). These chitosan-induced biofilm-like aggregates were associated with large amounts of undefined extracellular material (Fig. 3.2D), and also contained many filamentous bacterial cells as are often observed with bacteria under stress (Fig. 3.2C). Chitosan increases UPEC cellular association The effects of chitosan on interactions between UTI89 and host cells were assessed using the bladder epithelial cell line designated 5637. Chitosan (0.0002 and 0.002%) had no effect on the attachment or viability of 5637 cells, but did have a slight, though significant, inhibitory effect on growth of UTI89 in the cell culture medium (RPMI, Fig. 3.3A). Interactions between UTI89 and the BECs were drastically increased following a 2-h infection in the presence of chitosan treatment (Fig. 3.3B). In contrast, 0.002% chitosan decreased bacterial entry into the host cells (Fig. 3.3C), while having no significant effect on intracellular survival of the pathogen over a 24-h period (Fig. 3.3D). Use of chitosan indicates that UPEC reservoirs reside within all layers of the urothelium Previous work indicated that instillation of chitosan into the bladder lumen for 20 min will induce robust exfoliation of the superficial cells, leaving the underlying urothelium mostly intact (32). Using adult female CBA/J mice, we confirmed these findings, showing that chitosan promotes the rapid detachment of nearly all 31 Figure 3.2 Chitosan treatment results in increased biofilm formation and filamentous UPEC (A-D) Immunofluorescence images of UTI89 incubated with increasing concentrations of chitosan or buffer and stained with anti-E. coli antibody. Panel C specifically shows an example of a filamentous bacterium present after treatment with 0.02% chitosan. Experiments were repeated at least twice in triplicate with similar results. 10 !M A B C D E Buffer 0.002% Chitosan 0.002% Chitosan 0.0002% Chitosan 32 Figure 3.3 Chitosan treatment decreases BEC invasion despite increased association (A) Chitosan treatment (0.002 or 0.02%) results in decreased growth in RPMI tissue culture media in the presence of 5637 bladder epithelial cells. (B) Chitosan treatments result in increased association of UTI89 with BECs in culture. (C) Invasion of UTI89 into BECs was measured by gentamicin-protection assays, where the cell-impermeable antibiotic gentamicin kills extracellular bacteria. Data was graphed as an index that normalizes invasion to bacteria associated with epithelial cells. (D) Intracellular replication of UTI89 was measured in the presence of chitosan or buffer after an overnight incubation in low concentrations of gentamicin. All cell culture experiments were performed at least three times in triplicate and combined. Error bars indicate standard error of the mean with P = *<0.05, **<0.01, ***<0.001. Total - + - + 0 1!1007 2!1007 3!1007 * * Chitosan CFU/ml Invasion - + - + 0 50 100 150 ** Chitosan Invasion (%) Cell Association - + - + 0 100 200 300 400 500 ** *** Chitosan Cell Associated (%) Intracellular Survival - + - + 0 50 100 150 Chitosan Intracellular Replication (%) 0.0002% 0.002% Chitosan A B C D 33 of the large, binucleate superficial BECs, exposing the smaller mononucleate immature cells of the urothelium (Fig. 3.4A - B). Previous microscopy-based studies indicate that UPEC can invade all layers of the bladder urothelium (3, 7, 23, 24). Taking advantage of the ability of chitosan to strip away the topmost layer of superficial cells, we set out to quantify the ability of UPEC to invade mature versus immature BECs in vivo. Mice were treated with chitosan or phosphate buffer alone for 20 min followed by washes with phosphate buffered saline (PBS). Mice were then allowed to recover for 4 h prior to inoculation of UTI89 via transurethral catheterization. After 1 h, bladders were recovered, quartered, and incubated for an additional hour in the presence of gentamicin (10 μg/ml) in order to kill any extracellular bacteria. After additional washes to remove the antibiotic, bladders were homogenized and the numbers of surviving bacteria enumerated by dilution plating. Results shown in Fig. 3.4C indicate that UPEC has the capacity to invade both the superficial and immature cells of the bladder similarly. We next asked if UPEC could penetrate and persist equally well within both mature and immature BECs. Untreated mice were inoculated with UTI89 via catheterization and the infection was allowed to proceed for 3 d. At this time point, IBCs are rare and intracellular reservoir populations have been established (1, 14). Infected mice were then treated with phosphate buffer alone or with chitosan to remove the outermost cell layer. After several washes with PBS, bladders were collected and bacteria present were quantified. In these assays, chitosan treatment decreased bacterial titers in the bladder slightly, but this 34 change was not statistically significant (Fig. 3.4D). These results confirm that UPEC can establish itself within all layers of the urothelium. Resurgence of UPEC after chitosan treatment The exfoliation of infected superficial BECs occurs normally during UTI, driving the differentiation of underlying cells that may contain UPEC reservoirs (25, 31). It has been proposed that the differentiation process, with accompanying changes in the actin cytoskeleton, can stimulate the resurgence of UPEC (7). To investigate this possibility, bladders of CBA/J mice were treated with chitosan 3 d after infection with UTI89, washed, and then collected and imaged by scanning electron microscopy (SEM) at 1, 3, and 7 d postchitosan treatment. At days 1 and 3, large numbers of bacteria were visible on the apical surface of some bladders (Fig. 3.5). Similar levels of bacteria were observed less often at day 7 and in untreated, infected bladders, and not at all in uninfected controls. These observations suggest that chitosan treatment and subsequent regeneration of the urothelium can spur the resurgent growth of UPEC from established reservoirs. Many of the bacteria present on the bladder surface following chitosan treatment were filamentous, in line with previous work showing that filamentation is not uncommon among UPEC growing within the stressful confines of BECs and the bladder lumen (11, 15). Residual levels of chitosan, as well as the presence of oxidative radicals that can activate the SOS response, may both contribute to development of the filamentous bacteria (see Fig. 3.2E and (11, 15, 20)). Of note, many of the bacteria observed in this analysis were 35 Figure 3.4 UPEC invades basal and intermediate bladder epithelial cells 7-8 wk old CBA/J mice from Jackson Laboratory were treated with (A) buffer control or (B) 50 μl of 0.02% chitosan for 20 minutes as described in the methods. Mice were sacrificed, bladders aseptically removed, splayed, and nuclei were stained with Hoeschst dye. The ability of UTI89 to invade intermediate and basal epithelial cells was tested by treating mice with control buffer or 50 μl of 0.02% chitosan for 20 minutes. 4 h after chitosan treatment, mice were infected with 107 UTI89 and allowed to incubate for 1 h. At this time mice were sacrificed and bladders were removed, homogenized, serially diluted, and titered for the presence of bacteria. (D) Mice were infected as described above and allowed to develop reservoir populations. At 3 d post infection, mice were treated with chitosan or buffer as previously described, washed with profusely with PBS, and immediately sacrificed. Bladders were removed, homogenized, and titered as described above. Graphs show median value with P values determined by the Mann Whitney U test. Buffer Chitosan 10-1 100 101 102 103 104 CFU/Bladder Buffer Chitosan 100 101 102 103 104 105 106 107 108 109 CFU/g Bladder A B C D 100 !M 36 Figure 3.5 Chitosan treatment causes resurgence of UPEC reservoir into the bladder lumen (A) SEM images of uninfected, unmanipulated bladder as a control. SEM images of (B-C) 1 d, (D-E) 3 d, and (F) 7 d time points after chitosan treatment of a 3 d infected mouse bladder. Magnifications are shown at the bottom of the images. Uninfected Infected 1 d post Chitosan Infected Infected 3 d post Chitosan 3 d post Chitosan Infected 3 d post Chitosan Infected 7 d post Chitosan 10 !M 10 !M 10 !M 100 !M 1 !M 10 !M A B C D E F 37 interconnected by tubular projections (Fig. 3.5). The nature of these projections remains unknown, but they appear too large to be pili and too numerous to be flagella as typical of this particular UPEC isolate. Chitosan enhances the efficacy of antibiotics within the bladder UPEC present in the bladder at 3 d postinoculation are, for the most part, localized within the urothelium barrier and are consequently protected from the effects of both host cell-impermeable and -permeable antibiotics (3). By forcing the resurgence of UPEC from reservoir populations, we reasoned that chitosan may render the bacteria more susceptible to host defenses and antibiotics. To assess this possibility, mice were treated with chitosan or phosphate buffer alone at 3 d postinoculation with UTI89. Mice were subsequently administered 3 or 7 daily doses of antibiotics, including the host cell-impermeable aminoglycoside gentamicin and two host cell-permeable fluoroquinolones, ciprofloxacin and sparfloxacin. Controls were given with water (carrier) alone by gavage. The animals were then allowed 3 additional days to clear the antibiotics from their systems before bladders were recovered, homogenized, and plated to determine bacterial titers. In these assays, chitosan treatment without subsequent administration of antibiotics stimulated marked, though sporadic, outgrowth of UTI89 in the bladders of some, but not all of the test animals (Fig. 3.6), corroborating with results from the SEM analysis. The delivery of antibiotics for either 3 or 7 d had minimal effects on bacterial titers within the bladder tissue, in line with previous 38 Figure 3.6 Chitosan treatment coupled with antibiotic treatment reduces bacterial titers Mice, infected with 107 UTI89, were treated on day 3 with buffer or chitosan (50 μl of 0.02% chitosan). Buffer/chitosan treatment was followed by either a 3 d or 7 d control or antibiotic treatment (Gent = gentamicin, SPX = sparfloxacin, CIP = ciprofloxacin). A schematic showing the administration of chitosan and antibiotics is diagrammed below the graph. Graph is combined data from two separate experiments with greater than 11 mice per group. 100 101 102 103 104 105 106 107 108 *** * Antibiotic Duration (d) - + + - + - + - + - - 3 3 3 7 7 7 7 CIP SPX Gent *** ** Chitosan ** Experiment Length (d) 9 13 0 1 2 3 4 5 6 7 8 9 10 11 12 (d) Sacrifice +/- Antibiotic Infect +/- Chitosan CFU/Bladder 39 observations (3). However, the treatment of bladders with chitosan prior to antibiotic administration significantly reduced bacterial titers, an effect that was much more pronounced with the 7 d antibiotic treatments (Fig. 3.6). These data indicate that chitosan can be used to enhance the efficacy of antibiotics within the bladder, likely by stimulating the efflux of UPEC reservoirs as well as decreasing the permeability barrier function of the urothelium. Mice show recurrence despite near elimination of UPEC bladder reservoirs By greatly reducing the level of detectable UPEC reservoirs within the bladder tissue, we hypothesized that chitosan treatment followed by the administration of sparfloxacin would result in decreased episodes of overt UTI recurrence as measured by urine titers. To test this, infected mice were treated on day 3 with chitosan or buffer, and then given sparfloxacin or water control for 7 consecutive days. Urine titers were collected once daily for >80% of the mice and plated directly on LB agar plates, noting the volume of urine collected. Samples that produced bacterial lawns when plated were assumed to contain a minimum of 4000 CFU. Urine titer data for 15 d following cessation of antibiotic treatment is shown in Fig. 3.7A. Titers of >104 colony forming units (CFU)/ml were counted as a recurrent/relapsing UTI. These were detected in all experimental groups over the course of these assays, though untreated mice receiving neither chitosan nor sparfloxacin had significantly more individual 40 Figure 3.7 Chitosan and antibiotic treatment fails to prevent recurrence (A) Urine titers measuring recurrence in infected mice mock treated or treated with 7 days of sparfloxacin, or sparfloxacin following chitosan treatment on day 3. Urine counts were not serially diluted, and thus a lawn, or a count over 1000 CFU/ml was considered as a recurrence event (above dotted line). (B) Total recurrence events observed for each mouse from panel A over the 15 d measurement. Each individual collection from each individual mouse was described as recurrent or below limit of recurrence. Statistics were performed as (A) Fischer's Exact Test, or (B) Mann Whitney U test with P = *<0.05, ***<0.001. Graphs are combined data from two separate experiments with greater than 11 mice per group. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 100 101 102 103 104 105 106 Buffer + H20 Buffer + SPX Chitosan + SPX **** ****** ****** * * Days Post Treatment CFU/mL Urine A B Buffer + H2O Buffer + SPX Chitosan + SPX 0 5 10 15 *** *** Recurence Events/ Mouse 41 recurrence events as determined by urine titers over the course of 15 d (Fig. 3.7B and data not shown). All 11 untreated mice exhibited a recurrence at some point during the 15 d period, whereas nearly half (5) of the mice treated with chitosan and sparfloxacin had no recurrence events (Fig. 3.7B). Mice treated with sparfloxacin alone faired only slightly worse. Both test treatments significantly delayed the onset of recurrent UTIs, with urine titers rising only after 3 or 7 days following the sparfloxacin or chitosan plus sparfloxacin treatments, respectively. Discussion In this manuscript, chitosan was used as a tool to trigger selective exfoliation of superficial bladder epithelial cells in a murine model of UTI. Chitosan acts to disrupt tight junctions between superficial bladder cells resulting in exfoliation of host epithelial cells, with little observable inflammation (32). Interestingly, chitosan only acts on the surface layer of the urothelium, leaving the intermediate and basal layers of epithelial cells mostly intact (32). Using chitosan, the UPEC reservoir populations were observed to be present in both the underlying layers of the urothelium and the superficial bladder epithelial cells. Additionally, UPEC was shown to invade underlying epithelial cells as efficiently as superficial cells during murine infection. Massive efflux of UPEC into the bladder lumen was observed after chitosan treatment of mice, suggesting chitosan can force the resurgence of UPEC from the intracellular reservoirs, perhaps by triggering the differentiation of the immature host cells or otherwise altering the intracellular milieu so that 42 bacterial growth and release is favored. SEM imaging of infected bladders after chitosan treatment revealed numerous bacteria on lumenal surface, many of which were filamentous. These bacteria often elaborated unusual interbacterial connections that are morphologically reminiscent of recently described "nanotubes." Bacterial nanotubes have been shown to mediate the direct transfer of proteins and, possibly, RNA between bacterial cells (5). These tubules also provide a network for exchange of molecules both within and between species and likely contribute structurally to bacterial communities. It is not yet clear if chitosan promotes the formation of these structures, although their presence at late time points following the administration of chitosan and in untreated bladders suggests that this is not the case. Treatment of infected mouse bladders with chitosan followed by three or seven daily doses of antibiotics resulted in significant decreases in bacterial titers within the bladder tissue. In these assays, the 7 d treatments with either sparfloxacin or ciprofloxacin were notably more effective and may have substantial therapeutic potential. However, several pitfalls do exist with the proposed strategy. Chitosan can stimulate biofilm formation and increases interactions between UTI89 and BECs in vitro, which and could thereby promote bladder colonization under some conditions. Of even greater concern, the selective exfoliation of the superficial cell layer impairs barrier function of the urothelium and could consequently allow for broader dissemination of UPEC or enable infection by opportunistic pathogens. However, the combined use of antibiotics with chitosan ameliorates these concerns. 43 A model for UPEC colonization and resurgence from within the immature cells of the urothelium is presented in Fig. 3.8 UPEC may gain entry to the underlying immature cells of the bladder as the integrity of the urothelium barrier is compromised due to the exfoliation of infected superficial cells and the influx of neutrophils. Within the basal and intermediate cells of the urothelium, UPEC do not multiply and instead establishes long-lived quiescent intracellular reservoirs. These reservoirs may eventually be delivered back to the lumenal surface of the bladder as their immature host cells migrate and differentiate into superficial epithelial cells. Changes in the intracellular environment, including perhaps the redistribution of actin filaments, may enable UPEC to reinitiate growth, leading the bacteria to exit the host vacuolar compartment and multiply within the host cytosol in close association with cytokeratin intermediate filaments (7, 17). Replication and subsequent efflux into the bladder lumen promotes the further dispersal of UPEC, which in turn can stimulate host inflammatory responses and the full spectrum of symptoms associated with a recurrent UTI. By driving the resurgence of UPEC reservoirs in the presence of antibiotics, chitosan may be able to interrupt this cycle of infection that likely contributes to the widespread nature of recurrent UTIs. The fact that chitosan treatment in combination with antibiotics could not prevent recurrent/relapsing infection in all of the animals tested in our assays indicates that the use of chitosan can be further optimized to better eradicate UPEC reservoirs within the bladder that may be present at levels below our limit of detection. It is also possible that the presence of bacterial reservoirs within nearby tissues, such as the ureters or the vaginal mucosa, may 44 Figure 3.8 Model of UPEC action (A) UPEC invade the transitional epithelium taking up residence in both superficial epithelial cells and underlying epithelial cells. (B) UPEC resident in underlying cells vertically move through the hierarchy of differentiating cells as a quiescent reservoir as the host cell progresses towards a terminally differentiated superficial epithelial bladder cell. (C) UPEC replicates and exits the quiescent intracellular reservoir within the host endocytic compartment (vacuole) before replicating rapidly in the cytosol to form IBCs. IBCs then act to disseminate UPEC to neighboring tissues to restart the cycle. Time IBC (Dispersal) Invasion Basal and Intermediate Cells Superficial Cell Vacuole UPEC Tracked Epithelial Cell A B C 45 harbor UPEC reservoirs that can recolonize the bladder following the cessation of antibiotic treatment. Recolonization of the bladder in these assays is not likely attributable to fecal contamination of the urinary tract, as we have found that mice carrying UPEC within their intestines do not spontaneously acquire UTIs (unpublished observations). Formation of IBCs allows for dispersal of the bacteria and ultimately reinoculation of the bladder lumen, and to a low frequency, further invasion of host epithelial cells. In summary, UPEC slowly move towards the surface epithelium in differentiating epithelial cells, before undergoing resurgence to further disseminate the infection and persist within the urinary tract. The idea of inducing bladder cell exfoliation as a therapeutic option for the treatment of chronic and recurrent UTIs is not new, and has been explored experimentally in previous work using protamine sulfate. When instilled into the bladder lumen, protamine sulfate triggers massive loss of the superficial cells as well as other BECs, often stripping away the urothelium to the basement membrane (25, 27). Chitosan offers a more restrained alternative, since it acts primarily on only the uppermost layers of cells. It also acts rapidly, induces little, if any, inflammation, and is likely less prone to elicit painful responses as does protamine sulfate (32). Finally, there are already anecdotal reports from outside of the USA of the use of chitosan to successfully treat human patients with chronic UTI (P. Veranic, unpublished), supporting our conclusion that chitosan may have tangible therapeutic value when used synergistically with antibiotics. 46 Materials and Methods Reagents Chitosan hydrochloride, low molecular weight, (FMC Corporation) was prepared as a 0.02% stock (w/v) in phosphate buffer (1.6 g NaCl, 0.095 KH2PO4, 0.472 NaHPO4 x 12 H2O Q.S. to 1 L H2O; pH 4.5). All antibiotics and chemicals were purchased from Sigma-Aldrich and used at the concentrations listed in the text. Bacterial strains and growth The prototypic UPEC cystitis isolate UTI89 has been described previously (4, 24). Bacteria were grown from frozen stocks in either Luria-Bertani (LB) broth or modified M9 minimal medium (6 g/liter Na2HPO4, 3 g/liter KH2PO4, 1 g/liter NH4Cl, 0.5 g/liter NaCl, 1 mM MgSO4, 0.1 mM CaCl2, 0.1% glucose, 0.0025% nicotinic acid, 0.2% casein amino acids, and 16.5 μg/ml thiamine in H2O) at 37°C. Growth curve analysis was performed as previously described using a Bioscreen C machine (Growth Curves USA) with optical density measured at 600 nm every 30 m (18). Biofilm assays In vitro microtiter plate-based biofilm assays were performed as previously described. Briefly, UTI89 was diluted 1:100 from overnight shaking cultures into M9 medium. Quadruplicate, 100 μl samples in 96-well pinchbar flat-bottomed polystyrene microtiter plates with lids (Nunc) were incubated for 48 h without 47 shaking at 37°C surrounded by distilled water to limit evaporation of samples. Nonadherent bacteria were then removed by washing twice with H2O prior to addition of crystal violet (150 μl of a 0.1% solution in water; Sigma-Aldrich). After 10 min incubation at room temperature, the wells were rinsed twice with H2O and air-dried. Dimethyl sulfoxide (200 μl; Sigma-Aldrich) was added to each well, and the plates were shaken vigorously for 15 min on an orbital shaker to solubilize the dye, and A562 was measured using a Synergy HT multidetection microplate reader (BioTek Instruments, Inc.). Biofilms were also grown on glass coverslips for 48 h in 24-well tissue culture grade plates tilted at an angle to allow for a liquid-air interface to cross the coverslip. Biofilms grown on glass coverslips were visualized using a SZX10 stereomicroscope (Olympus) equipped with a QIClick Cooled Digital CCD camera (QImaging). Association, invasion, intracellular replication assays UTI89 was grown at 37°C for 48 h in static LB broth to induce type 1 pilus expression. Triplicate sets of confluent 5637 bladder epithelial cell monolayers grown in 24-well tissue culture plates were infected with UTI89 using a multiplicity of infection of ~15 bacteria per host cell. To facilitate and synchronize bacterial contact with the host cells, plates were centrifuged at 600 x g for 5 min at room temperature at the start of infection (Beckman Allegra 6 Centrifuge). Cells were infected in conjunction with chitosan (0.002% or 0.02%) for 2 h or corresponding volume of low pH phosphate buffer. After a 2 h incubation at 37°C, samples were washed three times with PBS containing Ca2+ and Mg2+ (PBS2+) to 48 remove any nonadherent bacteria. Wells for adherence and total growth assays were collected at this time point and lysed in PBS with 0.4% Triton X-100, and bacteria present within the lysates were enumerated by plating serial dilutions on LB agar plates. Monolayers for invasion and intracellular replication assays were then incubated for another 2 h with complete RPMI medium plus 100 μg/ml of gentamicin to kill extracellular bacteria. Monolayers for invasion assays were collected at this time (4 h) and processed as described above. Invasion was graphed as normalized to associated bacteria as well as raw values for invasion CFU. For intracellular replication assays, additional washes with PBS2+ were performed, followed by addition of fresh medium containing a lower concentration of gentamicin (10 μg/ml). Incubations were continued for another 14 h. This submaximal concentration of gentamicin was used to prevent extracellular growth of UPEC while limiting possible leaching of the antibiotic into the host cells during longer incubations. After final washes in PBS2+, host cells were again lysed as described above in PBS with 0.4% Triton X-100, with bacteria enumerated by plating serial dilutions on LB agar plates. Mouse infection Seven- to 8-week-old female CBA/J mice (Jackson Laboratory) were anesthetized via isoflurane inhalation and slowly inoculated via transurethral catheterization with 50 μl of a bacterial suspension (~107 CFU from 24 h static LB broth cultures of UTI89) in PBS as previously described. Bacterial reflux into the kidneys using this procedure is rare, occurring in less than 1% of the test animals 49 (unpublished data). Chitosan (0.01% in 50 μl of pH 4.5 phosphate buffer) was administered in a similar manner using transurethral catheterization of anesthetized mice for 20 min; however, mice were rotated 180° midway through the incubation to promote exfoliation of the entire bladder. At the appropriate time point, mice were sacrificed, bladders were harvested aseptically, weighed, and homogenized in 1 ml PBS containing 0.025% Triton X-100. Bacterial titers within the homogenates were determined by plating serial dilutions on LB agar plates. Eleven mice total, from two independent experiments, were used for each condition tested. Previous published results indicate no need for mock-infected mice to be housed in cages with the infected animals (3). To determine the ability of UPEC to invade underlying tissues, mice were anesthetized and treated with chitosan. After 4 h of incubation, mice were infected as described above via transurethral catheterization. After 1 h of incubation, mice were sacrificed and bladders were aseptically removed, cut into quarters and incubated in 1 ml of gentamicin (100 μg/ml) for 1 h. Bladders were then washed and homogenized in the presence of 0.025% Triton X-100. After homogenization, bladders were serially diluted and titered as above. To determine the contribution of mouse epithelial tissues to reservoir population, mice were infected and reservoir populations were allowed to establish for 3 d. At this time, mice were treated with chitosan or buffer. Post-treatment, mice were sacrificed and bladders were rigorously washed with PBS to remove exfoliated superficial cells and lumen localized bacteria. Bladders were 50 then homogenized and titered to determine the relative contribution of tissue layers towards reservoir formation. Treatment efficacy Mice were infected as described above. At 3 days postinoculation, treatments were initiated by transurethral catheterization of mice with buffer or chitosan. A single dose of chitosan was administered on the first day of treatment (day 3) in conjunction with antibiotic treatment. Daily antibiotic treatment continued for 3 or 7 consecutive days. Gentamicin (200 μg) was given subcutaneously, while sparfloxacin (700 μg) and ciprofloxacin (40 μg) were given orally by gavage. Control animals were given water alone by oral gavage. All antibiotics were delivered in 50 μl volumes. Mice were sacrificed 3 days after the final antibiotic treatment. At this time point, bladders were harvested aseptically, weighed, and homogenized as described above, followed by serial dilution and titering of the bacteria. Mouse urine titers Mice were infected as described above. After allotted treatment regimen, urine was collected daily. Mice were placed over sterile saran wrap and allowed to urinate. Urine was collected, measured for volume, and plated on LB agar plates directly after dilution in PBS to 100 μl volume if required. We were unable to create a dilution range due to limited quantity of mouse urine, and thus all 51 colonies were counted when possible on LB plates. A count over 10,000 CFU/ml was designated as a recurrence event. SEM microscopy Infected mouse bladders were excised from animals, cut longitudinally into halves and fixed for 4 h at 4°C in a mixture of 4% paraformaldehyde and 2% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4). The tissue samples were rinsed in 0.1 M cacodylate buffer and postfixed in 1% osmium tetroxide in the same buffer for 1 h at 4°C. Specimens were critical point dried, sputter-coated with gold and examined at 15 kV with a JOEL JSM 84 A scanning electron microscope. Statistical analysis P values were determined by Student's t-test and Mann-Whitney U tests performed using Prism 5.01 software (GraphPad Software). Values of less than 0.05 were defined as significant. Acknowledgements We are grateful to Frank Rauh (FMC Corp) for providing the chitosan. This study was funded by NIH grants AI095647, DK068585, AI090369, and AI088086. M.G.B. was supported by Award Number T32AI055434 from the National Institute of Allergy and Infectious Diseases. The content is solely the responsibility of the authors and does not necessarily represent the official views 52 of the National Institute Of Allergy And Infectious Diseases or the National Institutes of Health. References 1. Anderson, G. G., K. W. Dodson, T. M. Hooton, and S. J. Hultgren. 2004. Intracellular bacterial communities of uropathogenic Escherichia coli in urinary tract pathogenesis. Trends Microbiol. 12:424-430. 2. Apodaca, G. 2004. The uroepithelium: not just a passive barrier. Traffic 5:117-128. 3. Blango, M. G., and M. A. Mulvey. 2010. Persistence of uropathogenic Escherichia coli in the face of multiple antibiotics. Antimicrob. Agents Chemother. 54:1855-1863. 4. Chen, S. L., C. S. Hung, J. Xu, C. S. Reigstad, V. Magrini, A. Sabo, D. Blasiar, T. Bieri, R. R. Meyer, P. Ozersky, J. R. Armstrong, R. S. Fulton, J. P. Latreille, J. Spieth, T. M. Hooton, E. R. Mardis, S. J. Hultgren, and J. I. Gordon. 2006. Identification of genes subject to positive selection in uropathogenic strains of Escherichia coli: a comparative genomics approach. Proc. Natl. Acad. Sci. U. S. A. 103:5977-5982. 5. Dubey, G. P., and S. Ben-Yehuda. 2011. Intercellular nanotubes mediate bacterial communication. Cell 144:590-600. 6. Eto, D. S., T. A. Jones, J. L. Sundsbak, and M. A. Mulvey. 2007. Integrin-mediated host cell invasion by type 1-piliated uropathogenic Escherichia coli. PLoS Pathog. 3:e100. 7. Eto, D. S., J. L. Sundsbak, and M. A. Mulvey. 2006. Actin-gated intracellular growth and resurgence of uropathogenic Escherichia coli. Cell. Microbiol. 8:704-717. 8. Foxman, B. 2003. Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Dis. Mon. 49:53-70. 9. Foxman, B. 1990. Recurring urinary tract infection: incidence and risk factors. Am. J. Public Health 80:331-333. 10. Hicks, R. M. 1975. The mammalian urinary bladder: an accommodating organ. Biol. Rev. Camb. Philos. Soc. 50:215-246. 53 11. Horvath, D. J., Jr., B. Li, T. Casper, S. Partida-Sanchez, D. A. Hunstad, S. J. Hultgren, and S. S. Justice. 2011. Morphological plasticity promotes resistance to phagocyte killing of uropathogenic Escherichia coli. Microbes Infect. 13:426-437. 12. Huang, E. S., and R. S. Stafford. 2002. National patterns in the treatment of urinary tract infections in women by ambulatory care physicians. Arch. Intern. Med. 162:41-47. 13. Jost, S. P., J. A. Gosling, and J. S. Dixon. 1989. The morphology of normal human bladder urothelium. J. Anat. 167:103-115. 14. Justice, S. S., C. Hung, J. A. Theriot, D. A. Fletcher, G. G. Anderson, M. J. Footer, and S. J. Hultgren. 2004. Differentiation and developmental pathways of uropathogenic Escherichia coli in urinary tract pathogenesis. Proc. Natl. Acad. Sci. U. S. A. 101:1333-1338. 15. Justice, S. S., D. A. Hunstad, P. C. Seed, and S. J. Hultgren. 2006. Filamentation by Escherichia coli subverts innate defenses during urinary tract infection. Proc. Natl. Acad. Sci. U. S. A. 103:19884-19889. 16. Kerec, M., M. Bogataj, P. Veranic, and A. Mrhar. 2005. Permeability of pig urinary bladder wall: the effect of chitosan and the role of calcium. Eur. J. Pharm. Sci. 25:113-121. 17. Khandelwal, P., S. N. Abraham, and G. Apodaca. 2009. Cell biology and physiology of the uroepithelium. Am. J. Physiol. Renal Physiol. 297:F1477-1501. 18. Kulesus, R. R., K. Diaz-Perez, E. S. Slechta, D. S. Eto, and M. A. Mulvey. 2008. Impact of the RNA chaperone Hfq on the fitness and virulence potential of uropathogenic Escherichia coli. Infect Immun. 76:3019-3026. 19. Lewis, S. A. 2000. Everything you wanted to know about the bladder epithelium but were afraid to ask. Am. J. Physiol. Renal Physiol. 278:F867-874. 20. Li, B., P. Smith, D. J. Horvath, Jr., F. E. Romesberg, and S. S. Justice. 2010. SOS regulatory elements are essential for UPEC pathogenesis. Microbes Infect. 12:662-668. 21. Liu, H., Y. Du, X. Wang, and L. Sun. 2004. Chitosan kills bacteria through cell membrane damage. Int. J. Food Microbiol. 95:147-155. 22. Martin, B. F., and Y. C. Wong. 1981. Development and maturation of the bladder epithelium of the guinea pig. Acta Anat. (Basel) 110:359-375. 54 23. Mulvey, M. A., Y. S. Lopez-Boado, C. L. Wilson, R. Roth, W. C. Parks, J. Heuser, and S. J. Hultgren. 1998. Induction and evasion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science 282:1494-1497. 24. Mulvey, M. A., J. D. Schilling, and S. J. Hultgren. 2001. Establishment of a persistent Escherichia coli reservoir during the acute phase of a bladder infection. Infect. Immun. 69:4572-4579. 25. Mysorekar, I. U., and S. J. Hultgren. 2006. Mechanisms of uropathogenic Escherichia coli persistence and eradication from the urinary tract. Proc. Natl. Acad. Sci. U. S. A. 103:14170-14175. 26. Mysorekar, I. U., M. A. Mulvey, S. J. Hultgren, and J. I. Gordon. 2002. Molecular regulation of urothelial renewal and host defenses during infection with uropathogenic Escherichia coli. J. Biol. Chem. 277:7412- 7419. 27. Parsons, C. L., C. W. Stauffer, and J. D. Schmidt. 1988. Reversible inactivation of bladder surface glycosaminoglycan antibacterial activity by protamine sulfate. Infect. Immun. 56:1341-1343. 28. Prat, V., K. Matousovic, M. Horcickova, M. Hatala, and Z. Milotova. 1989. [Prevention of recurrent urinary infections using Solco Urovac, a polymicrobial vaccine]. Cas. Lek. Cesk. 128:1106-1109. 29. Schilling, J. D., R. G. Lorenz, and S. J. Hultgren. 2002. Effect of trimethoprim-sulfamethoxazole on recurrent bacteriuria and bacterial persistence in mice infected with uropathogenic Escherichia coli. Infect. Immun. 70:7042-7049. 30. Schilling, J. D., M. A. Mulvey, C. D. Vincent, R. G. Lorenz, and S. J. Hultgren. 2001. Bacterial invasion augments epithelial cytokine responses to Escherichia coli through a lipopolysaccharide-dependent mechanism. J. Immunol. 166:1148-1155. 31. Thumbikat, P., R. E. Berry, A. J. Schaeffer, and D. J. Klumpp. 2009. Differentiation-induced uroplakin III expression promotes urothelial cell death in response to uropathogenic E. coli. Microbes Infect. 11:57-65. 32. Veranic, P., A. Erman, M. Kerec-Kos, M. Bogataj, A. Mrhar, and K. Jezernik. 2009. Rapid differentiation of superficial urothelial cells after chitosan-induced desquamation. Histochem. Cell Biol. 131:129-139. 55 33. Vigil, P. D., C. J. Alteri, and H. L. Mobley. 2011. Identification of in vivo-induced antigens including an RTX family exoprotein required for uropathogenic Escherichia coli virulence. Infect. Immun. 79:2335-2344. 34. Wang, H., G. Min, R. Glockshuber, T. T. Sun, and X. P. Kong. 2009. Uropathogenic E. coli adhesin-induced host cell receptor conformational changes: implications in transmembrane signaling transduction. J. Mol. Biol. 392:352-361. 35. Wiles, T. J., R. R. Kulesus, and M. A. Mulvey. 2008. Origins and virulence mechanisms of uropathogenic Escherichia coli. Exp. Mol. Pathol. 85:11-19. 36. Yomota, C., T. Komuro, and T. Kimura. 1990. [Studies on the degradation of chitosan films by lysozyme and release of loaded chemicals]. Yakugaku Zasshi 110:442-448. 37. Zhou, G., W. J. Mo, P. Sebbel, G. Min, T. A. Neubert, R. Glockshuber, X. R. Wu, T. T. Sun, and X. P. Kong. 2001. Uroplakin Ia is the urothelial receptor for uropathogenic Escherichia coli: evidence from in vitro FimH binding. J. Cell. Sci. 114:4095-4103. CHAPTER 4 SMALL NONCODING RNAS REGULATE THE STRESS RESISTANCE AND VIRULENCE PROPERTIES OF UROPATHOGENIC ESCHERICHIA COLI 57 Abstract Small noncoding RNA (sRNA) molecules can modulate diverse bacterial functions ranging from carbon metabolism to virulence gene expression. Here, we used a series of deletion mutants, each lacking one of seven conserved sRNAs (DsrA, RprA, OxyS, RyhB, MicF, MicC, and Spot 42) for effects on the fitness and virulence potential of the reference uropathogenic Escherichia coli (UPEC) isolate UTI89. UPEC strains are the primary etiologic agents of urinary tract infections, which consistently rank among the most common of infectious diseases. In broth culture, each sRNA deletion mutant grew like the wild type strain, whereas in biofilm assays all but the micC mutant exhibited modest, though significant defects. None of the mutants displayed increased sensitivity to nitrosative stress, but the Spot 42 (spf) and micC mutants were both markedly impaired in their ability to deal with oxidative stress generated by methyl viologen. The spf mutant, but not the others, also had diminished swim motility. Focusing further on Spot 42, we found that deletion of this sRNA significantly altered the levels of key metabolites in UTI89, including the coenzyme A precursor pantothenate. The spf mutant was also defective in its ability to multiply and persist within host bladder epithelial cells in both cell culture-based assays and in a murine infection model. Cumulatively, these results demonstrate that specific sRNA molecules can impact multiple bacterial processes that control the stress resistance and virulence capacity of UPEC both in vitro and within the host environment. 58 Introduction Small noncoding RNA (sRNA) molecules help control the translation and activity of numerous proteins in both nonpathogenic and pathogenic bacteria (7, 55, 61, 81). Base pairing between an sRNA and cognate mRNA targets can either promote or, more often, inhibit translation. Oftentimes, sRNA-mRNA interactions are facilitated by the homohexameric RNA chaperone Hfq (12). sRNAs can modulate diverse bacterial functions, including metabolism, iron utilization, the expression of outer membrane proteins (OMPs), stress resistance, and virulence (15, 25, 61, 75). Much of what we currently know about sRNAs is based on work carried out with nonpathogenic K-12 Escherichia coli isolates. In these bacteria the expression of about 90 different sRNA species has been confirmed, with more than 200 additional sRNAs predicted by in silico analyses (59, 66, 67). Many of these sRNA molecules are also encoded by pathogenic E. coli strains, including diarrheagenic isolates and strains of uropathogenic E. coli (UPEC). Previously, we reported that deletion of hfq in the UPEC reference isolate UTI89 rendered this pathogen severely attenuated in its ability to colonize both the bladder and kidneys in a mouse urinary tract infection (UTI) model system (34). The hfq mutant was also hypersensitive to oxidative and nitrosative stresses and was defective in its ability to swim and form biofilms. These results indicate that sRNAs in association with Hfq contribute significantly to the fitness and virulence potential of UPEC. UTIs caused by UPEC are among the most common of infectious diseases worldwide, representing a daunting medical and financial burden that is 59 likely to worsen as antibiotic resistance among UPEC strains increases (23). Successful colonization of the urinary tract requires that UPEC deal with a panoply of stresses and host defenses, including the bulk flow of urine, nutrient limitations, the production of reactive nitrogen and oxygen radicals, the secretion of antimicrobial compounds, and the influx of phagocytes like neutrophils (26, 50). Upon entering the lumen of the bladder, UPEC expressing filamentous adhesive organelles known as type 1 pili are able to bind and subsequently invade bladder epithelial cells, gaining at least temporary reprieve from extracellular antimicrobial factors and shear forces that work to eliminate microbes. Within bladder cells, UPEC enter into actin-bound, low pH endosomal compartments where they can persist quiescently for days to many weeks (21, 49, 52). Alternatively, UPEC may break into the host cell cytosol where they can multiply, forming large intracellular biofilm-like communities (IBCs) in close association with cytokeratin intermediate filaments (31, 49). The persistence and dissemination of UPEC within the urinary tract is facilitated by multiple factors, including the formation and eventual dispersion of IBCs as well as flagella-driven motility and the optimized use of central metabolic pathways like gluconeogenesis and the TCA cycle (1, 26). The ability of UPEC to cope with changing environmental stresses within the host likely requires rapid alteration of metabolic and stress response pathways, tasks that can potentially be facilitated with the aid of sRNA molecules. Here, taking a candidate approach using isogenic deletion mutants, we assess the effects of a panel of seven Hfq-dependent sRNA molecules on the 60 fitness and virulence potential of UPEC, before focusing in greater detail on a single sRNA, Spot 42. Materials and Methods Bacterial strains and plasmids Strains used in this study are listed in Table 4.1. Mutant strains were constructed in the human cystitis isolate E. coli strain UTI89 using the primers listed in Table 4.2 and the lambda Red recombination system, as previously described (19, 51). Chloramphenicol and kanamycin resistance cassettes, each containing their own promoter and terminator, were amplified from Salmonella strain TT23216 or plasmid pKD4, respectively (19, 34). The primers for amplification of the cassettes were designed with overhanging ends containing ~40 bp of homology to the 5' and 3' ends of target knockout sites. PCR products were then introduced by electroporation into UTI89 carrying pKM208, which encodes IPTG (isopropyl-b-D-thiogalactopyranoside)-inducible lambda Red recombinase (19). The spf and micC double knockout strain was constructed by deleting micC from UTI89Δspf using the kanamycin resistance cassette amplified from the plasmid pKD4. Knockout strains were verified by PCR amplification using primers specific to sequences flanking each target gene. The plasmids used in this study are listed in Table 4.1. Plasmids pMB1_GrxB, pMB2_Gsp, pMB3_PanC, and pMB4_YggE were constructed by PCR amplifying from UTI89 genomic DNA each gene of interest with flanking KpnI and PstI restriction digestion sites. PCR products were cut using KpnI and 61 Table 4.1 Bacterial strains and plasmids Strain or Plasmid Description Source or Reference Strains E. coli UTI89 UPEC reference strain and cystitis isolate (14, 49) MG1655 K-12 laboratory E. coli strain (10) Recombinant Strains UTI89ΔdsrA UTI89 dsrA::cat This work UTI89ΔmicC UTI89 micC::cat This work UTI89ΔmicF UTI89 micF::cat This work UTI89ΔoxyS UTI89 oxyS::cat This work UTI89ΔrhyB UTI89 rhyB::cat This work UTI89ΔrprA UTI89 rprA::cat This work UTI89Δspf UTI89 spf::cat This work UTI89ΔspfΔmicC UTI89 spf::cat, micC::kan This work UTI89ΔfimH UTI89 fimH::cat T. Wiles TT23216 Template strain with Cat cassette flanked by universal primer sequences (34) Plasmids pGEN-GFP(LVA) Encodes destabilized GFP (half-life ~40 min) under control of em7 promoter, Apr (81) pKD4 Template plasmid for use in lambda Red Recombination, Kanr (18) pKM208 IPTG-inducible lambda Red recombinase expression plasmid, Apr (52) pRR48 lacIq/ptac cloning vector, Apr (74) pMB1_GrxB grxB cloned into pRR48, Apr This work pMB2_Gsp gsp cloned into pRR48, Apr This work pMB3_PanC panC cloned into pRR48, Apr This work pMB4_YggE yggE cloned into pRR48, Apr This work pACYC184 Low copy cloning plasmid, Clmr Tetr NEB pMB5_MiaA-Flag C-terminal Flag-tagged miaA cloned into pACYC184, Tetr This work pRRK1 Modified pRR48 lacking Shine-Delgarno sequence, Apr This work pSpot42a spf cloned into pRRK1, Apr This work pMicC1 micC cloned into pRRK1, Apr This work 62 Table 4.2 Oligonucleotides employed during the study Primera Sequence (5'-3')b, c, d DsrA-KO-F TTCAGCGTCTCTGAAGTGAATCGTTGAATGCACAA TAAAACACCAAACACCCCCCAAAACC DsrA-KO-R TATTTTCTTGTCAGCGAAAAAAATTGCGGATAAGG TGATGCACACAACCACACCACACCAC DsrA-Conf-F GAAAGCGAAGTTCATCGCA DsrA-Conf-R ATTATCAAAGATGATTTTTTCGGG MicC-KO-F AAAATTATACTTTTAATTTTCTATACGTTATTCTGC GCGGCACCAAACACCCCCCAAAACC MicC-KO-R TTAAATGCTCTGGATAAGGATTATCCAATTCTA AAAAAAACACACAACCACACCACACCAC MicC-Conf-F GCCTTTCATCCCCATTTTG MicC-Conf-R ACTGGAAGAAACGTTACTTCACG MicF-KO-F TGTCAAAACAAAACCTTCACTCGCAACTAGAATAT CTTCCCACCAAACACCCCCCAAAACC MicF-KO-R CACAGAATAATGAAAAGTGTGTAAAGAAGGGTAAA AAAAACACACAACCACACCACACCAC MicF-Conf-F TGTTTCAGAATGTAAATGAAAGGG MicF-Conf-R AGATGTACAAGCGCCATTTTG OxyS-KO-F CTATCAGGCTCTCTTGCTGTGGGCCTGTAGAATAA AAAAACACCAAACACCCCCCAAAACC OxyS-KO-R GATTATCCCTATCAAGCATTCTGACTGATAATTGC TCACACACACAACCACACCACACCAC OxyS-Conf-F TCCTTTGCTCCGATCGTAAC OxyS-Conf-R GGCTAACGTGGCAGGAATC RhyB-KO-F CTTCCCGAGGATAAATTGAGAACGAAAGGTCAAA AAAAAACACCAAACACCCCCCAAAACC RhyB-KO-R GTGTTGGACAAGTGCGAATGAGAATGATTATTATT GTCTCCACACAACCACACCACACCAC RhyB-Conf-F AGTACATACGGCAGATGGTAACG RhyB-Conf-R GTGAATCTGCCTGATGGCTT RprA-KO-F TCTGATCGACGCAAAAAGTCCGTATGCCTACTATT AGCTCCACCAAACACCCCCCAAAACC RprA-KO-R TGAGGGGCGAGGTAGCGAAGCGGAAAAATGTTAA AAAAAACACACAACCACACCACACCAC RprA-Conf-F AAACCGAATAAGTAATTTCTCATCAG RprA-Conf-R CATCAATAGTCATGGCAAAAATAT Spot42-KO-F ATGCTTTCTGAACTGAACAAAAAAGAGTAAAGTTA GTCGCCACCAAACACCCCC CAAAACC Spot42-KO-R CATGGCGTATCAGGCATTACGGATCTTTTCTTTCG CCCAACACACAACCACACCACACCAC Spot42-Conf-F GAAAACTGGGATCAGGCG 63 Table 4.2 Continued Primera Sequence (5'-3')b, c, d Spot42-Conf-R TTTAGCGAGATGCAGCCTG GrxB-pRR48-F CGCGCTGCAGGTGAAGCTATACATTTACG GrxB-pRR48-R CGGCGGTACCTTAAATCGCCATTGATG Gsp-pRR48-F CGCGCTGCAGGTGATGAGCAAAGGAACGAC Gsp-pRR48-R CGGCGGTACCACATGTATTACTCTTTCACC PanC-pRR48-F CGCGCTGCAGTTAATTATCGAAACCCTGC PanC-Flag-pRR48- R ATCCGGGTACCCTATCCCTTATCGTCGTCATCCTT GTAGTCTGGTCCTCCTCCTCCCGCCAGTTCGACC AGTTTG YggE-pRR48-F CGCGCTGCAGGTGAAGTTCA AAGTTATCG YggE-pRR48-R CGGCGGTACCTTAATGTGCAGCAGGTGTTTTAGC G MiaA-pRR48-F CGGCGAATTCGGCTAAAAGTTTCTGGCGAAGAAA AATCGG MiaA-Flag-pRR48- R CGCGGAATTCCTATCCCTTATCGTCGTCATCCTTG TAGTCTGGTCCTCCTCCTCC GCCTGCGATAGCACCAACAAC Spot42-pRRK1-F CGCGCTGCAGGTAGGGTACAGAGGT Spot42-pRRK1-R CGCGGGTACCTTCTTTCGCCCAATA a F, forward primer; R, reverse primer; KO, knockout primer; Conf, confirmation primer. b Universal Primer sequence underlined c Added restriction sites underlined d Flag tag and linker sequence in bold 64 PstI restriction enzymes and ligated into pRR48 using T4 DNA Ligase (NEB)(70). pSpot42a and pMicC1 were similarly constructed using pRRK1, a derivative of pRR48 that lacks a ribosome binding site following the ptac promoter. To create pMB5_MiaA-Flag, the miaA gene in UTI89 was amplified, along with 200 base pairs upstream of the miaA start site, using primers that were designed to also incorporate flanking EcoR1 restriction sites and a C-terminal FLAG tag. The PCR product was ligated into the EcoR1 site in pACYC184 (NEB). Plasmid constructs were verified by sequencing. Growth assays UTI89 and its derivatives were grown from frozen stocks in either Luria- Bertani (LB) broth, 100 mM morpholineethanesulfonic acid (MES)-buffered LB (LB-MES; pH 5.0), or modified M9 minimal medium (6 g/l Na2HPO4, 3 g/l KH2PO4, 1 g/l NH4Cl, 0.5 g/l NaCl, 1 mM MgSO4, 0.1 mM CaCl2, 0.1% glucose, 0.0025% nicotinic acid, 0.2% casein amino acids, and 16.5 μg/ml thiamine in H2O) (Sigma-Aldrich) at 37°C overnight in loosely capped 20-by-150-mm borosilicate glass tubes at a 30º angle with shaking at 225 rpm. Overnight cultures were diluted 1:100 into 100-well honeycomb plates and assayed for growth using a Bioscreen C instrument (Growth Curves USA) as described (34). Growth was assessed in LB-MES ± 1 mM sodium nitrite and in LB broth ± 1 mM EDTA, 0.01% sodium dodecyl sulfate, or 1 mM methyl viologen (MV, Sigma- Aldrich). Antibiotics were added to maintain plasmids as necessary for growth of overnight cultures, but not for subsequent growth assays (Sigma-Aldrich). 65 Superoxide dismutase (SOD) assays A superoxide dismutase detection kit was purchased from Cell Technologies, Inc. and used according to the manufacturers specifications. Briefly, UTI899 and UTI89Δspf were grown to OD600 of 0.1, 0.2, and 0.4 in LB broth + 1 mM MV, pelleted, and lysed in B-PER (Thermo Scientific) prior to analysis. The superoxide dismutase detection kit relies on the SOD-inhibitable conversion of a highly water-soluble tetrazolium salt (WST-1 (2-(4-Iodophenyl)- 3-(4-nitrophenyl)-5-(2,4-disulfophenyl)- 2H-tetrazolium monosodium salt) to a yellow WST-1 formazan dye upon reduction with superoxide anions produced by xanthine oxidase. Reduced production of the WST-1 formazan dye, as measured by assaying absorbance at 440 nm, correlates with increased SOD activity. Measurements were normalized to the OD600 of each bacterial culture sample just prior to collection. Motility assays Bacterial swimming motility was determined by inoculating 0.2% agar plates with a toothpick dipped into an overnight culture of each strain. Care was taken to break the surface but not touch the bottom of the plate, to avoid possible initiation of twitching motility. Plates were incubated face up at 37°C and bacterial spreading was measured at 2-h intervals for 10 h. Values are from three independent experiments done in triplicate. Swarm motility assays were performed using 0.5% Eiken agar plates supplemented with 0.5% glucose. Five 66 μL of bacteria were spotted on the surface of the plate and allowed to swarm overnight (16 h) at 37°C. Biofilm assays In vitro microtiter plate-based biofilm assays were performed as previously described (34). Bacteria were diluted 1:100 from overnight shaking cultures into modified M9 medium, and quadruplicate 100-ml samples added to 96-well pinchbar flat-bottomed polystyrene microtiter plates (Nunc) were incubated with lids for 48 h without shaking at 30°C. Sample-containing wells were surrounded by wells with H2O only to minimize evaporation. Nonadherent bacteria were removed by washing twice with H2O prior to addition of crystal violet (150 μl of a 0.1% solution in water; Sigma-Aldrich). After a 10-min incubation at room temperature, the wells were rinsed twice with H2O and air-dried. Dimethyl sulfoxide (200 μl; Sigma-Aldrich) was then added to each well, and the plates were shaken vigorously for 15 min on an orbital shaker to solubilize the dye. A562 was measured using a Synergy HT multidetection microplate reader (BioTek Instruments, Inc.). Mouse infections Seven- to 8-week-old female CBA/J mice (Jackson Laboratory) were anesthetized using isoflurane inhalation and slowly inoculated via transurethral catheterization with 50 μl of bacteria (~107 CFU from 24 h static LB broth cultures) resuspended in PBS as previously described (34). Bacterial reflux into 67 the kidneys using this procedure is rare, occurring in less than 1% of the test animals (unpublished data). At 6 h, 1 d, 3 d, or 9 d postinoculation, mice were sacrificed and bladders were harvested aseptically, weighed, and homogenized in 1 ml PBS containing 0.025% Triton X-100. Bacterial titers within the homogenates were determined by plating serial dilutions on LB agar plates. Eleven mice total, from two independent experiments, were used for each condition tested. Numbers of intracellular bacteria present at the 6 h time point were determined using an ex vivo gentamicin protection assay as described (65). Reservoir populations of UPEC within bladder tissues were enumerated as previously described (9). Briefly, at 3 d post-inoculation mice were treated for 3 consecutive days with gentamicin (200 μg in 50 ml delivered subcutaneously) in order to sterilize the urine and kill any extracellular bacteria. Control animals received subcutaneous injections of PBS. Mice were sacrificed 3 d after the final antibiotic treatment and bacterial titers within the bladder were determined as described above. Competition experiments were performed as described (1), using a final inoculating dose of 107 CFU with equal numbers of wild type and mutant bacteria. IBC quantification CBA/J mice were infected with UTI89/pGEN_GFP(LVA) or UTI89Δspf/pGEN_GFP(LVA) via transurethral catheterization. Six h post-inoculation, mice were sacrificed and bladders were removed, halved, splayed, and pinned down lumenal side up on silicon disks (Sylgard 184 silicone 68 elastomer, Dow Corning Corp.) under Ringer solution [5 mM NaCl, 3 mM HCl, 2 mM CaCl2, 1 mM MgCl2, 3 mM NaH2PO4, 10 mM glucose, and 5 mM Hepes (pH 7.4)]. GFP positive IBCs were visualized and enumerated using a SZX10 stereomicroscope (Olympus) equipped with a Canon PowerShot A640 10.1 megapixel camera mounted via a Camadapter kit (camadapter.com). Metabolomics Chemicals and reagents were of the highest purity and purchased from Sigma-Aldrich, except for MSTFA (N-methyl-N-(trimethylsilyl) trifluoroacetamide), which was purchased from Thermo Scientific, and methoxyamine hydrochloride, which was purchased from MP Biomedicals (Solon, OH). Six biological replicates of each strain were used per experiment. Cultures were grown to an OD600 of 1.0, pelleted by centrifugation, and frozen. Pellets were resuspended in 5 ml of boiling 75% EtOH (aqueous), vortexed, and then incubated at 90°C for 5 min. Cell debris was removed by centrifugation at 5000 x g for 3 min. Supernatant were transferred to new tubes and dried en vacuo. GC-MS analysis was performed using a Waters GCT Premier mass spectrometer fitted with an Agilent 6890 gas chromatograph and a Gerstel MPS2 autosampler. Dried samples were suspended in 40 μl of a pyridine solution containing 40 mg/ml O-methoxylamine hydrochloride and incubated for 1 h at 30°C. Twenty ml of each sample was transferred to an autosampler vial and incubated with MSTFA for 30 min at 37°C with shaking. One ml of sample was injected into the inlet, which was held at 250°C. The gas chromatograph was 69 obtained using an initial temperature of 95°C for 1 min followed by a 40°C/min ramp up to 110°C, with a hold time of 2 min. This was followed by a second 5°C/min ramp up to 250°C, and then a third ramp up to 350°C, with a final hold time of 3 min. A 30 m Restek Rxi-5 MS column with a 5 m long guard column was employed for analysis. Data were collected using MassLynx 4.1 software and analysis of known metabolites was performed using QuanLynx. To identify unknown metabolites, data from peaks that were picked using MarkerLynx and exported to SIMCA-P (ver. 12.0.1), where principal component analysis and partial least squares - differential analysis was performed. Adhesion, invasion, and intracellular replication assays Bacteria were grown at 37°C for 48 h in 20 ml static LB broth to induce type 1 pilus expression. Cultured 5637 bladder epithelial cells (ATCC HTB-9) were grown in RPMI 1640 supplemented with 10% fetal bovine serum (Hyclone, Logan, UT) at 37°C with 5% CO2. Triplicate sets of confluent 5637 bladder epithelial cell monolayers in 24-well tissue culture plates were infected using a multiplicity of infection of ~15 bacteria per host cell. To facilitate and synchronize bacterial contact with the host cells, plates were centrifuged at 600 x g for 5 min at room temperature using a Beckman Allegra 6 Centrifuge. After a 2-h incubation at 37°C, samples were washed three times with PBS containing Ca2+ and Mg2+ (PBS2+) to remove any nonadherent bacteria. For adherence assays, host cells were lysed at this point by addition of PBS containing 0.4% Triton X- 100. For invasion assays, the monolayers were incubated prior to lysis for an 70 additional 2 h in complete RPMI medium with 100 μg/ml of gentamicin added to kill any extracellular bacteria. For intracellular growth/persistence assays, after the 2-h incubation with medium containing 100 μg/ml gentamicin, infected monolayers were washed with PBS2+ and fresh medium containing 10 μg/ml gentamicin was added. This submaximal concentration of gentamicin was used to prevent extracellular growth of UPEC while limiting possible leaching of the antibiotic into the host cells during longer incubations (49). After an additional 14- h incubation, monolayers were washed with PBS2+ and lysed. Bacteria present in the lysates recovered during these assays were enumerated by plating serial dilutions on LB agar plates. Statistical analysis P values were determined by Student's t tests or by Mann-Whitney U tests performed using Prism 5.01 software (GraphPad Software). Values of less than 0.05 were defined as significant. Results and Discussion Construction of sRNA deletion mutants The sRNAs chosen for analysis in this study are well conserved among K-12 E. coli and UPEC isolates, and several have been implicated as important regulators of gene expression in closely related Salmonella strains (24, 54, 57, 74). Each of the sRNAs examined here are known to target one or more mRNAs (Table 4.3). Two of the sRNAs (DsrA and RprA) promote expression of the 71 Table 4.3 Tested sRNA molecules Name Length (UTI89) Sequence Identity with MG1655 Known Targets* Reference DsrA 86 100 H-NS, rpoS, gadAX, hdeAB, gadBC, ehxCABD (36-38, 41, 68) RprA 104 100 rpoS, csgD, ydaM (40, 46) OxyS 109 100 fhlA, rpoS, yhiV, yhiM, gadB, dps, uhpT, pqqL (2, 3, 79) Spot 42 108 100 galK, gsp, dppB, fucK, fucI, ebgC, gltA, maeA, glpF, sthA, nanC, srlA, xylF, ascF, atoD, caiA, fucP, paaK, puuE (7, 8, 47) RyhB 89 100 sdhCDAB, acnA, fumA, ftnA, bfr, sodB, sodA, cysE, entCEBAH, iscRSUA, fdoG, nuoA (43) (20, 63, 72) (6) MicC 108 97 ompC, ompD (13, 56) MicF 92 99 ompF, lrp, yahO, lpxR (5, 17, 29) * Genes in bold indicate targets that are activated by the indicated sRNA, all other targets are repressed. 72 stationary-phase sigma factor RpoS, while another (OxyS) inhibits RpoS synthesis (60). The sRNA MicC acts to repress the synthesis of OmpC and OmpD, while the sRNA MicF interferes with OmpF expression (4, 13). Recent work indicates that MicF can also repress translation of the global transcriptional regulator Lrp, the periplasmic protein YahO, and the lipid A-modifying enzyme LpxR (17, 29). The sRNA RyhB helps regulate iron homeostasis (43), and the archetypal sRNA Spot 42 (spf) is known to modulate basal metabolic processes in coordination with the global regulators CRP and cAMP (7, 8). Spot 42 is an abundant sRNA in both K-12 E. coli strains and the UPEC isolate UTI89 ((62) and manuscript in preparation), and when induced to high levels can affect the activities of other sRNA molecules by competing for Hfq binding sites (48, 62). Each of these seven conserved sRNAs was deleted individually in the UPEC reference strain UTI89 using the lambda-Red recombination system. Mutants were verified by PCR analysis and tested against the wild type strain in a series of in vitro experiments (Fig. 4.1). sRNA-mediated regulation of biofilm formation by UPEC All of the sRNA deletion mutants grew normally in standard LB broth and in modified M9 minimal medium (Fig. 4.1A and data not shown). Likewise, all mutants grew like wild type UTI89 in the presence of the divalent cation-chelating agent EDTA (1 mM) or the surfactant sodium dodecyl sulfate (0.01%) (data not shown). Each mutant also expressed wild type levels of type 1 pili, as determined by yeast agglutination assays, and each was similarly hemolytic on blood agar 73 Figure 4.1 sRNAs modulate biofilm formation, swim motility, and stress resistance of UTI89 (A) Growth of a wild type UTI89 and isogenic sRNA deletion mutants in LB broth. (B) Biofilm formation by UTI89 and its derivatives was measured following growth in modified M9 medium at 30°C in microtiter plates. (C) Quantitation of swim motility over the course of 10 h at 37°C. Motility of the spf mutant is shown separately in (D) for clarity. Graphs in (E) and (F) show growth curves of UTI89 and the sRNA mutants in MES-LB broth + 2 mM ASN and in LB broth + 1 mM MV, respectively. Data in B-D represent the mean ± SE of at least three independent experiments performed in triplicate or quadruplicate. P values were determined by Student's t test; *P<0.05, **P<0.01, ***P<0.001, versus the wild type control. Graphs in A, E, and F show the means of triplicate samples from representative experiments carried out three or more times. Error bars in these graphs were negligible. 74 LB 0 10 20 30 0.0 0.5 1.0 1.5 UTI89 !dsrA !rprA !spf !oxyS !ryhB !micC !micF Time (h) OD600 2 mM ASN 0 5 10 15 20 0.0 0.5 1.0 1.5 UTI89 !micC !ryhB !spf !oxyS !rprA !dsrA !micF Time (h) OD600 Swim Motility 0 5 10 0 50 100 UTI89 !dsrA !rprA !oxyS !ryhB !micC !micF Time (h) Distance Travelled (% UTI89) 1 mM MV 0 5 10 15 20 25 0.0 0.2 0.4 0.6 0.8 UTI89 !micC !ryhB !spf !oxyS !rprA !dsrA !micF Time (h) OD600 Swim Motility 0 5 10 0 50 100 UTI89 * !spf * * * Time (h) Distance Travelled (% UTI89) Biofilm Assay UTI89 !spf !dsrA !rprA !oxyS !ryhB !micC !micF 0 50 100 * ** ** *** *** *** Absorbance562 A C E F D B 75 plates, indicating normal secretion of the UPEC-associated pore-forming toxin a-hemolysin (data not shown). In microtiter plate-based biofilm assays carried out at 37°C all of the sRNA knockout mutants behaved like the wild type strain, but at 30°C, where biofilm formation by UPEC is generally more robust, all of the sRNA mutants, aside from ΔmicC, were at least modestly defective (Fig. 4.1B). In these assays, the ΔoxyS mutant was the most attenuated in biofilm development, a phenotype that may be in part attributable to the misregulation of OxyS targets like RpoS (80). Deletion of the sRNAs DsrA and RprA can also disrupt the balance of RpoS regulation, and could thereby compromise biofilm formation (22, 44). In addition, RprA may modulate the development of biofilms by UTI89 via effects on the stationary phase-induced biofilm regulator CsgD and the diguanylate cyclase YdaM (46). Spot 42 promotes the motility of UPEC Motility of the sRNA mutants was assessed using both swarm and swim assays. All strains behaved similarly on swarm motility plates, and all but the Δspf mutant displayed wild type swimming phenotypes (Fig. 4.1C and D, and data not shown). In these swim motility assays, UTI89Δspf consistently lagged behind the wild type strain by about 1 h. Interestingly, a recent microarray-based study implicated Spot 42 as a negative regulator of motility and chemotaxis in the salmon pathogen Aliivibrio salmonicida (27), indicating that Spot 42 homologues can have divergent effects on bacterial behavior across species. 76 Spot 42 and MicC enhance UPEC resistance to oxidative stress Nitrosative and oxidative stresses are known to play important roles in the host response to myriad infections, including UTIs (30, 35, 39, 58). The effect of nitrosative stress on growth of the sRNA mutants was investigated using acidified sodium nitrite (ASN), which produces nitrous acid, NO and other reactive nitrogen species upon addition to LB-MES broth (pH 5.0) (78). Sensitivity to oxidative stress was tested using MV, which generates superoxide radicals in LB broth culture (28). All of the strains grew similarly in LB-MES with or without 2 mM ASN (Fig. 4.1E and data not shown). In contrast, the micC and spf mutants had clear and highly reproducible growth defects in the presence 0.5, 1, and 2 mM MV (Fig. 4.1F and data not shown). Complementation using a plasmid encoding spf driven by a pTac promoter rescued growth of the spf mutant in the presence of MV (Fig. 4.2A). The micC mutant could be similarly complemented, dependent upon the level of induction by IPTG (Fig. 4.2B). A double knockout lacking both spf and micC rendered UTI89 more sensitive to MV than either single deletion alone, suggesting that these two sRNAs promote oxidative stress resistance via effects on independent pathways, potentially involving multiple targets (Fig. 4.2C). For example, by repressing the translation of OmpD and OmpC, MicC can alter the permeability of the bacterial envelope to MV and other damaging radicals (13, 53, 64). Likewise, Spot 42 might decrease the porosity of the bacterial envelope to oxygen radicals via its ability to repress translation of a number of transporters, permeases, and porin- 77 Figure 4.2 Spot 42 and MicC modulate oxidative stress resistance in UTI89 The strains indicated in (A-C) were grown shaking in plate format at 37°C in LB broth + 1 mM MV, and optical density (OD600) measurements over time were obtained using a Bioscreen C instrument. Strains carrying the empty vector pRRK1 served as controls. In (A), Spot42 expression from the pSpot42a plasmid was induced by addition of 1 mM IPTG. To complement the micC mutant in (B), a range of IPTG concentrations, in 10-fold increments from 10 to 1000 mM, was used to induce MicC expression. Leaky expression of MicC was sufficient to complement growth of UTI89ΔmicC, while increasing concentrations of IPTG negatively affected growth. Each curve (A-C) represents the means of quadruplicate samples, and are representative of experiments performed three or more times. (D) SOD activity of UTI89 and UTI89Δspf following growth in LB broth + 1 mM MV. Measurements were normalized to the OD600 of each culture taken just before collection, and represent the means ± SE of three independent experiments performed in triplicate. P values were determined by the Student's t test; ***P<0.001, versus wild type UTI89. 1 mM MV 0 5 10 15 20 25 0.0 0.2 0.4 0.6 UTI89 !spf !micC Time (h) OD600 A B C SOD Assay 0 10 20 30 40 *** *** 0.2 0.4 UTI89 UTI89!spf OD600 = 0.1 SOD Activity 1 mM MV 0 10 20 30 0.0 0.2 0.4 0.6 UTI89 / pRRK1 UTI89 / pMicC1 UTI89!micC / pRRK1 UTI89!micC / pMicC1 UTI89!micC / pMicC1 UTI89!micC / pMicC1 UTI89!micC / pMicC1 IPTG Time (h) OD600 D 1 mM MV 0 5 10 15 20 25 0.0 0.1 0.2 0.3 0.4 0.5 UTI89 / pRRK1 UTI89 / pSpot42a UTI89!spf / pRRK1 UTI89!spf / pSpot42a Time (h) OD600 78 79 like molecules, including AscF, GlpF, SlrA, NanC, FucP, and XylF (see Table 4.3) (7, 8). Spot 42 and MicC could also influence the sensitivity of UTI89 to oxidative stress independent of effects on the bacterial envelope. For example, focusing on just Spot 42 with its broader range of known and predicted mRNA targets, we observed that, in the presence of 1 mM MV, UTI89Δspf had significantly reduced SOD activity relative to the wild type strain (Fig. 4.2D). Spot 42 is not known to regulate the expression of any SOD enzymes, although the web-based tool TargetRNA predicts that Spot 42 may base pair with mRNA encoding the tRNA prenyltransferase MiaA, which we found does positively influence the resistance of UPEC to oxidative stress (unpublished observations, (71)). However, the use of reporter constructs has so far failed to establish miaA as a bona fide target of Spot 42. Additional in silico analyses indicated that Spot 42 might bind messages for the oxidative stress defense protein YggE and the atypical glutaredoxin Grx2, while a recent microarray-based study suggested that Spot 42 promotes the expression of the glutathionylspermidine synthetase/amidase fusion protein Gsp (7). Each of these gene products has the potential to enhance bacterial resistance to oxidative stress (16, 33, 73), but overexpression of recombinant YggE (pMB4_YggE), Grx2 (pMB1_GrxB) or Gsp (pMB2_Gsp) did not rescue growth of UTI89Dspf in the presence of MV (data not shown). It is feasible that the combined effects of multiple Spot 42 targets dictate the sensitivity of UTI89 to MV. Interestingly, the spf mutant grew like wild type UTI89 in the presence of other oxidative stressors, including H2O2 (0.6 mM), menadione (40 mg/ml), 80 cumene hydroperoxide (25 mM), and plumbagin (0.05 mM) (data not shown), suggesting that Spot 42 does not alter UPEC resistance to all forms of oxidative stress. This sort of selective susceptibility of a mutant E. coli strain to different types of oxidative stress has been noted previously (e.g., glutaredoxin mutants) (73). Altered metabolism of UTI89Δspf Spot 42 can help fine-tune the regulation of central and secondary metabolic processes in K-12 laboratory-adapted strains of E. coli (7, 8, 47). Taking a metabolomics approach employing gas chromatography coupled with mass spectroscopy to measure levels of 47 common metabolites in UTI89 and UTI89Δspf, we found evidence that Spot 42 can also affect key metabolic processes in UPEC. Following growth in LB broth to an OD600 of 1.0, UTI89Δspf had significantly reduced levels of lactate, 2-phosphoglycerate, and pantothenate, but higher levels of ribose, 2-hydroxyglutarate, and b-alanine (Fig. 4.3, see also Supplemental Fig. 4.1)). These changes suggest broad irregularities in carbon utilization by the spf mutant, potentially impacting glycolysis, fatty acid metabolism, and the pentose phosphate pathway, among others. At the root of these irregularities may be the decreased ability of UTI89Δspf to efficiently convert b-alanine into pantothenate, the direct precursor of the acyl carrier Coenzyme A (CoA). Decreased levels of CoA can affect multiple metabolic processes, including the generation of reducing equivalents like NADH. Deficiencies in the production of nicotinamide adenine dinucleotide 81 (NADH) may contribute to the increased sensitivity of UTI89Δspf to MV (see Fig. 4.1F). However, induced expression of the pantothenate synthetase PanC, which catalyzes the conversion of b-alanine and pantoate into pantothenate (18), was not sufficient to restore wild type growth of the spf mutant in the presence of MV (data not shown). Of note, the altered abundance of CoA precursors measured in UTI89Δspf is not attributable to spurious turnover of acetyl-CoA by the chloramphenicol acetyltransferase enzyme encoded by this mutant, as another mutant (UTI89ΔfimH) carrying the same antibiotic resistance cassette was indistinguishable from the wild type strain with respect to its metabolomics profile. Spot 42 regulates the intracellular persistence of UTI89 Interactions between UTI89Δspf and host cells were initially assessed using the human bladder epithelial cell line known as 5637. In these cell culture-based assays, the spf mutant associated with the bladder cells in higher numbers than wild type UTI89, but both mutant and wild type strains invaded the host cells with similar frequencies (Fig. 4.4A - B). Over extended 14-h assays, UTI89Δspf displayed a reduced ability to persist within the bladder cells (Fig. 4.4C). These experiments were complemented using a well-established murine UTI model in which adult female CBA/J mice were infected via transurethral catheterization (9). In non-competitive assays, similar numbers of wild type UTI89 and UTI89Δspf were recovered from bladders at 6 h, 1 d, and 3 d post-inoculation (Fig. 4.5A-C). Both strains were also able to colonize bladders similarly at the 3 d time point in competitive assays, in which equal numbers of 82 Figure 4.3 Deletion of spf alters key metabolic processes in UTI89 The abundance of 47 common metabolites in UTI89 and UTI89Δspf was determined using gas chromatography in association with mass spectroscopy. Only metabolites that were significantly different between the wild type and mutant strain are shown. Data are presented as the means ± SD of 6 independent replicates. *P<0.05 for all UTI89Δspf samples versus wild type UTI89, as calculated by Student's t test. Metabolomics lactate 2-phosphoglycerate ribose 2-hydroxyglutarate !-alanine pantothenate 0 50 100 150 200 UTI89 UTI89"spf Percent (%) UTI89 Control * * * * * * 83 Figure 4.4 Spot 42 modulates interactions between UTI89 and host bladder cells (A) UTI89Δspf associates with cultured bladder epithelial cells at higher levels than wild type UTI89. (B) Both mutant and wild type strains invade the host cells similarly, (C) but over the course of a 14-h assay in the presence of gentamicin the spf mutant is less able to persist intracellularly. Data are expressed relative to wild type UTI89 as the means ± SD of three or more experiments performed in triplicate. *P<0.05 or ***P<0.001, versus the wild type control as determined by the Student's t test. Cell Associated % Total 0 50 100 150 200 *** UTI89 UTI89!spf Cell Associated (%) Invasion Index 0 25 50 75 100 125 UTI89 UTI89!spf Invasion (%) A B C Intracellular Survival 0 25 50 75 100 125 * UTI89 UTI89!spf CFU/mL 84 Figure 4.5 Spot 42 promotes the intracellular persistence of UTI89 in a murine model of UTI Adult female CBA/J mice were inoculated via transurethral catheterization with 107 CFU of UTI89 or UTI89Δspf. (A-C) Bacterial titers in bladders were determined at 6 h, 1 d, and 3 d postinoculation. (D) For competitive assays in which mice were infected with equal numbers of the wild type and mutant strains (107 CFU total), bladder titers were calculated at the 3 d time point. (E) Numbers of intracellular bacteria were determined at 6 h postinoculation using ex vivo gentamicin protection assays. (F) IBCs were visualized and enumerated by fluorescent microscopy of splayed bladders recovered at 6 h postinoculation with strains carrying pGEN_GFP(LVA). (G) Bladder-associated UPEC reservoirs were assessed at 8 d postinoculation, three days after a 3-d systemic treatment with gentamicin. Bars denote median values for each group. *P<0.05, as determined using the Mann-Whitney U test. Graphs depict cumulative results from two independent assays (n = 11 mice per group). 85 0 10 20 30 IBCs * UTI89 UTI89!spf IBC/Bladder Half Reservoir Assay 0 50000 100000 150000 200000 * UTI89 UTI89!spf CFU/g Bladder Competition Assay, 3 d 100 101 102 103 104 105 106 107 108 109 UTI89 UTI89!spf CFU/g Bladder A C B 6 h + 1 h gentamicin 100 101 102 103 104 105 106 * UTI89 UTI89!spf CFU/mL D 3 d 100 101 102 103 104 105 106 107 108 109 1010 UTI89 UTI89!spf CFU/g Bladder 1 d 100 101 102 103 104 105 106 107 108 109 UTI89 UTI89!spf CFU/g Bladder 6<