Posttranscriptional regulation of the envelope in Escherichia coli

Prokaryotes make extensive use of posttranscriptional regulation to modulate diverse cellular processes such as central carbon metabolism, stress response pathways, and virulence determinants. Posttranscriptional regulation in Escherichia coli is mediated via two broadly characterized methods. The first utilizes small noncoding RNAs (sRNAs) which bind target mRNA transcripts to alter their stability and translation. Nearly all characterized sRNAs function jointly with an RNA chaperone protein, Hfq. The second method employs mRNA-binding proteins which directly mediate translational inhibition or activation upon mRNA targets. Posttranscriptional regulation by both methods was recently demonstrated important to pathogenesis by several bacterial organisms. This study addresses the role of posttranscriptional regulation in uropathogenic Escherichia coli (UPEC), the organisms responsible for the majority of urinary tract infections. Specifically, deletion of Hfq, an RNA chaperone required for many sRNA-mRNA interactions, strongly reduced infection in murine models of cystitis and pyelonephritis and virtually eliminated formation of UPEC intracellular bacterial communities (IBCs). The hfq mutant experienced severe sensitivities to membrane disrupting agents such as polymyxin B, reactive oxygen species (ROS) and reactive nitrogen species (RNS) during in vitro models of host innate immune function. These phenotypes mirrored those of a !E-deleted UPEC, suggesting Hfq's involvement in posttranscriptional regulation of virulence was largely exerted at the bacterial envelope. In addition, RNS-treatment of ! ! "#! UPEC resulted in posttranscriptional downregulation of CpxP, a periplasmic regulator of the Cpx envelope stress response pathway. This downregulation was dependent on carbon storage regulator A (CsrA), a protein posttranscriptional regulator, as overexpression of CsrB, an sRNA antagonist of CsrA function, was sufficient to prevent as well as overcome downregulation of CpxP by RNS. Overexpression of CpxP in the presence of RNS proved beneficial to growth, however, suggesting CpxP downregulation by urinary RNS may not just disrupt UPEC's envelope, but impair the Cpx pathway involved in its repair. Anti-nitrotyrosine immunoblotting and mass-spectrometry indicate nitrosation of CsrA at tyrosine 48, a residue immediately adjacent to the domain implicated in RNA interaction, possibly altering CsrA's binding properties. These results demonstrate posttranscriptional regulation assisting virulence, but also imply manipulation by the host to deter growth.

POSTTRANSCRIPTIONAL REGULATION OF THE ENVELOPE IN ESCHERICHIA COLI by Richard Russell Kulesus A dissertation submitted to the faculty of The University of Utah in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Experimental Pathology Department of Pathology The University of Utah December 2011 Copyright ! Richard Russell Kulesus 2011 All Rights Reserved The Univers i ty of Utah Graduate School STATEMENT OF DISSERTATION APPROVAL The dissertation of Richard Russell Kulesus has been approved by the following supervisory committee members: Matthew Mulvey , Chair 5/12/2010 Date Approved Warren Voth , Member 5/12/2010 Date Approved Dean Tantin , Member 5/12/2010 Date Approved John Weis , Member 5/12/2010 Date Approved Robert J. Weiss , Member 5/12/2010 Date Approved and by Peter E. Jensen , Chair of the Department of Pathology and by Charles A. Wight, Dean of The Graduate School. ABSTRACT Prokaryotes make extensive use of posttranscriptional regulation to modulate diverse cellular processes such as central carbon metabolism, stress response pathways, and virulence determinants. Posttranscriptional regulation in Escherichia coli is mediated via two broadly characterized methods. The first utilizes small noncoding RNAs (sRNAs) which bind target mRNA transcripts to alter their stability and translation. Nearly all characterized sRNAs function jointly with an RNA chaperone protein, Hfq. The second method employs mRNA-binding proteins which directly mediate translational inhibition or activation upon mRNA targets. Posttranscriptional regulation by both methods was recently demonstrated important to pathogenesis by several bacterial organisms. This study addresses the role of posttranscriptional regulation in uropathogenic Escherichia coli (UPEC), the organisms responsible for the majority of urinary tract infections. Specifically, deletion of Hfq, an RNA chaperone required for many sRNA-mRNA interactions, strongly reduced infection in murine models of cystitis and pyelonephritis and virtually eliminated formation of UPEC intracellular bacterial communities (IBCs). The hfq mutant experienced severe sensitivities to membrane disrupting agents such as polymyxin B, reactive oxygen species (ROS) and reactive nitrogen species (RNS) during in vitro models of host innate immune function. These phenotypes mirrored those of a !E-deleted UPEC, suggesting Hfq's involvement in posttranscriptional regulation of virulence was largely exerted at the bacterial envelope. In addition, RNS-treatment of ! ! "#! UPEC resulted in posttranscriptional downregulation of CpxP, a periplasmic regulator of the Cpx envelope stress response pathway. This downregulation was dependent on carbon storage regulator A (CsrA), a protein posttranscriptional regulator, as overexpression of CsrB, an sRNA antagonist of CsrA function, was sufficient to prevent as well as overcome downregulation of CpxP by RNS. Overexpression of CpxP in the presence of RNS proved beneficial to growth, however, suggesting CpxP downregulation by urinary RNS may not just disrupt UPEC's envelope, but impair the Cpx pathway involved in its repair. Anti-nitrotyrosine immunoblotting and mass-spectrometry indicate nitrosation of CsrA at tyrosine 48, a residue immediately adjacent to the domain implicated in RNA interaction, possibly altering CsrA's binding properties. These results demonstrate posttranscriptional regulation assisting virulence, but also imply manipulation by the host to deter growth. TABLE OF CONTENTS ABSTRACT ...................................................................................................................... iii ACKNOWLEDGMENTS ............................................................................................... viii CHAPTERS: 1. INTRODUCTION ......................................................................................................... 1 The incorrigible lifestyle of UPEC ......................................................................... 2 Nitrosative stress responses .................................................................................... 6 Posttranscriptional regulation in E. coli .................................................................. 8 Protein-based posttranscriptional regulation: CsrA ................................. 9 Small-concoding RNAs and the RNA chaperone Hfq .......................... 12 Summary ............................................................................................................... 16 References ............................................................................................................. 18 2. CSRA-MEDIATED POSTTRANSCRIPTIONAL REGULATION OF THE CPX PATHWAY IN UROPATHOGENIC ESCHERICHIA COLI UNDER NITROSATIVE STRESS ........................................................................................... 30 Abstract ................................................................................................................. 30 Introduction ........................................................................................................... 31 Results ................................................................................................................... 34 Cpx reporter constructs .......................................................................... 34 RNS effects on CpxP expression ........................................................... 37 Growth phase- and RelA-dependent effects on CpxP expression in the presence of RNS ........................................................ 39 CsrA-mediated downregulation of CpxP by RNS ................................. 42 Overexpression of CpxP enhances bacterial growth in ASN ................ 45 Cpx confers a competitive advantage to UPEC within the urinary tract ........................................................................... 48 Discussion ............................................................................................................. 46 Experimental procedures ...................................................................................... 57 Plasmid constructs ................................................................................. 57 Bacterial strains and growth conditions ................................................. 58 Western blot analysis ............................................................................. 62 Microarray sample preparation .............................................................. 63 v i Microarray gene expression analysis ..................................................... 64 Microarray data accession number ........................................................ 64 RT-PCR analysis .................................................................................... 64 Mouse infections .................................................................................... 65 Statistics ................................................................................................. 66 Acknowledgements ............................................................................................... 66 References ............................................................................................................. 67 3. IMPACT OF THE RNA CHAPERONE HFQ ON THE FITNESS AND VIRULENCE POTENTIAL OF UROPATHOGENIC ESCHERICHIA COLI .................................................................................................. 78 Abstract ................................................................................................................. 79 Introduction ........................................................................................................... 79 Materials and methods .......................................................................................... 80 Strains and plasmids .............................................................................. 80 Mouse infections .................................................................................... 81 Growth assays ........................................................................................ 81 Biofilm assays ........................................................................................ 81 Agglutination, cell association, and invasion assays ............................. 81 Motility assays ....................................................................................... 81 Polymyxin B sensitivity assays .............................................................. 81 LPS profiling .......................................................................................... 81 Statistics ................................................................................................. 81 Results ................................................................................................................... 81 The disruption of hfq attenuates UPEC colonization of the urinary tract ............................................................. 81 Hfq affects UPEC growth at low pH and resistance to RNS and ROS ................................................................... 81 Effects of Hfq on UPEC motility ........................................................... 82 Hfq functions in biofilm formation ........................................................ 82 Hfq is required for UPEC resistance to polymyxin B ............................ 83 Phenotypic overlap among hfq, rpoS, and rpoE mutants ....................... 84 Discussion ............................................................................................................. 84 Acknowledgments ................................................................................................. 85 References ............................................................................................................. 85 Supplemental table and figure .............................................................................. 87 4. DISCUSSION .............................................................................................................. 89 UPEC are adaptive pathogens ............................................................................... 89 The Protein-mRNA mediated arm of PTR: CsrA ................................................. 90 How does CsrA regulate CpxP? ............................................................ 91 Functional consequences of CsrA nitration ........................................... 93 PTR by Hfq ........................................................................................................... 96 vi i LPS alteration: symptom or cause? ........................................................ 98 Structural consequences of OMP misregulation .................................. 104 Biofilm regulation by sRNAs .............................................................. 105 UPEC: The !E mutant that lived .......................................................... 107 Complicity of Hfq and CsrA ............................................................................... 110 Importance of PTR in UPEC .............................................................................. 113 References ........................................................................................................... 118 APPENDIX A. MECHANISMS AND CONSEQUENCES OF BLADDER CELL INVASION BY UROPATHOGENIC ESCHERICHIA COLI ................................. 130 B. ORIGINS AND VIRULENCE MECHANISMS OF UROPATHOGENIC ESCHERICHIA COLI ............................................................................................... 141 ACKNOWLEDGMENTS This work is, in truth, the product of a brain trust led by Dr. Matthew Mulvey. As a mentor he provided not just poignant scientific questions and a stimulating environment, but an inquisitiveness and contagious zeal for the subject that has inspired me and earned my admiration. His support, encouragement, experience and expertise have been superlative in accomplishing this endeavor. Additionally, I am deeply grateful to my thesis committee, Drs. John Weis, Dean Tantin, Warren Voth and Robert Weiss for their crucial advice and acuity. A special thanks is owed the members of the Mulvey Lab, past and present, for remarkable interactions, scientific and otherwise; one of the greatest compliments I can bestow on Dr. Mulvey is he picks good people who work hard and assist each other. Moreover, thanks to Kimberly Antry, Sara Ray, Tricia Sweeney, Kim Cash, Dan Hutten, Joel Taylor, AJ Boldan, LJ Johnson and Richie Harris of the Pathology Department for keeping the path running smooth. Lastly, and most importantly, my profound gratitude to my wife, Marci, and our children, Logan, Elisabeth, and Gavin, for their unending love, encouragement, and comfort. They are the reason behind this. CHAPTER 1 INTRODUCTION Worldwide, urinary tract infections (UTI) rank among the most common human infections, second only to respiratory infections (1, 2). Strains of uropathogenic Escherichia coli are the causative agent of more than 80% of UTIs and also represent a significant proportion of nosocomial infections (3, 4). Though not commonly lethal, the sheer number of UTIs represent an enormous financial and health burden worldwide (1, 3). UTIs are strikingly predominant in women, likely attributable to anatomical differences such as reduced urethral length and proximity of the urethral meatus to the perineum, a possible staging point for infection (5, 6). Moreover, while approximately 50% of women will experience at least one UTI in their lifetime, the rate of recurrence is high, with one in four women having recurrent or relapsing infections (7). Interestingly, within individual patients, recurrent infections tend to be caused by UPEC strains that are phenotypically and/or genotypically identical to the strain responsible for the initial acute infection (8-10). In certain instances, UTI recurrence or relapse with identical strains has occurred months-to-years subsequent to the initial infection (11). 2 The incorrigible lifestyle of UPEC UPEC have evolved numerous virulence mechanisms that facilitate infection of the normally sterile urinary tract (12). As summarized in Fig. 1.1, factors and events associated with increased UPEC survival within the urinary tract include, but are not limited to, the expression of adhesive organelles, biofilm formation, flagella, and the activation of numerous stress response pathways. Crosstalk among host and bacterial factors dictates the course of disease, ultimately leading to the eradication or further dissemination of the pathogens, or, alternatively, to a sort of détente in which UPEC can persist within host tissues for long periods without eliciting overt damage or inflammatory reactions. Key virulence factors encoded by virtually all UPEC isolates are type 1 pili, which are phase-variable polymeric fibrous adhesive organelles expressed on the bacterial surface (13, 14). Located at the distal tip of each type 1 pilus is an adhesin, FimH, which binds mannosylated glycoprotein receptors on bladder epithelial cells (see Fig. 1.1). FimH receptors include uroplakin Ia (UPIa) and !3"1 integrin complexes (15). UP1a expression is limited primarily to terminally differentiated bladder epithelial cells where it associates with other uroplakin proteins to form hexagonal complexes that coat nearly the entire lumenal surface of the bladder (16, 17). !3"1 integrins, on the other hand, are more broadly distributed throughout the bladder epithelium and other tissues, where they act as key signaling and adherence factors that regulate the formation of focal adhesions and other cellular processes (15, 18-20). Binding of FimH initiates a cascade of intracellular signaling events culminating in internalization of UPEC via an actin- and microtubule-dependent zipper-like mechanism (21) (see Fig. 1.1). 3 Once within a host cell, UPEC may replicate, forming large biofilm-like inclusions termed intracellular bacterial communities (IBCs) or "pods" (22-29). Alternately, UPEC may remain intracellular, bound within a late endosomal compartment in a more quiescent state, or the pathogens may traffic back out of the host cell (20) (see Fig. 1.1). Intracellular multiplication of UPEC is seemingly dependent upon the abundance of actin within the target host cell. This conclusion is based in part on the observation that intracellular bacterial replication occurs rampantly in the actin-poor, terminally differentiated superficial bladder epithelial cells, while UPEC growth is severely restricted within the immature, actin-rich underlying cells (25) (Fig. 1.1). The ability of UPEC to invade and persist quiescently within the immature cells of the bladder FIG. 1.1 Overview of UPEC infection in the bladder. UPEC are shown in blue (not to scale), terminally differentiated bladder epithelial cells are presented as the large hexagonal structures, with small immature bladder cells visible beneath. (1) UPEC adhering to bladder epithelial cells via type 1 pili (short rods). Once cellular attachment is made, UPEC can invade host cells via a zipper-like mechanism (2). Epithelial cells eventually exfoliate in response to infection (3) enabling UPEC to colonize the underlying immature cell layers (4). Host defenses such as polymorphonuclear leukocytes and nitric oxide (NO, red and blue spheres) (5) help resolve the infection. 4 for many weeks to months may help explain the remarkable predilection for UTIs to recur. Quiescent reservoirs of UPEC within immature bladder cells may undergo resurgence as the occupied host cells terminally differentiate, a process accompanied by dramatic redistribution of cellular actin filaments (25). Aggregation of UPEC into biofilm-like communities, including IBCs or extracellular aggregates, is known to positively influence the infection process, and factors that enhance biofilm formation, such as the autoaggregation surface protein antigen 43, improve UPEC persistence in the bladder (30). Aggregation and biofilm formation may concentrate nutrients and enable UPEC to better resist antimicrobial factors, including antibiotics (31). While sessile activities associated with biofilm formation have marked influence on the UPEC infectious cycle, flagella-mediated motility has also been shown to confer a competitive advantage. Specifically, motility facilitates UPEC ascension into the upper urinary tract, as demonstrated in several studies in which flagellated UPEC were observed to have a significant advantage over non-motile competitors during UTI (24, 32-34). Host defenses against UPEC include the presence of high solute concentrations within the urine, which are generally inhibitory to bacterial growth, and the generation of high shear forces associated by the regular flow of urine, that work to remove non-adherent or loosely adherent bacteria (35). These largely passive methods of maintaining environmental sterility are enhanced by the production of many anti-bacterial compounds, including small cationic peptides known as defensins that are capable of disrupting bacterial membrane integrity (36), and iron sequestration factors such as lactoferrin that deprive invading bacteria of essential iron. Soluble factors such as 5 secretory immunoglobulin A (sIgA) and Tamm-Horsfall protein also bind bacteria, preventing adherence to host cells and assisting the removal of microbes from the urinary tract with the flow of urine (37, 38). The normally long-lived bladder epithelial cells can themselves be sacrificially shed via an apoptotic-like mechanism to facilitate removal of bound and internalized bacteria (27, 39, 40). However, bladder cell exfoliation may also provide UPEC with access to deeper layers of the bladder epithelium. UPEC must also deal with infiltrating neutrophils and other immune effector cells that act to eliminate pathogens by phagocytosis and by the release of numerous anti-bacterial compounds, including reactive nitrogen species (RNS) and reactive oxygen species (ROS) (Fig. 1.1.5). RNS and ROS can covalently modify and damage lipids, proteins, and nucleic acids (RNA and DNA), disrupting components both within the bacterial cytosol as well as the bacterial envelope, including the inner and outer membranes and the intervening periplasmic space (26, 41-44). Additional sources of RNS and ROS include bladder epithelial cells, which contribute RNS during the course of a UTI (45) and UPEC themselves under anaerobic or microaerophilic conditions where RNS forms as a metabolic by-product during reduction of abundant urinary nitrate to nitrite (46). Nitrite itself is also a reactive end product of nitric oxide (NO) generation. Urine nitrite levels, which can exceed 500 !M, are frequently used as a diagnostic indicator of UTI (46). Of note, UPEC isolates are often able to resist RNS levels that prevent growth of standard laboratory E. coli K12 strains (44, 47, 48). 6 Nitrosative stress responses E. coli and other bacterial species employ multiple oxidative and nitrostive stress sensing and response systems. Among these is the prototypical SOS stress response pathway, which is activated by DNA damage caused by various agents, including oxygen radicals and RNS such as S-nitrosothiols (49). Interestingly, the SOS response can also be activated by polyamine compounds (50, 51), and polyamines such as cadaverine can enhance the resistance of UPEC to RNS (47, 52). Multiple redox-sensitive pathways and factors, such as the transcriptional regulators SoxR, OxyR, and NorR, recognize and respond to oxidative and nitrosative stresses by upregulating flavorubredoxins, oxidoreductases, iron-transporters and catalases, which act to detoxify nitrosative and oxidative radicals (53-59). Virtually all of the RNS- and ROS-responsive systems described to date are cytosolicly localized. The bacterial envelope represents the principle interface between a bacterium and its environment. It is here that early detection of, and first responses to, environmental and host-generated stresses are most likely to occur. Due to the highly ionic nature of many RNS and ROS, the bacterial envelope is only variably permeable to these radicals. RNS- and ROS-mediated damage to lipids and proteins within the envelope is therefore are plausible, especially in the face of host inflammatory responses. Considering these facts, I hypothesized that one of the earliest bacterial responses to nitrosative stress is activation of envelope stress response pathways. To address this hypothesis I generated short-lived GFP promoter fusion reporter constructs to assess activation of a canonical envelope stress response pathway, the Cpx system (Fig. 1.2). This system is composed of three principle components: the integral 7 inner-membrane histidine kinase CpxA; the cytosolic transcription factor CpxR; and the periplasmic adaptor CpxP. Under noninducing conditions, CpxP binds to the periplasmic region of CpxA, keeping CpxA in an inactive state. Under inducing stresses, such as the generation of misfolded pilin subunits within the periplasm, alkaline pH, and/or bacterial adherence to abiotic surfaces, CpxP dissociates from CpxA, allowing CpxA to phosphorylate the cytosolic response regulator CpxR. Once phosphorylated, CpxR can mediate transcriptional activation or repression of a broad set of genes including periplasmic disulfide bond catalysts, isomerases, chaperones, and proteases (60). CpxA, R, and P are also all upregulated downstream of Cpx pathway activation, although only FIG. 1.2. Schematic representation of Cpx pathway activation. Misfolded periplasmic proteins (squiggly lines) cause the periplasmic adaptor protein, CpxP, to dissociate from the sensor-kinase CpxA, resulting in CpxA activation and subsequent phosphorylation of the response regulator CpxR. Acting as a transcription factor, CpxR modulates the expression of over 100 genes, including cpxP. As periplasmic stress is alleviated, CpxP binds once again binds and inhibits CpxA as part of an autoinhibitory mechanism. 8 CpxP expression is entirely dependent upon the CpxR transcription factor (46). Because of this last property, CpxP reporter constructs are often used as sensitive indicators of Cpx activation (61, 62). Using a similar approach, I exploited a cpxP promoter fusion to assess activation of the Cpx pathway in response to nitrosative stress, with the hypothesis that RNS would induce misfolding of periplasmic proteins. Chapter 2 of this dissertation describes results from my study of the Cpx pathway in UPEC under nitrosative stress. Using Cpx reporter constructs, I demonstrate the proper induction of these reporters under Cpx-inducing conditions, but also observed that, contrary to my hypothesis, CpxP expression under nitrosative stress was completely abolished. Notably, RNS-mediated repression of other Cpx gene products, aside from CpxP, was not observed. RT-PCR and microarray analysis indicated that repression of CpxP expression in response to RNS occurred via a posttranscriptional mechanism. Coincident with the ablation of CpxP expression, I also observed massive upregulation of several cytosolic nitrosative stress response genes and multiple genes associated with motility. These results indicate potentially important functional links among the Cpx system, nitrosative stress responses, motility, and posttranscriptional regulators of gene expression in UPEC. Posttranscriptional regulation in E.coli In assessing potential mechanisms for the posttranscriptional control of CpxP expression in the presence of RNS, I became intrigued with the general mechanisms of posttranscriptional regulation (PTR) in bacteria. In particular, how do pathogens employ PTR to modulate virulence? In UPEC, what specific virulence determinants are regulated 9 by PTR and what are the functional consequences of this regulation? These questions form the core of what this dissertation addresses. Several PTR mechanisms have been well characterized in E.coli and related species. These mechanisms fall broadly into two categories: 1) those involving interactions between regulatory proteins like CsrA with target mRNAs and 2) those where small noncoding RNAs (sRNAs) interact with specific mRNA transcripts. Both cases may involve translational repression or activation and may also affect message stability. Translational repression can result from occlusion of the Shine/Dalgarno sequence, abrogating ribosome binding. Conversely, posttranscriptional regulatory factors may promote relaxation of secondary structures within target transcripts, opening up ribosome binding sites, thereby promoting translation. Alterations to message stability occur when Hfq, in conjunction with sRNAs, protects or reveals RNase degradation sites within the mRNA (see reviews (63-66)). Protein-based posttranscriptional regulation: CsrA The PTR factor carbon storage regulator A, or CsrA, is a global regulator of glycogen biosynthesis and central carbon metabolism in E. coli, with noted homologs extending to Gram-positive organisms (67-70). CsrA is capable of translational activation, RNA stabilization, and translational inhibition, mediated by CsrA interactions with consensus ruACArGGAuGU motifs in target transcripts (71). CsrA can have broad effects leading, for example, to increased stabilization and/or translation of mRNA transcripts associated with glycolysis and the glyoxalate shunt (69, 72), acetyl-coenzyme A synthesis (73), and the flhDC master regulator of motility (74). Alternately, CsrA can downregulate metabolic processes such glycogen synthesis and gluconeogenesis (69, 75, 10 76). Furthermore in several Gram-negative bacterial pathogens CsrA regulates virulence determinants such as biofilm production (77, 78) and attachment (78), extracellular amyloid-fibrils termed curli (79), and motility (46). The ability of CsrA to regulate virulence determinants and carbon metabolism along with biofilm formation and motility has prompted speculation that this posttranscriptional regulator acts to modulate key physiological changes in bacterial pathogens as they switch from acute to chronic/persistent phases of an infection cycle (80). Interestingly, CsrA activity is itself posttranscriptionally regulated, with two genomically-encoded sRNAs, CsrB and CsrC, acting as antagonists (81, 82). Both sRNAs are almost entirely composed of variable CsrA-binding sites, with the stoichiometry of CsrB-to-CsrA binding calculated at 18:1 (83). These binding sites are believed to serve as molecular decoys to titrate CsrA dimers away from target transcripts. CsrB and CsrC are activated by the transcriptional regulator UvrY, a component of the BarA-UvrY two-component system that respond to glucose and the glycolytic end-products acetate and formate (84-86). An autoinhibitory loop is formed as CsrA induces glycolysis, producing acetate and formate, which results in activation of UvrY and increased production of the CsrB sRNA (81). Noting the large upregulation of motility-associated genes concomitant to posttranscriptional downregulation of CpxP under nitrosative stress, I hypothesized that posttranscriptional regulator CsrA may be responsible. This possibility was tested, as described in Chapter 2, by inducing overexpression of the CsrA antagonist CsrB. These experiments demonstrate that antagonization of CsrA function is sufficient to alleviate CpxP repression under nitrosative stress. To investigate the possibility of CsrA binding 11 the cpxP leader region, I determined the 5' untranslated region (UTR) of the cpxP transcript. Within the 5' UTR is a region with some homology to the known CsrA-binding consensus. I hypothesize that modification of CsrA or one or more of its targets in the presence of RNS leads to repression of CpxP translation. Key amino acid residues affected by RNS include cysteines and tyrosines. CsrA lacks cysteines, but contains two conserved tyrosine residues, Tyr48 and Tyr61. Immunoblots using nitrotyrosine-specific antibody and tandem mass-spectrometry of purified, RNS-treated CsrA indicated that Tyr48 of CsrA could be nitrated. Tyr48 is adjacent to Ile47, a residue shown to be critical to the ability of CsrA to bind RNA targets (87). In silico analyses indicate nitration of Tyr48 would introduce substantial steric hindrance within an alpha-helix containing Ile47, possibly altering the RNA-binding properties of CsrA. This may represent a mechanism whereby the binding specificity of CsrA may be altered, and may contribute to the posttranscriptional repression of CpxP expression under nitrosative stress. The ability of RNS to cause posttranscriptional downregulation of CpxP raised the question of whether this phenomenon was beneficial or detrimental to UPEC. In in vitro assays, I found that overexpression of CpxP in UPEC in the presence of RNS enhanced the growth of UPEC, while a cpxP null mutant grew similar to the wild type strain. These results suggested that CpxP levels were modulatory, rather than essential, to UPEC survival and growth in the presence of RNS. However, in a murine model of cystitis, the cpxP null mutant was significantly less fit than the parent wild type strain, at least in competition assays. Of note, cpxR and cpxA null mutants were similarly disadvantaged in vivo in competition assays. These data indicate that the Cpx system can assist growth in the murine urinary tract or in nitrosative stress conditions. This implies 12 that the downregulation of CpxP by RNS may be a host mechanism to disrupt a canonical bacterial envelope stress response pathway, thereby inhibiting the infection process. This conclusion, however, remains open to interpretation since RNS-mediated attenuation of CpxP expression may have alternate outcomes under varying environmental conditions. One particularly intriguing possibility is that RNS generated by UPEC themselves may be employed as a means to posttranscriptionally regulate the Cpx system. Small-noncoding RNAs and the RNA chaperone Hfq The second class of PTR employs sRNA base-pairing with mRNA transcripts to facilitate translational activation, repression and/or to alter message stability. These base-pairing interactions often occur through multiple, nonadjacent regions of 2-8bp (88, 89). sRNAs may inhibit translation by blocking the ribosome binding site (RBS) within the 5'-UTR. A prime example of this is the OxyS sRNA , which binds and inhibits translation of flhA mRNA (90). Activation of translation can occur when an sRNA disrupts an incipient auto-inhibitory RNA duplex in the 5' leader region of a transcript, such as occurs with the RprA and DsrA sRNAs as they interact with transcripts encoding the stationary-phase sigma factor RpoS (91-94). sRNAs may also affect translation of multiple targets. For example, DsrA not only activates translation of rpoS transcripts, but also represses translation of hns transcripts, which code for a histone-like protein (95, 96). Analysis of the differential binding and action of DsrA on the rpoS and hns tanscripts revealed that DsrA could assume multiple conformations for achieving different base-pairing interactions with its targets (95, 96). sRNAs are genomically encoded and transcribed normally from individual promoters, typically resolving in a rho-independent terminator (89). Although most sRNAs are unique genes with independent 13 promoters, at least one sRNA, SgrS, exists that is derived from an existing mRNA, transcribed opposite of the protein coding strand, (97). Of all the confirmed sRNAs in the literature, over half require a protein co-factor, Hfq, to mediate their effects. Hfq, which is highly conserved amongst bacteria and archaea, was originally characterized as a host factor required for Q" phage replication (98, 99). Forming homohexameric complexes, Hfq has noted structural similarity to eukaryotic Sm-like proteins that are involved in RNA splicing (100-103). Hfq non-specifically binds RNAs at A/U-rich sites (104), facilitating interactions between mRNAs and sRNAs (105). Hfq is involved in the pathogenesis of many organisms, including Brucella abortus (106), Pseudomonas aeruginosa (107), Listeria monocytogenes (108), FIG. 1.3. Hfq is involved in regulation of !S and !E. Hfq, shown in green, assists sRNA (shown in cyan) in interactions governing translation of the rpoS gene, coding for the "S transcription factor. Deletion of hfq results in constitutive activation of the periplasmic degradation factor DegS which degrades RseA and RseB leading to constitutive activation of "E. 14 Vibro cholerae (109), Legionella pneumophila (110), and Salmonella typhimurium (111), although it is dispensable for infection by the Gram-positive Staphylococcus auerus (112). In K12 laboratory E. coli strains, Hfq acts as a pleiotropic regulator (113), controlling the expression of at least two major bacterial sigma transcription factors (see Fig. 1.3). The stationary-phase or general stress-response sigma factor "S, encoded by the rpoS gene, is regulated by three Hfq-dependent sRNAs: DsrA, RprA, and OxyS (114). "S assists bacterial adaptation to oxidative, hyperosmotic, pH, nutritional, and UV radiation stresses (115). Many phenotypes associated with hfq deletion have previously been attributed to effects on RpoS expression (116). Hfq is also involved in the regulation of rpoE, which encodes the envelope stress sigma factor "E (109, 111, 117-120). Loss of hfq results indirectly in constitutive activation of the "E regulon due to upregulation of the periplasmic protease DegS, which degrades the the "E sequestration factor RseA (111). An hfq mutant may thus be anticipated to have phenotypes resulting from effects on either the "S or the "E stress response pathways. Control of message stability and translation by sRNAs represents a potentially fast-acting method for modifying protein and mRNA levels, permitting highly specific fine-tuning of gene expression above and beyond transcriptional control. sRNAs tend to be degraded with their mRNA interaction partners, providing an auto-inhibitory mechanism, and further assisting energetic efficiency in the bacterium. Energy- and time-intensive translation is not required for sRNAs to function, enabling them to be produced and act rapidly. In this respect, sRNAs function ideally as rapid response systems, and have been found, not surprisingly, to regulate many stress-response and bacterial envelope proteins. Indeed, approximately half of the known Hfq-dependent sRNAs 15 characterized affect translation of envelope proteins. The OmrA/OmrB sRNAs regulates curli expression by directly interacting with the RBS of the csgD transcript (121). Porins or outer membrane proteins (OMPs), the predominant envelope proteins, are frequently the target of sRNA regulation (122-125). For example, expression of the highly abundant OMP, OmpA, is regulated by the sRNA MicA (126-128), while OmpC is controlled by the sRNA OmpW (118), OmpF by the sRNA MicF (129-131), and YbfM, an OMP of unknown function, by the sRNA MicM/RybB/SroB (132). These porins tend to be beta-barrel structures believed to function as solute channels through the outer membrane, although several also serve as phage receptors (133). At least two of these sRNAs, MicA and RybB, also fall under control of the #E transcriptional regulator (118). In addition, at least one two-component signal transduction system, the PhoPQ pathway, which responds to low-levels of extracellular divalent cations, is translationally regulated by the sRNA MicA (134). After addressing the involvement of the protein-mediated class of posttranscriptional regulation in UPEC, as exemplified by CsrA, I turned my attention to the possible involvement of sRNAs as mediators of UPEC fitness and virulence. To broadly test the role of sRNAs in UPEC pathogenesis, I deleted hfq from a reference UPEC isolate (UTI89) and tested its fitness and virulence potential in a range of in vivo and in vitro assays, as described in Chapter 3. Although the UPEC hfq mutant grew normally during in vitro growth analyses, it was highly defective in bladder colonization and completely unable to colonize the kidneys. In addition, the hfq mutant was virtually incapable of forming IBCs. These experiments indicate the necessity of Hfq, and hence, sRNAs during the infection process. 16 How does Hfq, and thus sRNAs, influence UPEC virulence? These observed defects in infection in vivo could be attributable to disregulation of many specific virulence determinants, including disruption of envelope integrity, improper expression of the #S response regulator, and/or the disturbance of one or more stress response pathways. As detailed in Chapter 3, in vitro assays indicate that disruption of hfq in UPEC has diverse pleiotropic effects, leading to decreased biofilm formation, reduced motility, and increased bacterial susceptibility to RNS, ROS, and envelope-disrupting cationic peptides like polymyxin B. Considering the impact that Hfq has on #E and #S, the phenotypic comparisons were made among hfq, rpoS (#S) and rpoErseABC (#E) deletion mutants. Although I observed some phenotypic overlap among these mutants, the hfq mutant was dramatically more sensitive to polymyxin B and RNS, indicating observed phenotypes associated with disruption of hfq were not solely due to disregulation of #E and #S. Moreover, the hfq mutant uniquely exhibited highly altered lipopolysaccharide, the predominant surface molecules. In total, these results demonstrate the importance of Hfq to UPEC infection, while highlighting the distinct contribution that Hfq has on bacterial phenotypes independent of the #S and #E stress response systems. Summary Taken together, the data presented in this thesis begin to delineate the critical importance of PTR in regulating the fitness and virulence potential of UPEC. The protein-mediated arm of PTR, CsrA, downregulates CpxP expression under nitrosative stress, which in turn may have direct bearing on the fitness of UPEC within the host. Although this work only begins to address indirectly the contribution of CsrA to UPEC 17 virulence, the results suggest that this posttranscriptional regulator will be a central player in the pathogenesis of UTIs. The pleiotropic effects of Hfq on UPEC virulence and fitness within the host and in in vitro assays likewise highlight the critical involvement of sRNAs as important virulence factors with wide-ranging targets. Cumulatively, this work demonstrates that PTR can vitally impact UPEC virulence mechanisms, suggesting novel means by which these pathogens can sense and respond to the numerous stresses encountered within the host environment. 18 References 1. Foxman, B. 2002. Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Am J Med 113 Suppl 1A:5S-13S-15S-13S. 2. Kucheria, R., P. Dasgupta, S. H. Sacks, M. S. Khan, and N. S. Sheerin. 2005. Urinary tract infections: new insights into a common problem. Postgrad Med J 81:83-86. 3. Foxman, B., and P. Brown. 2003. Epidemiology of urinary tract infections: transmission and risk factors, incidence, and costs. Infect Dis Clin North Am 17:227-241. 4. Ronald, A. 2002. The etiology of urinary tract infection: traditional and emerging pathogens. Am J Med 113 Suppl 1A:14S-19S-14S-19S. 5. Yamamoto, S., T. Tsukamoto, A. Terai, H. Kurazono, Y. Takeda, and O. Yoshida. 1997. Genetic evidence supporting the fecal-perineal-urethral hypothesis in cystitis caused by Escherichia coli. J Urol 157:1127-1129. 6. Moore, K. N., R. A. Day, and M. Albers. 2002. Pathogenesis of urinary tract infections: a review. J Clin Nurs 11:568-574. 7. Foxman, B. 1990. Recurring urinary tract infection: incidence and risk factors. Am J Public Health 80:331-333. 8. Brauner, A., S. H. Jacobson, and I. Kuhn. 1992. Urinary Escherichia coli causing recurrent infections-a prospective follow-up of biochemical phenotypes. Clin Nephrol 38:318-323. 9. Russo, T. A., A. Stapleton, S. Wenderoth, T. M. Hooton, and W. E. Stamm. 1995. Chromosomal restriction fragment length polymorphism analysis of Escherichia coli strains causing recurrent urinary tract infections in young women. J Infect Dis 172:440-445. 10. Ikaheimo, R., A. Siitonen, T. Heiskanen, U. Karkkainen, P. Kuosmanen, P. Lipponen, and P. H. Makela. 1996. Recurrence of urinary tract infection in a primary care setting: analysis of a 1-year follow-up of 179 women. Clin Infect Dis 22:91-99. 11. Jacobson, S. H., I. Kuhn, and A. Brauner. 1992. Biochemical fingerprinting of urinary Escherichia coli causing recurrent infections in women with pyelonephritic renal scarring. Scand J Urol Nephrol 26:373-377. 12. Wiles, T. J., R. R. Kulesus, and M. A. Mulvey. 2008. Origins and virulence mechanisms of uropathogenic Escherichia coli. Exp Mol Pathol 85:11-19. 19 13. Hull, R. A., R. E. Gill, P. Hsu, B. H. Minshaw, and S. Falkow. 1981. Construction and expression of recombinant plasmids encoding type 1 and D-mannose-resistant pili from a urinary tract infection Escherichia coli isolate. Infect. and Immun. 33:933-938. 14. Klemm, P., and K. A. Krogfelt. 1994. Type 1 fimbriae of Escherichia coli. P. Klemm, ed. CRC Press, Boca Raton. 9-26. 15. Eto, D. S., T. A. Jones, J. L. Sundsbak, and M. A. Mulvey. 2007. Integrin- Mediated Host Cell Invasion by Type 1-Piliated Uropathogenic Escherichia coli. PLoS Pathog 3:e100-e100. 16. Wu, X. R., T. T. Sun, and J. J. Medina. 1996. In vitro binding of type 1-fimbriated Escherichia coli to uroplakins Ia and Ib: relation to urinary tract infections. Proc Natl Acad Sci U S A 93:9630-9635. 17. Sun, T. T., H. Zhao, J. Provet, U. Aebi, and X. R. Wu. 1996. Formation of asymmetric unit membrane during urothelial differentiation. Mol Biol Rep 23:3- 11. 18. Hynes, R. O. 2002. Integrins: bidirectional, allosteric signaling machines. Cell 110:673-687. 19. Brakebusch, C., and R. Fassler. 2003. The integrin-actin connection, an eternal love affair. Embo J 22:2324-2333. 20. Eto, D. S., T. A. Jones, J. L. Sundsbak, and M. A. Mulvey. 2007. Integrin-mediated host cell invasion by type 1-piliated uropathogenic Escherichia coli. PLoS Pathog 3:e100. 21. Martinez, J. J., M. A. Mulvey, J. D. Schilling, J. S. Pinkner, and S. J. Hultgren. 2000. Type 1 pilus-mediated bacterial invasion of bladder epithelial cells. Embo J 19:2803-2812. 22. Mulvey, M. A., J. D. Schilling, and S. J. Hultgren. 2001. Establishment of a persistent Escherichia coli reservoir during the acute phase of a bladder infection. Infect Immun 69:4572-4579. 23. Anderson, G. G., J. J. Palermo, J. D. Schilling, R. Roth, J. Heuser, and S. J. Hultgren. 2003. Intracellular bacterial biofilm-like pods in urinary tract infections. Science 301:105-107. 24. Justice, S. S., C. Hung, J. A. Theriot, D. A. Fletcher, G. G. Anderson, M. J. Footer, and S. J. Hultgren. 2004. Differentiation and developmental pathways of uropathogenic Escherichia coli in urinary tract pathogenesis. Proc Natl Acad Sci U S A 101:1333-1338. 20 25. Eto, D. S., J. L. Sundsbak, and M. A. Mulvey. 2006. Actin-gated intracellular growth and resurgence of uropathogenic Escherichia coli. Cell Microbiol 8:704- 717. 26. Bower, J. M., D. S. Eto, and M. A. Mulvey. 2005. Covert operations of uropathogenic Escherichia coli within the urinary tract. Traffic 6:18-31. 27. Mulvey, M. A., Y. S. Lopez-Boado, C. L. Wilson, R. Roth, W. C. Parks, J. Heuser, and S. J. Hultgren. 1998. Induction and evasion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science 282:1494-1497. 28. Soto, S. M., A. Smithson, J. P. Horcajada, J. A. Martinez, J. P. Mensa, and J. Vila. 2006. Implication of biofilm formation in the persistence of urinary tract infection caused by uropathogenic Escherichia coli. Clin Microbiol Infect 12:1034-1036. 29. Wright, K. J., P. C. Seed, and S. J. Hultgren. 2007. Development of intracellular bacterial communities of uropathogenic Escherichia coli depends on type 1 pili. Cell Microbiol 9:2230-2241. 30. Ulett, G. C., J. Valle, C. Beloin, O. Sherlock, J. M. Ghigo, and M. A. Schembri. 2007. Functional analysis of antigen 43 in uropathogenic Escherichia coli reveals a role in long-term persistence in the urinary tract. Infect Immun 75:3233-3244. 31. Blango, M. G., and M. A. Mulvey. 2010. Persistence of uropathogenic Escherichia coli in the face of multiple antibiotics. Antimicrob Agents Chemother 54:1855-1863. 32. Lane, M. C., V. Lockatell, G. Monterosso, D. Lamphier, J. Weinert, J. R. Hebel, D. E. Johnson, and H. L. Mobley. 2005. Role of motility in the colonization of uropathogenic Escherichia coli in the urinary tract. Infect Immun 73:7644-7656. 33. Wright, K. J., P. C. Seed, and S. J. Hultgren. 2005. Uropathogenic Escherichia coli flagella aid in efficient urinary tract colonization. Infect Immun 73:7657- 7668. 34. Lane, M. C., C. J. Alteri, S. N. Smith, and H. L. Mobley. 2007. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A 104:16669-16674. 35. Sobel, J. D. 1997. Pathogenesis of urinary tract infection. Role of host defenses. Infect Dis Clin North Am 11:531-549. 36. Zucht, H. D., J. Grabowsky, M. Schrader, C. Liepke, M. Jurgens, P. Schulz- Knappe, and W. G. Forssmann. 1998. Human beta-defensin-1: A urinary peptide present in variant molecular forms and its putative functional implication. Eur J Med Res 3:315-323. 21 37. Orskov, I., A. Ferencz, and F. Orskov. 1980. Tamm-Horsfall protein or uromucoid is the normal urinary slime that traps type 1 fimbriated Escherichia coli. Lancet 1:887-887. 38. Duncan, J. L. 1988. Differential effect of Tamm-Horsfall protein on adherence of Escherichia coli to transitional epithelial cells. J Infect Dis 158:1379-1382. 39. Fukushi, Y., S. Orikasa, and M. Kagayama. 1979. An electron microscopic study of the interaction between vesical epitherlium and E. Coli. Invest Urol 17:61-68. 40. McTaggart, L. A., R. C. Rigby, and T. S. Elliott. 1990. The pathogenesis of urinary tract infections associated with Escherichia coli, Staphylococcus saprophyticus and S. epidermidis. J Med Microbiol 32:135-141. 41. Burney, S., J. L. Caulfield, J. C. Niles, J. S. Wishnok, and S. R. Tannenbaum. 1999. The chemistry of DNA damage from nitric oxide and peroxynitrite. Mutat Res 424:37-49. 42. Mulvey, A., D. Schilling, J. Martinez, and J. Hultgren. 2000. Bad bugs and beleaguered bladders: interplay between uropathogenic Escherichia coli and innate host defenses. Proc Natl Acad Sci U S A 97:8829-8835. 43. Mak, R. H., and H. J. Kuo. 2006. Pathogenesis of urinary tract infection: an update. Curr Opin Pediatr 18:148-152. 44. Rama, G., D. K. Chhina, R. S. Chhina, and S. Sharma. 2005. Urinary tract infections-microbial virulence determinants and reactive oxygen species. Comp Immunol Microbiol Infect Dis 28:339-349. 45. Kang, W. S., F. J. Tamarkin, M. A. Wheeler, and R. M. Weiss. 2004. Rapid up-regulation of endothelial nitric-oxide synthase in a mouse model of Escherichia coli lipopolysaccharide-induced bladder inflammation. J Pharmacol Exp Ther 310:452-458. 46. Klemm, P., G. Christiansen, B. Kreft, R. Marre, and H. Bergmans. 1994. Reciprocal exchange of minor components of Type 1 and F1C fimbriae results in hybrid organelles with changed receptor specificities. J Bacteriol 176:2227-2234. 47. Bower, J. M., and M. A. Mulvey. 2006. Polyamine-mediated resistance of uropathogenic Escherichia coli to nitrosative stress. J Bacteriol 188:928-933. 48. Svensson, L., B. I. Marklund, M. Poljakovic, and K. Persson. 2006. Uropathogenic Escherichia coli and tolerance to nitric oxide: the role of flavohemoglobin. J Urol 175:749-753. 49. Lobysheva, I. I., M. V. Stupakova, V. D. Mikoyan, S. V. Vasilieva, and A. F. Vanin. 1999. Induction of the SOS DNA repair response in Escherichia coli by 22 nitric oxide donating agents: dinitrosyl iron complexes with thiol-containing ligands and S-nitrosothiols. FEBS Lett 454:177-180. 50. Oh, T. J., and I. G. Kim. 1999. The expression of Escherichia coli SOS genes recA and uvrA is inducible by polyamines. Biochem Biophys Res Commun 264:584-589. 51. Kim, I. G., and T. J. Oh. 2000. SOS induction of the recA gene by UV-, gamma-irradiation and mitomycin C is mediated by polyamines in Escherichia coli K-12. Toxicol Lett 116:143-149. 52. Bower, J. M., H. B. Gordon-Raagas, and M. A. Mulvey. 2009. Conditioning of uropathogenic Escherichia coli for enhanced colonization of host. Infect Immun 77:2104-2112. 53. Demple, B., and C. F. Amabile-Cuevas. 1991. Redox redux: the control of oxidative stress responses. Cell 67:837-839. 54. Nunoshiba, T., T. deRojas-Walker, J. S. Wishnok, S. R. Tannenbaum, and B. Demple. 1993. Activation by nitric oxide of an oxidative-stress response that defends Escherichia coli against activated macrophages. Proc Natl Acad Sci U S A 90:9993-9997. 55. Hidalgo, E., and B. Demple. 1996. Activation of SoxR-dependent transcription in vitro by noncatalytic or NifS-mediated assembly of [2Fe-2S] clusters into apo- SoxR. J Biol Chem 271:7269-7272. 56. Dietrich, L. E., T. K. Teal, A. Price-Whelan, and D. K. Newman. 2008. Redox-active antibiotics control gene expression and community behavior in divergent bacteria. Science 321:1203-1206. 57. Hausladen, A., C. T. Privalle, T. Keng, J. DeAngelo, and J. S. Stamler. 1996. Nitrosative stress: activation of the transcription factor OxyR. Cell 86:719-729. 58. Gardner, A. M., C. R. Gessner, and P. R. Gardner. 2003. Regulation of the Nitric Oxide Reduction Operon (norRVW) in Escherichia coli. Role of NorR and Sigma 54 in The Nitric Oxide Stress Response. J Biol Chem 278:10081-10086. 59. Mukhopadhyay, P., M. Zheng, L. A. Bedzyk, R. A. LaRossa, and G. Storz. 2004. Prominent roles of the NorR and Fur regulators in the Escherichia coli transcriptional response to reactive nitrogen species. Proc Natl Acad Sci U S A 101:745-750. 60. De Wulf, P., A. M. McGuire, X. Liu, and E. C. Lin. 2002. Genome-wide profiling of promoter recognition by the two-component response regulator CpxR-P in Escherichia coli. J Biol Chem 277:26652-26661. 23 61. Raivio, T. L., D. L. Popkin, and T. J. Silhavy. 1999. The Cpx envelope stress response is controlled by amplification and feedback inhibition. J Bacteriol 181:5263-5272. 62. DiGiuseppe, P. A., and T. J. Silhavy. 2003. Signal detection and target gene induction by the CpxRA two-component system. J Bacteriol 185:2432-2440. 63. Nogueira, T., and M. Springer. 2000. Posttranscriptional control by global regulators of gene expression in bacteria. Curr Opin Microbiol 3:154-158. 64. Storz, G., J. A. Opdyke, and A. Zhang. 2004. Controlling mRNA stability and translation with small, noncoding RNAs. Curr Opin Microbiol 7:140-144. 65. Gottesman, S. 2005. Micros for microbes: non-coding regulatory RNAs in bacteria. Trends Genet 21:399-404. 66. Waters, L. S., and G. Storz. 2009. Regulatory RNAs in bacteria. Cell 136:615- 628. 67. Romeo, T., M. Gong, M. Y. Liu, and A. M. Brun-Zinkernagel. 1993. Identification and molecular characterization of csrA, a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and surface properties. J Bacteriol 175:4744-4755. 68. Liu, M. Y., H. Yang, and T. Romeo. 1995. The product of the pleiotropic Escherichia coli gene csrA modulates glycogen biosynthesis via effects on mRNA stability. J Bacteriol 177:2663-2672. 69. Sabnis, N. A., H. Yang, and T. Romeo. 1995. Pleiotropic regulation of central carbohydrate metabolism in Escherichia coli via the gene csrA. J Biol Chem 270:29096-29104. 70. Mukherjee, A., Y. Cui, Y. Liu, C. K. Dumenyo, and A. K. Chatterjee. 1996. Global regulation in Erwinia species by Erwinia carotovora rsmA, a homologue of Escherichia coli csrA: repression of secondary metabolites, pathogenicity and hypersensitive reaction. Microbiology (Reading, England) 142 ( Pt 2):427-434. 71. Dubey, A. K., C. S. Baker, T. Romeo, and P. Babitzke. 2005. RNA sequence and secondary structure participate in high-affinity CsrA-RNA interaction. RNA (New York, N.Y.) 11:1579-1587. 72. Yang, H., M. Y. Liu, and T. Romeo. 1996. Coordinate genetic regulation of glycogen catabolism and biosynthesis in Escherichia coli via the CsrA gene product. J Bacteriol 178:1012-1017. 73. Wei, B., S. Shin, D. LaPorte, A. J. Wolfe, and T. Romeo. 2000. Global regulatory mutations in csrA and rpoS cause severe central carbon stress in Escherichia coli in the presence of acetate. J Bacteriol 182:1632-1640. 24 74. Wei, B. L., A. M. Brun-Zinkernagel, J. W. Simecka, B. M. Prüss, P. Babitzke, and T. Romeo. 2001. Positive regulation of motility and flhDC expression by the RNA-binding protein CsrA of Escherichia coli. Mol Microbiol 40:245-256. 75. Baker, C. S., I. Morozov, K. Suzuki, T. Romeo, and P. Babitzke. 2002. CsrA regulates glycogen biosynthesis by preventing translation of glgC in Escherichia coli. Mol Microbiol 44:1599-1610. 76. Dubey, A. K., C. S. Baker, K. Suzuki, A. D. Jones, P. Pandit, T. Romeo, and P. Babitzke. 2003. CsrA regulates translation of the Escherichia coli carbon starvation gene, cstA, by blocking ribosome access to the cstA transcript. J Bacteriol 185:4450-4460. 77. Jackson, D. W., K. Suzuki, L. Oakford, J. W. Simecka, M. E. Hart, and T. Romeo. 2002. Biofilm formation and dispersal under the influence of the global regulator CsrA of Escherichia coli. J Bacteriol 184:290-301. 78. Wang, X., A. K. Dubey, K. Suzuki, C. S. Baker, P. Babitzke, and T. Romeo. 2005. CsrA posttranscriptionally represses pgaABCD, responsible for synthesis of a biofilm polysaccharide adhesin of Escherichia coli. Mol Microbiol 56:1648- 1663. 79. Jonas, K., A. N. Edwards, I. Ahmad, T. Romeo, U. Romling, and O. Melefors. 2009. Complex regulatory network encompassing the Csr, c-di-GMP and motility systems of Salmonella Typhimurium. Environ Microbiol. 80. Lucchetti-Miganeh, C., E. Burrowes, C. Baysse, and G. Ermel. 2008. The posttranscriptional regulator CsrA plays a central role in the adaptation of bacterial pathogens to different stages of infection in animal hosts. Microbiology 154:16-29. 81. Suzuki, K., X. Wang, T. Weilbacher, A. K. Pernestig, O. Melefors, D. Georgellis, P. Babitzke, and T. Romeo. 2002. Regulatory circuitry of the CsrA/CsrB and BarA/UvrY systems of Escherichia coli. J Bacteriol 184:5130-5140. 82. Weilbacher, T., K. Suzuki, A. K. Dubey, X. Wang, S. Gudapaty, I. Morozov, C. S. Baker, D. Georgellis, P. Babitzke, and T. Romeo. 2003. A novel sRNA component of the carbon storage regulatory system of Escherichia coli. Mol Microbiol 48:657-670. 83. Romeo, T. 1998. Global regulation by the small RNA-binding protein CsrA and the non-coding RNA molecule CsrB. Mol Microbiol 29:1321-1330. 84. Chavez, R. G., A. F. Alvarez, T. Romeo, and D. Georgellis. 2010. The physiological stimulus for the BarA sensor kinase. J Bacteriol 192:2009-2012. 25 85. Suzuki, K., P. Babitzke, S. R. Kushner, and T. Romeo. 2006. Identification of a novel regulatory protein (CsrD) that targets the global regulatory RNAs CsrB and CsrC for degradation by RNase E. Genes Dev 20:2605-2617. 86. Suzuki, K., X. Wang, T. Weilbacher, A.-K. Pernestig, O. Melefors, D. Georgellis, P. Babitzke, and T. Romeo. 2002. Regulatory Circuitry of the CsrA/CsrB and BarA/UvrY Systems of Escherichia coli. J. Bacteriol. 184:5130-5140. 87. Mercante, J., K. Suzuki, X. Cheng, P. Babitzke, and T. Romeo. 2006. Comprehensive alanine-scanning mutagenesis of Escherichia coli CsrA defines two subdomains of critical functional importance. J Biol Chem 281:31832-31842. 88. Valentin-Hansen, P., M. Eriksen, and C. Udesen. 2004. The bacterial Sm-like protein Hfq: a key player in RNA transactions. Mol Microbiol 51:1525-1533. 89. Gottesman, S. 2004. The small RNA regulators of Escherichia coli: roles and mechanisms. Annu Rev Microbiol 58:303-328. 90. Altuvia, S., A. Zhang, L. Argaman, A. Tiwari, and G. Storz. 1998. The Escherichia coli OxyS regulatory RNA represses fhlA translation by blocking ribosome binding. EMBO J 17:6069-6075. 91. Sledjeski, D. D., A. Gupta, and S. Gottesman. 1996. The small RNA, DsrA, is essential for the low temperature expression of RpoS during exponential growth in Escherichia coli. Embo J 15:3993-4000. 92. Cunning, C., L. Brown, and T. Elliott. 1998. Promoter substitution and deletion analysis of upstream region required for rpoS translational regulation. J Bacteriol 180:4564-4570. 93. Majdalani, N., C. Cunning, D. Sledjeski, T. Elliott, and S. Gottesman. 1998. DsrA RNA regulates translation of RpoS message by an anti-antisense mechanism, independent of its action as an antisilencer of transcription. Proc Natl Acad Sci U S A 95:12462-12467. 94. Majdalani, N., D. Hernandez, and S. Gottesman. 2002. Regulation and mode of action of the second small RNA activator of RpoS translation, RprA. Mol Microbiol 46:813-826. 95. Majdalani, N., S. Chen, J. Murrow, K. St John, and S. Gottesman. 2001. Regulation of RpoS by a novel small RNA: the characterization of RprA. Mol Microbiol 39:1382-1394. 96. Lease, R. A., and M. Belfort. 2000. A trans-acting RNA as a control switch in Escherichia coli: DsrA modulates function by forming alternative structures. Proc Natl Acad Sci U S A 97:9919-9924. 26 97. Wadler, C. S., and C. K. Vanderpool. 2007. A dual function for a bacterial small RNA: SgrS performs base pairing-dependent regulation and encodes a functional polypeptide. Proc Natl Acad Sci U S A 104:20454-20459. 98. Franze de Fernandez, M. T., L. Eoyang, and J. T. August. 1968. Factor fraction required for the synthesis of bacteriophage Qbeta-RNA. Nature 219:588-590. 99. Franze de Fernandez, M. T., W. S. Hayward, and J. T. August. 1972. Bacterial proteins required for replication of phage Q ribonucleic acid. Pruification and properties of host factor I, a ribonucleic acid-binding protein. J Biol Chem 247:824-831. 100. Sun, X., I. Zhulin, and R. M. Wartell. 2002. Predicted structure and phyletic distribution of the RNA-binding protein Hfq. Nucleic Acids Res 30:3662-3671. 101. Zhang, A., K. M. Wassarman, J. Ortega, A. C. Steven, and G. Storz. 2002. The Sm-like Hfq protein increases OxyS RNA interaction with target mRNAs. Mol Cell 9:11-22. 102. Moller, T., T. Franch, P. Hojrup, D. R. Keene, H. P. Bachinger, R. G. Brennan, and P. Valentin-Hansen. 2002. Hfq: a bacterial Sm-like protein that mediates RNA-RNA interaction. Mol Cell 9:23-30. 103. Arluison, V., P. Derreumaux, F. Allemand, M. Folichon, E. Hajnsdorf, and P. Regnier. 2002. Structural Modelling of the Sm-like Protein Hfq from Escherichia coli. J Mol Biol 320:705-712. 104. Pannone, B. K., and S. L. Wolin. 2000. Sm-like proteins wRING the neck of mRNA. Curr Biol 10:R478-481. 105. Vecerek, B., L. Rajkowitsch, E. Sonnleitner, R. Schroeder, and U. Bläsi. 2008. The C-terminal domain of Escherichia coli Hfq is required for regulation. Nucleic Acids Res 36:133-143. 106. Robertson, G. T., and R. M. Roop. 1999. The Brucella abortus host factor I (HF-I) protein contributes to stress resistance during stationary phase and is a major determinant of virulence in mice. Mol Microbiol 34:690-700. 107. Sonnleitner, E., S. Hagens, F. Rosenau, S. Wilhelm, A. Habel, K. E. Jager, and U. Blasi. 2003. Reduced virulence of a hfq mutant of Pseudomonas aeruginosa O1. Microb Pathog 35:217-228. 108. Christiansen, J. K., M. H. Larsen, H. Ingmer, L. Sogaard-Andersen, and B. H. Kallipolitis. 2004. The RNA-binding protein Hfq of Listeria monocytogenes: role in stress tolerance and virulence. J Bacteriol 186:3355-3362. 27 109. Ding, Y., B. M. Davis, and M. K. Waldor. 2004. Hfq is essential for Vibrio cholerae virulence and downregulates sigma expression. Mol Microbiol 53:345- 354. 110. McNealy, T. L., V. Forsbach-Birk, C. Shi, and R. Marre. 2005. The Hfq homolog in Legionella pneumophila demonstrates regulation by LetA and RpoS and interacts with the global regulator CsrA. J Bacteriol 187:1527-1532. 111. Sittka, A., V. Pfeiffer, K. Tedin, and J. Vogel. 2007. The RNA chaperone Hfq is essential for the virulence of Salmonella typhimurium. Mol Microbiol 63:193- 217. 112. Bohn, C., C. Rigoulay, and P. Bouloc. 2007. No detectable effect of RNA-binding protein Hfq absence in Staphylococcus aureus. BMC Microbiol 7:10. 113. Tsui, H. C., H. C. Leung, and M. E. Winkler. 1994. Characterization of broadly pleiotropic phenotypes caused by an hfq insertion mutation in Escherichia coli K- 12. Mol Microbiol 13:35-49. 114. Loewen, P. C., B. Hu, J. Strutinsky, and R. Sparling. 1998. Regulation in the rpoS regulon of Escherichia coli. Can J Microbiol 44:707-717. 115. Hengge-Aronis, R. 2002. Signal transduction and regulatory mechanisms involved in control of the sigma(S) (RpoS) subunit of RNA polymerase. Microbiol Mol Biol Rev 66:373-395, table of contents-373-395, table of contents. 116. Muffler, A., D. D. Traulsen, D. Fischer, R. Lange, and R. Hengge-Aronis. 1997. The RNA-binding protein HF-I plays a global regulatory role which is largely, but not exclusively, due to its role in expression of the sigmaS subunit of RNA polymerase in Escherichia coli. J Bacteriol 179:297-300. 117. Hitchcock, P. J., and T. M. Brown. 1983. Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J Bacteriol 154:269-277. 118. Johansen, J., A. A. Rasmussen, M. Overgaard, and P. Valentin-Hansen. 2006. Conserved small non-coding RNAs that belong to the sigmaE regulon: role in down-regulation of outer membrane proteins. J Mol Biol 364:1-8. 119. Figueroa-Bossi, N., S. Lemire, D. Maloriol, R. Balbontin, J. Casadesus, and L. Bossi. 2006. Loss of Hfq activates the sigmaE-dependent envelope stress response in Salmonella enterica. Mol Microbiol 62:838-852. 120. Thompson, K. M., V. A. Rhodius, and S. Gottesman. 2007. SigmaE regulates and is regulated by a small RNA in Escherichia coli. J Bacteriol 189:4243-4256. 28 121. Holmqvist, E., J. Reimegard, M. Sterk, N. Grantcharova, U. Romling, and E. G. Wagner. 2010. Two antisense RNAs target the transcriptional regulator CsgD to inhibit curli synthesis. EMBO J. 122. Guillier, M., and S. Gottesman. 2006. Remodelling of the Escherichia coli outer membrane by two small regulatory RNAs. Mol Microbiol 59:231-247. 123. Vogel, J., and K. Papenfort. 2006. Small non-coding RNAs and the bacterial outer membrane. Curr Opin Microbiol 9:605-611. 124. Valentin-Hansen, P., J. Johansen, and A. A. Rasmussen. 2007. Small RNAs controlling outer membrane porins. Curr Opin Microbiol 10:152-155. 125. Vogel, J. 2009. A rough guide to the non-coding RNA world of Salmonella. Mol Microbiol 71:1-11. 126. Rasmussen, A. A., M. Eriksen, K. Gilany, C. Udesen, T. Franch, C. Petersen, and P. Valentin-Hansen. 2005. Regulation of ompA mRNA stability: the role of a small regulatory RNA in growth phase-dependent control. Mol Microbiol 58:1421-1429. 127. Udekwu, K. I., F. Darfeuille, J. Vogel, J. Reimegard, E. Holmqvist, and E. G. Wagner. 2005. Hfq-dependent regulation of OmpA synthesis is mediated by an antisense RNA. Genes Dev 19:2355-2366. 128. Bossi, L., and N. Figueroa-Bossi. A small RNA downregulates LamB maltoporin in Salmonella. Mol Microbiol. 129. Mizuno, T., M. Y. Chou, and M. Inouye. 1984. A unique mechanism regulating gene expression: translational inhibition by a complementary RNA transcript (micRNA). Proc Natl Acad Sci U S A 81:1966-1970. 130. Andersen, J., S. A. Forst, K. Zhao, M. Inouye, and N. Delihas. 1989. The function of micF RNA. micF RNA is a major factor in the thermal regulation of OmpF protein in Escherichia coli. J Biol Chem 264:17961-17970. 131. Ramani, N., M. Hedeshian, and M. Freundlich. 1994. micF antisense RNA has a major role in osmoregulation of OmpF in Escherichia coli. J Bacteriol 176:5005- 5010. 132. Rasmussen, A. A., J. Johansen, J. S. Nielsen, M. Overgaard, B. Kallipolitis, and P. Valentin-Hansen. 2009. A conserved small RNA promotes silencing of the outer membrane protein YbfM. Mol Microbiol. 133. Datta, D. B., B. Arden, and U. Henning. 1977. Major proteins of the Escherichia coli outer cell envelope membrane as bacteriophage receptors. J Bacteriol 131:821-829. 29 134. Coornaert, A., A. Lu, P. Mandin, M. Springer, S. Gottesman, and M. Guillier. 2010. MicA sRNA links the PhoP regulon to cell envelope stress. Mol Microbiol. CHAPTER 2 CSRA-MEDIATED POSTTRANSCRIPTIONAL REGULATION OF THE CPX PATHWAY IN UROPATHOGENIC ESCHERICHIA COLI UNDER NITROSATIVE STRESS Abstract During the course of a urinary tract infection, strains of uropathogenic Escherichia coli (UPEC) can elicit a number of host inflammatory responses, including the production of reactive nitrogen species (RNS). These radicals can react with and damage membrane proteins and other components of the bacterial envelope, potentially affecting envelope stress response pathways. To address this possibility, I employed promoter-fusion reporter constructs to assess activation of the Cpx two-component envelope stress response system. I found that exposure of UPEC to RNS generated by acidified sodium nitrite (ASN) abrogated expression of a key Cpx regulon member, CpxP, by a posttranscriptional mechanism involving the global regulator CsrA. In vitro growth assays as well as in vivo competition experiments using a murine infection model indicated that the Cpx system, including CpxP, can positively affect the fitness of UPEC in the face of RNS and other stresses encountered within the host environment. In total, 31 these data indicate that RNS-mediated attenuation of CpxP expression via CsrA may factor in as a host defense within the urinary tract and at other sites of infection, but this phenomenon may also represent a mechanism by which bacteria themselves can modulate the Cpx system through the generation of endogenous RNS. Introduction Urinary tract infections (UTIs), which include cystitis and pyelonephritis, currently rank among the most common of infectious diseases within the human population (1). The vast majority of UTIs are caused by strains of uropathogenic Escherichia coli (UPEC) that can bind and invade host cells within the urinary tract (2, 3). The infection process can stimulate a number of antimicrobial and proinflammatory host responses, including the generation of nitric oxide (NO) and other reactive nitrogen species (RNS). Nitrite (NO2!) is a significant RNS present during a UTI, reaching concentrations in excess of 500 μM in the urine of infected patients (4). The activity of host nitric oxide synthases, as well as nitrate-reducing uropathogenic bacteria like UPEC, are likely sources of nitrite within the urinary tract during a UTI (5-7). Acidification of nitrite in low pH environments can result in formation of additional RNS, including nitric oxide (NO), nitrogen dioxide (NO2), and nitrous acid (HNO2) (8, 9). In the lab, acidified sodium nitrite (ASN) is a widely used system for generating RNS in vitro. During the course of a UTI, RNS like those produced via ASN are thought to contribute to the antibacterial characteristics of urine (4). 31 32 RNS damage nucleic acids, lipids, and proteins and can inactivate or alter enzymatic processes, metabolic pathways, and signal transduction cascades (10-16). In Gram-negative bacteria, RNS have been shown to stimulate a number of cytoplasmic stress responses, including the SOS pathway (17, 18), the OxyR transcription factor (19, 20), and the SoxRS two-component regulatory system (21). RNS effects on the bacterial envelope, which in Gram-negative bacteria is comprised of an inner and outer membrane and the intervening periplasmic space, are less well defined. The bacterial envelope interfaces with the external environment and functions as a selectively permeable physical barrier. Recent work using atomic force microscopy indicates that exposure of E. coli to NO can severely compromise the integrity of the envelope (22). By reacting with and damaging components of the bacterial envelope, RNS may trigger the activation of stress response pathways that specifically recognize and respond to envelope stress. In UPEC and in other E. coli strains, envelope stress is sensed by one or more of several identified systems: these include the "! and Rcs pathways along with the BaeSR and Cpx two-component systems (23-25). The Cpx system is comprised of the inner membrane histidine kinase CpxA and the cytoplasmic response regulator CpxR (26). In response to envelope stress CpxA phosphorylates CpxR, which then functions as a transcriptional regulator. CpxR controls the expression of protein folding and degrading factors involved in relieving envelope stress and can also regulate biofilm formation (27, 28), bacterial adherence (27, 29, 30), motility and chemotaxis (31), type III and type IV secretion systems (32-36), and, potentially, bacterial toxins such as #-hemolysin and cytotoxic necrotizing factor 1 (29, 32 33 37). Data from Lin and co-workers have suggested that CpxR can directly control nearly 100 genes in the E. coli K12 reference strain MG1655 (38). CpxR appears to have a key role in regulating virulence in a number of pathogens (23), including Salmonella species (39, 40), Legionella pneumophilia (32), Shigella sonnei (34-36), enteropathogenic E. coli (33), Actinobacillus suis (41), Haemophilus ducreyi (42), Xenorhabdus nematophila (43), Yersinia pseudotuberculosis (44), and potentially UPEC (29, 30, 45). In E. coli and other microbes the Cpx system is subject to negative feedback through CpxP, a small CpxR-regulated periplasmic protein that is proposed to bind the sensor kinase CpxA, keeping it in an inactive state (26, 46). CpxP is the most highly inducible member of the Cpx regulon so far identified and has elevated expression in response to both envelope stress and entry into stationary phase growth (46, 47). In addition to its role as a negative regulator of CpxA, CpxP also functions as an adaptor protein, interacting with a subset of misfolded periplasmic proteins and delivering them to the protease DegP for degradation (48, 49). In this process, CpxP is degraded along with its misfolded substrate, suggesting a mechanism by which bacteria can post-translationally modulate CpxP levels. To date, stimuli that explicitly inhibit CpxP expression have not been reported. Here, I sought to determine if RNS, which are generated in copious amounts during the course of a UTI, could influence the Cpx pathway. my results reveal an unexpected mechanism whereby nitrosative stress represses CpxP expression in a posttranscriptional manner involving the global regulatory factor CsrA (Carbon Storage Regulator). Possible consequences of this inhibitory pathway are discussed in light of 33 34 data showing for the first time that CpxP, as well as CpxR and CpxA, significantly enhance the fitness of UPEC within the urinary tract. Results Cpx reporter constructs The cpxRA operon and cpxP are separated on the E. coli chromosome by a well-conserved 146 bp segment containing two putative CpxR binding sites (Fig. 2.1.a). CpxP is among the most highly inducible members of the Cpx regulon, and in E. coli K12 strains the transcription of cpxP is almost entirely dependent upon CpxR (47, 50). To assess RNS effects on the Cpx stress response system, I created a transcriptional fusion using the 146 bp intergenic region upstream of the cpxP start site linked to a reporter gene encoding a destabilized variant of Green Fluorescent Protein (GFP-ASV). In E. coli, this GFP variant has a half-life of approximately 120 min (51), allowing us to follow expression levels of this reporter with a fine degree of temporal resolution. The cpxP-GFP reporter construct (pJLJ5) was transformed into the human cystitis isolate UTI89, and in control experiments was shown to be responsive to stimuli known to activate the Cpx pathway. Specifically, GFP-ASV expression under control of the cpxP promoter was elevated in response to overexpression of either the PapE pilin subunit or the outer membrane lipoprotein NlpE, as determined by Western blot analyses (data not shown and Fig. 2.2.a). Expression of cpxP-GFP was not observed in a mutant lacking cpxR (Fig. 2.1.b). As expected of CpxP itself (31, 47), expression of the cpxP-GFP reporter was also increased as UTI89/pJLJ5 entered into late log-phase growth (see 34 35 35 FIG. 2.1. The Cpx gene cluster and CpxR-dependent expression of the cpxP-GFP reporter. (A) Organization of the cpx genes, with the 146 bp intergenic region from which cpxRA and cpxP are divergergently transcribed shown in detail. Potential CpxR binding sites are shown in sky blue boxes, while the orange-shaded region indicates the putatitive 5'-UTR for cpxP. (B) Image shows Western blots, probed with anti-GFP antibody, used to examine the expression of cpxP-GFP (pJLJ5) and cpxR-GFP (pJLJ10) reporters in late log-phase cultures (=0.8) of wild-type UTI89 and an isogenic cpxR knockout mutant. 36 36 FIG 2.2. PapE overexpression counters ASN effects on CpxP expression. Western blots probed with anti-GFP antibody were used to detect expression of the cpxP-GFP reporter (pJLJ5) with or without IPTG-mediated induction of PapE expression (pHJ13) ± the addition of 1 mM ASN. (A) IPTG was added, as indicated, to induce PapE expression coordinate with 1 mM ASN at the 1 h time point, leading to enhanced cpxP-GFP expression. All images shown were obtained from a single blot using equivalent exposure. (B) ASN was added to cultures at the 1 h time point, while the addition of IPTG for induction of PapE expression was delayed until the 5 h time point. These experiments were repeated at least three times with similar results. 37 controls in Fig. 2.3.b). Reversing the orientation of the 146 bp cpxP promoter region in front of gfp-ASV created a putative cpxR reporter construct (pJLJ10), which served as an additional control in these studies. Expression of cpxR-GFP was only slightly diminished in the $cpxR mutant (Fig. 2.1.b), consistent with previous observations showing that, in contrast to cpxP, cpxR transcription itself is just partially regulated by CpxR. GFP expression was not detected under any of the tested conditions in UTI89 carrying a promoterless-GFP construct (pJLJ1, data not shown). Of note, for comparative analysis of Western blots in this study, I used equivalent film exposure times and ensured that equal amounts of protein from each sample were loaded onto the gels as appropriate (see Experimental Procedures). RNS effects on CpxP expression To assess the effects of nitrosative stress on the Cpx pathway, overnight cultures of the recombinant UTI89 strains grown in MES-buffered LB broth (MES-LB, pH 5) were diluted into fresh media and grown shaking for 1 h prior to the addition of 1 mM ASN to generate RNS. Exposure to ASN markedly slowed the growth of the bacteria and caused them to enter stationary phase at a lower density (Fig. 2.3.a). As anticipated, CpxP expression, as monitored using the cpxP-GFP reporter construct, was induced as UTI89 entered late log-phase growth in the absence of ASN (Fig. 2.3.b). However, in contrast to my predictions, CpxP expression in the presence of ASN was completely abolished. Under the same conditions, CpxR expression, as discerned using the cpxR-GFP reporter construct, was not notably affected by the presence of ASN (Fig. 2.3.c). Expression levels of GFP-ASV driven by a lac promoter were also unfazed by ASN (data 37 38 38 FIG. 2.3. Growth of UPEC in the presence of RNS abrogates CpxP expression. (A) Growth curves of UTI89/pJLJ5 (cpxP-GFP reporter) grown shaking in broth ± 1 mM ASN, which was added at the 1 h time point (thick arrow). (B) Western blots, probed using anti-GFP antibody, show levels of cpxP-GFP expression over time in UTI89/pJLJ5 ± ASN. (C) Western blots showing levels of the cpxR-GFP reporter in UTI89/pJLJ10 during growth ± ASN. These experiments were repeated three or more times with similar results. 39 not shown). Thus, loss of GFP-ASV expression by bacteria carrying the cpxP-GFP reporter was not simply due to enhanced proteolysis of GFP-ASV upon exposure to ASN. Rather, ASN had a seemingly specific inhibitory effect on expression of the cpxP-GFP promoter fusion. Once inhibited by exposure to ASN, expression of the CpxP did not recover for up to 24 h later (data not shown). However, forced expression of PapE, a strong inducer of Cpx activation (52), was able to prevent complete abrogation of CpxP expression in the presence of ASN (Fig. 2.2.a), and could even resurrect CpxP expression at late time points following exposure to ASN (Fig. 2.2.b). Overexpression of another potent inducer of the Cpx pathway, NlpE (53), had a similar antagonistic effect (data not shown), indicating that ASN-mediated downregulation of CpxP expression can in effect be overridden under some conditions if the Cpx pathway is sufficiently activated by other stimuli. Growth phase- and RelA-dependent effects on CpxP expression in the presence of RNS While exposure of early growth phase UTI89 cultures to ASN had a profound and lasting inhibitory effect on CpxP expression, the addition of ASN to mid-log or stationary phase cultures was seemingly inconsequential (Fig. 2.4). Coincident with bacterial entry into stationary phase is the accumulation of the alarmone guanosine tetraphosphate (ppGpp), a global transcriptional regulator that is synthesized by the relA gene product (54). As amino acids are depleted, increased ppGpp levels can drastically alter the transcriptional profile of the bacterial cell as part of the stringent response, diminishing 39 40 40 FIG 2.4. ASN effects on CpxP expression are limited in stationary phase cultures. (A) Representative growth curves of UTI89/pJLJ5 grown shaking in MES-LB in the presence (dotted line) or absence (solid line) of 1 mM ASN, which was added at the 8 h time point (arrow). (B) Western blots using anti-GFP antibody show expression of the cpxP-GFP reporter in the stationary phase cultures ± ASN. These experiments were repeated three times with similar results. 41 41 FIG. 2.5. RelA and CpxA effects on CpxP expression in UTI89. (A) Curves show growth of UTI89/pJLJ5 (cpxP-GFP reporter) carrying either pRelA (for IPTG-inducible expression of RelA) or the empty vector control pMMB66EH. ASN was added to the indicated cultures (dotted lines) at the 1 h time point, while IPTG was added to all samples at 2 h. (B) Westen blots probed with anti-GFP antibody showing levels of cpxP-GFP expression at hourly time points in the samples indicated in (A). (C) Western blots showing levels of cpxP-GFP expression over time in wild-type UTI89 versus an isogenic $cpxA mutant, either without (empty vector control) or with (pRelA) overexpression of RelA, which was induced at the 2 h time point. Results shown are representative of experiments repeated at least three times. 42 the expression of genes required for growth and proliferation while activating many genes involved in virulence and survival pathways (55). To test the capacity ppGpp levels to affect the Cpx pathway, and specifically ASN-mediated downregulation of CpxP, I employed an IPTG-inducible RelA expression construct (56). Overexpression of RelA drove UTI89 to enter stationary phase growth early (Fig. 2.5.a), and stimulated cpxP-GFP expression by as much as four fold over controls (Fig. 2.5.b). However, induced expression of RelA did not overcome the inhibitory effects of ASN on CpxP expression. CsrA-mediated downregulation of CpxP by RNS Semiquantitative reverse-transcription PCR (RT-PCR) was performed to assess cpxP message levels in UTI89 cultures grown to late log-phase (=0.8) in the presence or absence of 1 mM ASN. Amplification of 16S RNA served as a positive control in these assays. As shown in Figure 2.6.a, growth in ASN had little effect on transcription of either native cpxP or 16S RNA. Message levels of the cpxP-GFP promoter fusion was similarly unaffected by ASN, while cpxR was slightly elevated. These data indicate that ASN-mediated downregulation of CpxP expression likely occurs via a posttranscriptional mechanism. Microarray analysis of UTI89 cultures grown to OD600=0.8 with or without ASN present corroborated these results, indicating that cpxP, cpxR, cpxA, and 16S RNA expression changed in response to ASN by only 0.84-, 1.45-, 1.50-, and 0.9-fold, respectively. In sharp contrast, the expression of many genes like norV, narK, yeaR, yoaG, which are known to be responsive to nitrosative stress based on previous work from my lab and others (57-61), were massively upregulated by growth of UTI89 in 42 43 ASN, with some being activated by greater than 1,000-fold. A summary of the top 100 most highly expressed genes according to functional category is presented in Fig. 2.6.b, and the genes represented in this graph are listed in Table 2.3. Nearly half of these genes (colored blue in Fig. 2.6.b) are involved in bacterial motility, and can be positively controlled either directly or indirectly by a master regulator of motility, the multimeric DNA-binding FlhDC protein complex (62). By microarray analysis, expression levels of the genes encoding FlhDC were found to be upregulated about two-fold in the presence of ASN. As with other transcriptional regulators, even small changes in the abundance of FlhDC can potentially have sizeable effects on the expression of FlhDC-regulated genes (63). The flhDC transcript is bound and stabilized by CsrA, a global regulatory protein (64). CsrA is antagonized by two small noncoding RNA (sRNA) CsrB and CsrC, which sequester and thereby inactivate multiple CsrA homodimers (65, 66). Expression of CsrB is controlled by the BarA-UvrY two-component system, which itself is regulated by CsrA as part of an autoregulatory circuit (67). Recently, the BarA sensor kinase was shown to be responsive to formate and acetate, end products of glucose metabolism that can accumulate in growth media as bacteria transition into stationary phase (68). CsrA recognizes consensus binding sites in the 5'-untranslated region (UTR) of many transcripts and can either activate, as in the case of flhDC, or inhibit translation of these target messages (64, 69). The remarkable induction of FlhDC-regulated genes in UTI89 in the presence of ASN (Fig. 2.6.b) suggested the potential involvement of CsrA, which I hypothesized could also negatively affect cpxP translation in my assays. As 43 44 44 FIG. 2.6. Posttranscriptional control of CpxP expression by CsrA in the presence of ASN. (A) RT-PCR was performed on total RNA isolated from UTI89/pJLJ5 cultures grown to OD600=0.8 ± 1 mM ASN and primers specific for cpxR, cpxP, gfp, and 16S RNA. Mean integrated intensity rations of RT-PCR products from the ASN-treated versus nontreated samples (+ASN/-ASN) are shown, 1.0 indicating no difference in transcript levels between the +ASN and -ASN samples. (B) Pie-chart showing the top 100 upregulated genes in UTI89 grown to OD600=0.8 in the presence of 1 mM ASN, as assessed by Affymetrix E.coli 2.0 microarrays. Genes were sorted and color-coded by category, as indicated on the right. The outer bars in the graph represent fold-change differences between the ASN-treated and nontreated samples, shown on a log10 scale. (C) Western blot analysis of cpxP-GFP expression in UTI89/pJLJ5 grown in the presence of 1 mM ASN, with glucose added at the 7 h. (D) Western blots show cpxP-GFP expression in UTI89/pJLJ5 carrying either an empty vector control (pRRK1) or the IPTG-inducible CsrB expression construct pRRK2. All samples were treated with ASN at the 1 h time point, leading to abrogation of cpxP-GFP expression. This effect was countered by inducing CsrB expression with addition of IPTG at either the 1 or 4 h time points. 45 indirect support for this possibility, I found that the addition of 0.2% glucose to stationary phase cultures that were grown in the presence of 1 mM ASN resulted in the restoration of cpxP-GFP expression (Fig. 2.6.c). This effect may be explained by the ability of glucose to indirectly activate the BarA-UvrY two-component system, resulting in elevated CsrB levels and subsequent inhibition of CsrA (68). However, this interpretation is clouded by the fact that glucose can stimulate CpxP expression via the phosphotransacetylase-acetate kinase pathway and the generation of acetyl phosphate, which can directly activate CpxR (70-72). As a more direct test of CsrA involvement, I utilized an IPTG-inducible CsrB expression construct. Induced expression of CsrB either coordinate with the addition of ASN in early growth phase, or later as UTI89 entered late log phase growth, rescued expression of the cpxP-GFP reporter (Fig. 2.6.d). Together, these data indicate that CsrA can negatively affect the translation of cpxP in the presence of nitrosative stress. Overexpression of CpxP enhances bacterial growth in ASN The physiological consequences of RNS effects on the Cpx pathway, and CpxP specifically, were addressed using isogenic mutants of UTI89 lacking cpxP, cpxR, or cpxA. In control experiments, I noted that the $cpxR and $cpxA mutants were hypersensitive to amikacin, while the $cpxP mutant displayed enhanced resistance to this antibiotic (Fig. 2.7). These mutant phenotypes were rescued by complementation with plasmids encoding either cpxRA or cpxP, as appropriate. These results mirror those from previous studies in which K12 E. coli strains having mutated cpx genes displayed altered growth phenotypes in the presence of amikacin (73). Growth of UTI89 mutants lacking 45 46 46 FIG 2.7. Trans complementation of the cpx mutants. Wild-type UTI89 and the cpx null mutants ($cpxA, $cpxR, and $cpxP), each carrying either the empty vector control pGEN-MCS or complementation plasmids, were grown overnight shaking in LB broth in the presence of ampicillin, as needed, to better maintain plasmid selection. Serial dilutions of the overnight cultures were spotted onto LB agar plates containing 3 μg·ml-1 amikacin, and incubated for 24 h at 37°C. The image shows bacterial growth on the amikacin plates, with dilutions starting at 10-2 on the left and ending at 10-6 on the right. Plasmid pJLJ41 encodes cpxP downstream of its native promoter, while pJLJ42 encodes the cpxRA operon under control of its native promoter. Due to polar effects, the expression of cpxA is likely disrupted in the $cpxR mutant, and so pJLJ42 was used for complementation of both the $cpxR and $cpxA mutant strains. 47 any one of the cpx genes in LB or MES-LB broth ± 1 mM ASN was not notably different from the wild-type control strain (data not shown), suggesting that the Cpx system is not essential for UPEC resistance to RNS. However, induced overexpression of CpxP did enhance UPEC growth in the presence of ASN, enabling this pathogen to reach mid-log (=0.5) about 1 h ahead of controls (Fig. 2.8). This lead was reduced to 30 min in the absence of ASN. 47 Fig. 2.8. Overexpression of CpxP enhanced UPEC growth in the presence of RNS. Curves indicate the growth of UTI89 carrying either an empty vector control (EV, pRR48; dotted lines) or the IPTG-inducible CpxP expression construct pRRK12 (OE; solid lines). All samples were grown in the presence of 1 mM IPTG ± 1 mM ASN, as indicated. Lines depict mean values from quadruplicate samples ± S.D. 48 Cpx confers a competitive advantage to UPEC within the urinary tract While deletion of the cpx genes had no detrimental effect on growth of UTI89 in my in vitro assays, I reasoned that phenotypes associated with these mutants may become more apparent within the urinary tract where the pathogens are likely to encounter much more stringent environments replete with RNS plus numerous other antimicrobial factors. To address this possibility, I employed a well-established mouse UTI model system in which 1X107 CFU of bacteria were inoculated into adult female CBA/J mice via transurethral catheterization. After 3 d, bacterial numbers present in the bladders were determined by plating tissue homogenates. When wild-type UTI89 and each of the cpx mutants were inoculated by themselves into separate mice, no significant differences in the numbers of bacteria recovered 3 d were later observed (data not shown). However, when wild-type UTI89 was mixed 1:1 with each cpx mutant prior to inoculation, the wild-type strain was able to effectively outcompete each mutant (Fig. 2.9). These results demonstrate that the Cpx system can provide a clear competitive advantage to UPEC during the course of a UTI, supporting the possibility that dysregulation of the Cpx pathway by RNS may modulate bacterial fitness within the host environment. Discussion While the Cpx stress response pathway is known to modulate a number of virulence- and stress-associated phenomena in UPEC in vitro (23, 74), this is the first study to show that Cpx components significantly affect the fitness of UPEC within the 48 49 host during the course of a UTI. The diminished fitness of the cpxP null mutant is particularly intriguing considering its role as an auxiliary factor that is not strictly required for activation of the Cpx system (46, 47). Raivio and colleagues have suggested that the primary function of CpxP within the periplasm is to adjust the sensitivity of the CpxA histidine kinase to appropriate levels as environmental conditions vary (75). Accordingly, it was reported that deletion of cpxP leaves CpxA in a more active state, and consequently less responsive to Cpx-inducing cues (46, 48, 75). Therefore, modulation of CpxP levels within the periplasm likely provides UPEC and other bacteria with a means to fine-tune Cpx responses. The modulatory effects of CpxP may become more critical in rapidly changing and hostile environments as encountered within the host. 49 Fig. 2.9. Competitive advantage of wild-type UTI89 over isogenic cpx mutants within the bladder. Adult female CBA/J mice were inoculated with a 1:1 mixture of wild-type UTI89 with each of the individual cpx null mutants, $cpxA, $cpxR, or $cpxP. After 3 d, wild-type and mutant titers present within the bladder were determined. Data are presented as (A) total CFU/g bladder tissue and as (B) competitive indices, with values >0 indicating that the wild-type strain outcompeted the mutant within the host. The horizontal bars indicate median values for each group. P values were determined using Mann-Whitney U tests (n = 12-13 mice). 50 CpxP levels can be adjusted at the transcriptional level via activation of CpxR (46), or posttranslationally within the periplasm by proteolysis mediated by DegP (48, 49). Results presented here indicate a third mechanism involving translational repression of cpxP transcripts in the presence of RNS. Posttranscriptional control of mRNA transcripts in bacteria can be mediated by regulatory sRNA molecules or by RNA-binding proteins like CsrA. The RNA chaperone Hfq often promotes interactions between sRNA molecules and specific transcripts, usually resulting in accelerated decay or repressed translation of the target message (76). I recently reported that Hfq is a key regulator of multiple fitness and virulence phenotypes associated with UPEC, including resistance to high levels of RNS (77). However, Hfq was not required for RNS-mediated abrogation CpxP expression in UPEC as observed in this study (data not shown). Rather, my data implicate CsrA, a global regulatory protein that binds as a dimer to the 5'-UTRs of target transcripts, often occluding the Shine-Delegarno sequence (66, 78-84). CsrA recognizes the consensus sequence RUACARCGAUGU in target transcripts (85), and can act to either promote or repress translation. Key systems that are negatively controlled by CsrA include glycogen synthesis, gluconeogenesis, and biofilm development (84, 86-89). CsrA positively affects glycolysis, acetate metabolism, and motility, with the latter being mediated via translational effects on the master regulator of motility, FlhDC (64, 87, 90). The ability of CsrA to enhance translation of the flhDC mRNA likely contributed to the high abundance of motility-associated genes that I detected by microarray analysis as being highly upregulated in UTI89 grown in the presence of ASN. Stimulation of these motility genes by ASN may represent a defense 50 51 51 TABLE 2.1. Strains and plasmids used in this study Strain or plasmid Description Source Strains UTI89 UPEC cystitis isolate (104, 105) MM530 UTI89 !cpxA::clm This study MM639 UTI89 !cpxP::clm This study MM427 UTI89 !cpxR::clm This study TT23216 Salmonella template strain containing a clmR cassette flanked by universal primer sequences J. Roth, (77) MM173 UTI89/pJLJ5 This study MM495 UTI89/pJLJ10 This study MM1097 UTI89/pRR48 This study MM1095 UTI89/pRRK12 This study MM371 UTI89/pGFP(ASV) This study MM638 UTI89/pKM208 This study MM527 UTI89/pJLJ5/pHJ13 This study MM503 UTI89/pJLJ5/pLD404 This study MM531 UTI89 !cpxA::clm/pJLJ5 This study MM444 UTI89 !cpxR::clm/pJLJ5 This study MM315 UTI89/pMMB66EH This study MM316 UTI89/pMMB66EH/pJLJ5 This study MM511 UTI89/pJLJ5/pMMB66EH This study MM512 UTI89/pJLJ5 /pRelA This study MM641 UTI89 cpxA::clmR/pJLJ5 /pMM66EH This study MM533 UTI89 cpxA::clmR/pJLJ5/pMMBRelA This study MC4100 Laboratory K12 E. coli strain Coli Genetic Stock Center Plasmids pACYC177 Parent of pJLJ1, pJLJ5 and pJLJ10; p15A ori; Kanr Ampr New England Biolabs pGFP(ASV) Expresses GFP(ASV) from Plac promoter; Ampr Clontech pJLJ1 Control vector carrying promoterless gfp(ASV); Kanr This study pJLJ5 Vector for expression of GFP(ASV) from the cpxP promoter region; Kanr This study pJLJ10 Vector for expression of GFP(ASV) from the cpxRA promoter region; Kanr This study 52 52 Strain or plasmid Description Source Plasmids pRR48 lacIq/ptac expression vector; Ampr S. Parkinson, (103) pRRK12 IPTG-inducible CpxP expression construct; Ampr This study pRRK1 Parental plasmid for pRRK2, derived from pRR48 by mutation of the Shine-Dalgarno sequence; Ampr This study pRRK2 Encodes IPTG-inducible CsrB; Ampr This study pLD404 Vector for constitutive expression of NlpE; Ampr (53) pHJ13 Encodes IPTG-inducible PapE; Ampr (45) pKM208 IPTG-inducible Red recombinase expression plasmid; Ampr (107) pJLJ41 Expresses CpxP under its native promoter; Ampr This study pJLJ42 Expresses CpxRA under its native promoter; Ampr This study pGEN-MCS Parent plasmid for pJLJ41 and pJLJ42, contains hok sok post-segregation killing system and two par loci; Ampr -102 pMMB66EH Empty-vector control vector for pRelA; Ampr (113) pMMBRelA IPTG-inducible RelA expression construct; Ampr (56) TABLE 2.1. Continued 53 53 Primera Sequence Construct/ Gene Plasmid construction MP141 - F AACTGGATCCTCATTGTTTAAATACCTCCG pJLJ5 MP142 - R TGATGGTACCTTGCTCCCAAAATCTTTCGT pJLJ5 MP149 - F CGCTCGGATCCCATCATTTGCTCCCAAAATCTT pJLJ10 MP150 - R AACCGGGTACCTGTTTAAATACCTCCGAGGCA pJLJ10 CpxP for (pst1) AATCCTGCAGATTGTTTAAATACCTCCGAGGC pJLJ41 CpxP rev (salI) TAGAGTCGACTACCAGCGCGGCGAGAATAC pJLJ41 CpxRA for (pst1) TGCTCTGCAGTCATTTGCTCCCAAAATCTTTCT pJLJ42 CpxRA rev (salI) GCTAGTCGACAGCGGCAAGATCGAAGATTTTT pJLJ42 P222 - F GTGAGCGGATAACAATTTACTGCAGTGTGAAATGCTGC AGGATCCG pRRK1 P223 - R CGGATCCTGCAGCATTTCACACTGCAGTAAATTGTTATC CGCTCAC pRRK1 P216 - F GGGGTACCCCAACTGCCGCGAAGAATAGCA pRRK2 P224 - R CAATGCATTGGTTCTGCAGTTTTGTCTGTAAGCGCCTTG TAA pRRK2 P322 - F CGGGATCCCAGATTTTGGGAGCAAATGATGCG pRRK12 P323 - R GGGGTACCAAGCAGCAGGCAAATTGAGGATAAA pRRK12 RT-PCR MP22 - F TCATTAAGCCACGCTGCTGA cpxP MP23 - R ACTCAATAGCTTCAACGATGAA cpxP MP24 - F ATGACCAGCCACACTGGAACT 16S rRNA MP25 - R AGTATCAGATGCAGTTCCCAG 16S rRNA MP43 - F AGGGTGAAGGTGATGCAACA gfp MP44 - R CTCAAGAAGGACCATGTGGT gfp MP45 - F AAAGTCATGGATTAGCGACGT cpxR MP46 - R TCAGCACTAAGGCATCAACTT cpxR TABLE 2.2. Primers used in this study 54 strategy for UPEC, enabling these pathogens to better evade RNS generated within the host or other environments. The microarray results suggested CsrA activity may be of significant consequence to UPEC in the face of RNS. To test this possibility, I tested the ability of CsrA to modulate CpxP levels. Although I was able to construct a csrA null mutation for this purpose, this mutant strain proved to be exceptionally difficult to work with, forming large insoluble aggregates that have made subsequent analyses problematic. Consequently, I resorted to alternate approaches. CsrA is antagonized by the sRNA CsrB, the transcription of which is promoted by activation of the BarA-UvrY two-component system, which responds to glucose and, more specifically, the glucose metabolic end products formate and acetate (65, 67, 68). The BarA-UvrY system, in turn, is positively 54 Primera Sequence Construct/ Gene Knockout construction MP47 - F ATGCGGCGTAAACGCCTTATCCTGCCTACAAATGCGGAG TCACCAAACACCCCCCAAAACC cpxA MP48 - R AAACCTTGCGTGGTCGCGGCTATCTGATGGTTTCTGCTT CCACACAACCACACCACACCAC cpxA MP63 - F CTCTCTATCGTTGAATCGCGACAGAAAGATTTTGGGAGC AACACCAAACACCCCCCAAAACC cpxP MP64 - R GAAGACAGGGATGGTGTCTATGGCAAGGAAAACAGGG TTTCACACAACCACACCACACCAC cpxP MP143 - F ATGAATAAAATCCTGTTAGTTGATGATGACCGAGAGCTG ACTTCCCTATTTGTGTAGGCTGGAGCTGCTTCG cpxR MP144 - R TCATGAAGCAGAAACCATCAGATAGCCGCGACCACGCA AGGTTTTAAACCACATATGAATATCCTCCTTAG cpxR TABLE 2.2. Continued a F and R refer to forward and reverse primers. 55 regulated by CsrA, creating an autoregulatory loop (67). In my assays, ASN-mediated attenuation of CpxP translation was countered by the induced expression of CsrB, as well as addition of the BarA activator glucose. These observations link the regulation of the Cpx system to a number of pathways that are integral to bacterial fitness in general, and to UPEC virulence in particular. Specifically, the BarA-UvrY system has been implicated as a virulence determinant for UPEC within the urinary tract (91), and the capacity of CsrA to control biofilm formation and carbon utilization pathways has implicit relevance to the survival of UPEC within the host (92-94). Recently, it was reported that UPEC isolates are often much better equipped to handle RNS, being able to survive and adapt to high levels of ASN (2, 57, 95). Part of this adaptive response involved upregulation of the polyamine cadaverine, which can facilitate UPEC growth in the face of RNS (2, 57). Interestingly, FlhDC acts as a positive regulator of cadA, which encodes a lysine decarboxylase involved in cadaverine biogenesis (96), suggesting another link between CsrA and the fitness and virulence potential of UPEC. The ability of CsrA to repress CpxP expression in the presence of ASN is also likely pertinent to the pathogenesis of UTIs. On one hand, CsrA-mediated effects on cpxP translation may act as part of an adaptive response, altering activation levels of CpxA and perhaps enabling UPEC to better deal with the effects of nitrosative stress on the bacterial envelope. Alternatively, dysregulation of the Cpx system due to RNS may represent a specific detriment with which UPEC must deal. RNS-mediated downregulation of CpxP expression in conjunction with additional stresses and antimicrobial factors encountered 55 56 within the host may act to restrict UPEC growth and dissemination. This scenario is supported by my observations that a cpxP null mutant is significantly disadvantaged within the host urinary tract, at least when in competition with the wild-type pathogen. In the end, it is likely that RNS-mediated attenuation of CpxP expression will have variable effects on UPEC fitness depending on the cumulative input of multiple signaling systems and environmental cues. Whether or not CsrA abrogates CpxP expression by directly interacting with cpxP transcripts or by other less direct means remains to be tested. Using a primer walking technique, I determined that the 5'-UTR of cpxP extends at least 45 bp upstream of the translation start site (see Fig. 2.1.a and data not shown). Within this region there is potentially one degenerate CsrA binding site overlapping the Shine-Delgarno sequence. It is feasible that modification of CsrA in the presence of RNS alters its binding specificity, enabling CsrA to recognize an alternate repertoire of mRNA transcripts. In support of this possibility, I have found by both Western blot analysis and mass spectroscopy that a highly conserved tyrosine residue (Y47) within CsrA becomes nitrated when purified CsrA is exposed to ASN (unpublished observations). Y47 is located within a loop region surrounded by residues known to mediate CsrA-RNA interactions (81, 97). I am currently working to understand the functional significance of Y47 nitration. However, it is noteworthy that there is a growing body of evidence that tyrosine nitration in eukaryotic systems can modify protein function and alter signaling cascades (98-101). Since UPEC can produce their own RNS via nitrite reductases under conditions of low oxygen tension, as often encountered within host niches like the bladder (7), it may be that these bacteria 56 57 can also employ RNS as signaling molecules, with CsrA and, indirectly, cpxP being functionally relevant targets. Experimental procedures Plasmid constructs Plasmids and primers used in this study are listed in Tables 2.1 and 2.2, respectively. To create the cpxP-gfp promoter fusion, the 146 bp region between the divergent start sites of cpxR and cpxP from the E. coli strain MC4100 was amplified by PCR using primers MP141 and MP142 (Table 2.2). The PCR product was digested with BamH1 and Asp718 and ligated into the multiple cloning site of pGFP(ASV) (Clonetech). The resulting plasmid was digested with BamH1 and BsiW1 to generate a ~900 bp fragment containing the cpxP promoter upstream of the gfp(ASV) gene. This fragment was ligated into the BamH1 and Ban1 sites of the low copy number plasmid pACYC177 (New England Biolabs) to create pJLJ5. To construct pJLJ10, the 146 bp cpxP promoter region in pJLJ5 was replaced with the same sequence in the opposite orientation. As a control, plasmid pJLJ1 was constructed by ligating the promoterless gfp (ASV) gene from pGFP(ASV) into the BamH1 and Ban1 sites of pACYC177. In control experiments, E. coli strains carrying pJLJ1 did not express any detectable GFP under any conditions tested. Plasmid pJLJ41 was made by first amplifying cpxP off the UTI89 chromosome along with 250 bp of upstream and 100 bp of downstream sequences using primers CpxPfor(pst1) and CpxPrev(salI). The resulting PCR product was digested and ligated into PstI and SalI sites within the high-retention, low copy number plasmid 57 58 pGEN-MCS (102). pJLJ42, carrying cpxRA plus 250 bp of upstream and 100 bp of downstream sequences, was similarly constructed using primers CpxRAfor(pst1) and CpxRArev(salI). Plasmids pHJ13 (encoding IPTG-inducible PapE), pLD404 (for constitutive expression of NlpE), pMMBrelA (for IPTG-inducible expression of RelA), and the expression construct pRR48 have been described previously (45, 53, 56, 103). To create pRRK12, the cpxP sequence from UTI89 was amplified using primers P322 and P323, which introduced flanking 5'-BamH1 and 3'-Kpn1 restriction sites used to ligate cpxP downstream of the tac promoter in pRR48. Plasmid pRRK1 was constructed using primers P222 and P223 to mutate the Shine-Dalgarno sequence within pRR48 to a PstI site (Site-Directed Mutagenesis II Kit, Stratagene). The csrB coding sequence from UTI89 was amplified using primers P216 and P224 and ligated into PstI and BamHI sites within pRRK1 to create pRRK2. Bacterial strains and growth conditions Strains used in this study are listed in Table 2.1. Plasmids were introduced into UTI89, a human cystitis isolate (104, 105), by electroporation. Targeted gene knockouts were created in UTI89 using linear transformation and lambda Red-dependent recombination essentially as described (106, 107). Primers were designed to amplify the chloramphenicol (clm) resistance gene from strain TT23216 with appropriate flanking sequences having homology to regions within and around cpxR, cpxA, or cpxP. All gene knockouts were verified by PCR of the affected genomic regions. 58 59 59 TABLE 2.3. Top one hundred upregulated microarray genes Gene UTI89 Locus Tag Function Ratioa Probe setb ygbD C3073 Flavorubredoxin oxidoreductase 2,554.8 1766754_s_at flgB C1198 Flagellar biosynthesis 1,612.4 1762105_s_at norV C3072 Flavorubredoxin 1,253.1 1768449_s_at 723.4 1767683_at 53.9 1768764_s_at flgE C1201 Flagellar biosynthesis 1,246.4 1760787_s_at flgC C119 Flagellar biosynthesis 1,227.1 1768120_s_at flgD C1200 Flagellar biosynthesis 1,158.2 1760643_s_at flgG C1203 Flagellar biosynthesis 1,155.5 1767435_s_at fliM C2145 Flagellar biosynthesis 617.0 1761189_s_at fliL C2144 Flagellar biosynthesis 551.8 1768910_s_at ycdO C1081 Hypothetical protein 548.7 1764800_s_at 206.6 1763371_at fliN C2146 Flagellar biosynthesis 406.9 1765241_s_at flgA C1197 Flagellar biosynthesis 358.0 1763116_s_at fliA C2123 Flagellar biosynthesis 317.6 1763490_s_at flgH C1204 Flagellar biosynthesis 286.3 1768045_s_at fliK C2143 Flagellar biosynthesis 205.5 1759897_s_at flgJ C1206 Flagellar biosynthesis 202.0 1763207_s_at flgF C1202 Flagellar biosynthesis 182.8 1761549_s_at fliF C2138 Flagellar biosynthesis 175.3 1763750_s_at fliO C2147 Flagellar biosynthesis 164.8 1761160_s_at flgK C1207 Flagellar biosynthesis 153.0 1761245_s_at fliI C2141 Flagellar biosynthesis 152.1 1766980_s_at yoga C1994 Hypothetical protein 146.7 1762744_s_at ycdB C1082 Hypothetical protein 137.8 1768768_at fliJ C2142 Flagellar biosynthesis 136.9 1760976_s_at flgI C1205 Flagellar biosynthesis 112.7 1765040_s_at cysI C3127 Sulfite reduction 112.5 1768272_s_at 76.8 1767086_at fliC C2124 Flagellar biosynthesis 99.1 1765832_s_at c2201 C1993 Hypothetical protein 92.8 1762869_s_at fliG C2139 Flagellar biosynthesis 81.8 1766530_s_at Flip C2148 Flagellar biosynthesis 79.7 1767430_s_at fliD C2125 Flagellar biosynthesis 79.5 1764241_s_at tar C2089 Chemotaxis 74.7 1768914_s_at year C1995 Putative tellurite resistance protein 74.1 1768944_s_at 60 60 TABLE 2.3. Continued Gene UTI89 Locus Tag Function Ratioa Probe setb Aer C3510 Chemotaxis 69.9 1766701_s_at flhA C2082 Flagellar biosynthesis 69.7 1767873_s_at Tap C2088 Chemotaxis 67.4 1766991_s_at c3225 C3031 Hypothetical protein 62.4 1768634_s_at flhB C2083 Flagellar biosynthesis 59.4 1766226_s_at cysJ C3128 Sulfite reduction 55.9 1765526_s_at fliZ C2122 Flagellar biosynthesis 51.2 1760453_s_at cheA C2091 Chemotaxis 47.9 1766750_s_at aceA C4574 Isocitrate lyase 46.6 1763981_s_at ybdB C0599 Hypothetical protein 43.8 1761866_s_at cysH C3126 Sulfite reduction 43.3 1760382_at 25.5 1759826_s_at fdnI C1692 Formate dehydrogenase 42.1 1760891_s_at fliS C2126 Flagellar biosynthesis 40.9 1764033_s_at flgL C1208 Flagellar biosynthesis 40.8 1768710_s_at cysP C2758 Sulfite reduction 39.5 1764785_at 11.0 1762292_s_at Nark C1420 nitrite extrusion protein 37.7 1764323_s_at fliH C2140 Flagellar biosynthesis 36.8 1760053_s_at motA C2093 Chemotaxis 35.6 1763982_s_at fdnH C1691 Formate dehydrogenase 34.3 1763995_s_at cheR C2088 Chemotaxis 33.5 1760164_s_at cheW C2090 Chemotaxis 30.6 1759302_s_at cheY C2086 Chemotaxis 29.4 1764851_s_at c2419 C2178 Hypothetical protein 28.5 1763274_at cysA C2755 Sulfate transport 28.4 1762301_at cheB C2087 Chemotaxis 26.6 1765173_s_at fliQ C2149 Flagellar biosynthesis 26.6 1766705_s_at iscR/yfhP C2853 Fe-S cluster-containing transcription factor 25.9 1764175_s_at cysD C3123 Sulfate adenylyltransferase 22.5 1765655_s_at cheZ C2085 Chemotaxis 22.1 1765504_s_at yghK C3391 Glycolate permease 21.8 1759891_s_at Flit C2127 Flagellar biosynthesis 19.7 1762151_s_at yncE C1671 Hypothetical protein 19.6 1759697_s_at astD C1941 Succinylglutamic semialdehyde dehydrogenase 19.0 1761460_s_at entB C0597 Isochorismatase 18.4 1765518_s_at 61 61 TABLE 2.3. Continued Gene UTI89 Locus Tag Function Ratioa Probe setb yhjC C4053 Transcriptional regulator 18.0 1767782_s_at betB C0341 Betaine aldehyde dehydrogenase 17.6 1766956_at fdnG C1689 Formate dehydrogenase 16.7 1761354_s_at marB C1751 Multiple antibiotic resistance protein 16.7 1760768_s_at chuS C4027 Heme/hemoglobin transport protein 15.7 1763313_s_at cysN C3122 ATP-sulfurylase 14.9 1763768_s_at yhjH C4057 Chemotaxis 14.8 1765046_s_at beta C0340 Choline dehydrogenase 13.2 1766741_at gltB C3649 Glutamate synthase 13.2 1768316_at sitA C1339 Fe Transport 13.1 1761573_at chuX C4035 Hypothetical protein 12.7 1769108_s_at flhE C2081 Flagellar biosynthesis 11.6 1767174_at aceB C4573 Malate synthase A 11.3 1761179_at flgM C1196 Flagellar biosynthesis 11.1 1768555_s_at cysU C2757 Sulfate transport system permease 10.9 1759413_at cysC C3121 Adenylylsulfate kinase 10.8 1761476_s_at ymdA C1167 Hypothetical protein 10.6 1764274_s_at iscS/yfhO C2582 Cysteine desulfurase 10.5 1759704_s_at fhuF C5073 Ferric iron reductase protein fhuF 10.5 1761858_at dnaJ C0017 Chaperone 10.5 1769019_s_at yjcZ C4704 Hypothetical protein 10.4 1763969_s_at motB C2092 Chemotaxis 10.4 1767171_s_at ycjX C1592 Hypothetical protein 10.3 1768270_s_at yiaK C4117 Oxidoreductase 10.1 1759230_s_at nrdH C3033 Glutaredoxin-like protein 9.9 1764080_s_at cstA C0600 Carbon starvation protein A 9.6 1766639_s_at acs C4659 Acetyl-CoA synthetase 9.2 1761238_s_at cyoC C0454 Cytochrome subunit 9.0 1767399_s_at tsr C5058 Chemotaxis 9.0 1762388_s_at yeaJ C1982 Hypothetical 9.0 1767540_s_at cyoE C0451 Cytochrome subunit 8.8 1759601_s_at c2436 C2188 Putative pesticin receptor 8.8 1767260_at ompT C0566 DLP12 Prophage 8.8 1765378_s_at a Ratio of the expression in cultures containing ASN to the expression in cultures not containing ASN. b When different probe sets for a single gene yielded different results, all probe sets are listed. 62 Except where noted, UTI89 and its derivatives were cultured from -80°C frozen stocks in Luria-Bertani broth buffered at pH 5.0 with 100 mM morpholineethanesulfonic acid (MES-LB). Kanamycin (50 %g·ml-1), ampicillin (50 %g·ml-1), and/or chloramphenicol (20 %g·ml-1) were included when appropriate to maintain plasmid selection. After an overnight incubation shaking at 37°C, bacteria were subcultured 1:100 into fresh MES-LB. Sodium nitrite and isopropyl &-D-1-thiogalactopyranoside (IPTG) were each added to a final concentration of 1 mM as indicated. Bacteria used for RT-PCR, microarray, and Western blot analyses were grown shaking at 225 rpm at 37°C in 5 ml cultures within 120x17 mm screw-capped polystyrene conical tubes (Sarstedt). Growth was monitored by determining the optical density at 600 nm using a Spectronic 20D+ (Thermo). Other growth curves were obtained using shaking 200-ml cultures in 100-well honeycomb plates and a Bioscreen C instrument (Growth Curves USA). Antibiotics, sodium nitrite, and MES were purchased from Sigma-Aldrich, while IPTG was from Teknova. To test the sensitivities of the cpx mutants and complemented strains to amikacin, serial dilutions of overnight bacterial cultures (grown in LB broth in the presence of ampicillin to maintain plasmid selection) were plated as 5 ml drops on LB agar containing 3 %g·ml-1 amikacin. After a 24 h-incubation at 37°C, plates were photographed using a GelDoc XR instrument (BioRad). 62 63 Western blot analysis Bacterial samples were pelleted at 12000·g for 2-3 min at 4ºC, lysed in Bacterial Protein Extraction Reagent (Pierce), sonicated for 1 min, heated at 100ºC for 5 min, and stored overnight at -20ºC. Equivalent amounts of protein (20 %g as determined by BCA assay, Pierce) from each sample were resolved in 10% acrylamide using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred to PVDF membranes (Millipore) for Western blot analysis. All antibody incubations were performed in 1% BSA, 1% powdered milk, 0.1% Tween-20 in Tris-Buffered Saline (pH 7.4). Blots were incubated with mouse anti-GFP (1:10,000; Santa Cruz) for 45 min at room temperature, followed by a 1-h incubation with secondary anti-mouse HRP-conjugated IgG antibody (1:10,000; Amersham Biosciences). Blots were then washed, developed using the SuperSignal West Pico or SuperSignal West Femto Chemiluminescent kit (Pierce), and exposed to CL-XPosure Film (Pierce). To ensure that equivalent amounts of protein from each sample were loaded, duplicate gels were stained using GelCode Blue (Pierce) and/or blots were re-probed using goat anti-E. coli antisera (1:1,000; BioDesign). Microarray sample preparation Four separate colonies of UTI89 grown on LB agar plates from a freezer stock were used to start overnight shaking cultures in LB-MES broth. These were then diluted 1:100 into 5 mL LB-MES and grown shaking ± ASN at 37ºC in duplicate 120x17 mm screw-capped conical tubes until the OD600 was 0.8, at which point the bacteria were quickly pelleted and frozen at -80°C for at least 12 h. RNA was extracted using hot 63 64 phenol-chloroform and purified by CsCl gradient centrifugation (108). Synthesis of cDNA and subsequent fragmentation and labeling were performed according to Affymetrix protocols. Microarray gene expression analysis Fragmented and labeled cDNA (15 %g) was mixed with 270 %l hybridization buffer and hybridized to Affymetrix GeneChip E. coli 2.0 genome arrays at 45ºC for 20 h. The GeneChips were then washed, stained, and scanned using Affymetrix protocols and an Affymetrix GeneChip 3000 device with high-resolution scanning enabled. Raw images were converted to CEL files with Affymetrix GCOS software and image processing using the GCRMA method for probe-level data (109) was carried out using the Bioconductor Package in the R statistical environment (110). CEL files were analyzed as a group, background corrected using GCRMA (111), and normalized using quantile normalization. Median polish was used to obtain probe set summary measures. Organization of transcripts was based on available gene data from Affymetrix NetAffx (http://www.affymetrix.com/analysis/index.affx), the annotated UTI89 genome (105), and EcoCyc (http://ecocyc.org/, (112)). Microarray data accession number Complete microarray data have been deposited in the Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/). 64 65 RT-PCR analysis Total RNA was collected from bacterial cultures (grown ± ASN to an of 0.8) as described above. M-MLV reverse transcriptase (Ambion, Austin, TX) was used to reverse transcribe 1 %g of total RNA using random hexamer primers (Invitrogen) followed by PCR with gene-specific primers listed in Table 2.2 under the RT-PCR heading. Reactions set up without reverse transcriptase were used as controls. Amplicons ranging in size from 340 to 570 bp were resolved using 2% agarose gels, stained with ethidium bromide, and imaged using a GelDoc system (Bio-Rad Laboratories). Integrated band intensities were quantified using ImageJ software (NIH). Mouse infections Seven to 8 week old female CBA/J mice (Jackson Labs) were used in accordance with IACUC-approved protocols. Wild type UTI89 and the cpx knockout strains were grown from frozen stocks in 20 ml static LB broth at 37ºC for 24 h. Bacteria were pelleted by centrifugation for 8 min at 8,000·g and then resuspended in phosphate-buffered saline. Mice were briefly anesthetized using isofluorane inhalation and inoculated via transurethral catheterization with 50 ml of a bacterial suspension containing ~1 X 107 CFU total bacteria. For competition assays, wild type UTI89 and each cpx mutant strain were mixed 1:1 prior to inoculation. After 3 d, bladders were collected, weighed, and homogenized in PBS containing 0.02% Triton X-100. Homogenates were serially diluted and plated on LB agar plates ± chloramphenicol to determine the number of bacteria present per gram of tissue and to distinguish wild type UTI89 from the cpx knockout mutants. Competitive indices were calculated as Log10 65 66 [(wild-type CFU recovered/mutant CFU recovered)/(wild-type CFU inoculated/mutant CFU inoculated)], such that values of greater than 0 indicate that the wild type strain outcompeted the mutant. Mouse experiments were repeated twice with similar results (total combined data is presented in Fig. 2.9). Statistics Results from the mouse experiments were analyzed by Mann-Whitney U tests using Prism 5.01 software (Graphpad Software). P values of less than 0.05 were considered significant. Acknowledgements We thank R. B. Weiss and D. M. Dunn (U of Utah) for their expert help in acquiring, processing, and analyzing the microarray data. I are also grateful to Drs. S.J. Hultgren (Washington U School of Medicine), J.S. Parkinson (U of Utah), T.J. Silhavy (Princeton University), and M.S. Swanson (U of Michigan Medical School) for constructs used in this study. Finally, I thank C. Veltri for helping to initiate this project. This work was funded by Public Health Service grant DK068585 from the National Institute of Diabetes and Digestive and Kidney Diseases. R.R.K. was supported in part by Microbial Pathogenesis Training Grant T32 DK070507. 66 67 References 1. Foxman, B. 2003. Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Dis Mon 49:53-70. 2. Bower, J. M., and M. A. Mulvey. 2006. Polyamine-mediated resistance of uropathogenic Escherichia coli to nitrosative stress. J Bacteriol 188:928-933. 3. Ronald, A. 2002. The etiology of urinary tract infection: traditional and emerging pathogens. Am J Med 113 Suppl 1A:14S-19S-14S-19S. 4. Carlsson, S., N. P. Wiklund, L. Engstrand, E. Weitzberg, and J. O. Lundberg. 2001. Effects of pH, nitrite, and ascorbic acid on nonenzymatic nitric oxide generation and bacterial growth in urine. Nitric Oxide 5:580-586. 5. Mysorekar, I. U., M. A. Mulvey, S. J. Hultgren, and J. I. Gordon. 2002. Molecular Regulation of Urothelial Renewal and Host Defenses during Infection with Uropathogenic Escherichia coli. J Biol Chem 277:7412-7419. 6. Kang, W. S., F. J. Tamarkin, M. A. Wheeler, and R. M. Weiss. 2004. Rapid up-regulation of endothelial nitric-oxide synthase in a mouse model of Escherichia coli lipopolysaccharide-induced bladder inflammation. J Pharmacol Exp Ther 310:452-458. 7. Corker, H., and R. K. Poole. 2003. Nitric oxide formation by Escherichia coli. Dependence on nitrite reductase, the NO-sensing regulator Fnr, and flavohemoglobin Hmp. J Biol Chem 278:31584-31592. 8. Woolford, G., R. J. Casselden, and C. L. Walters. 1972. Gaseous products of the interaction of sodium nitrite with procine skeletal muscle. Biochem J 130:82P-83P-82P-83P. 9. Benjamin, N., and R. Dykhuizen. 1999. Nitric oxide and epitheilial host defense. F. C. Fang, ed. Klewer Academic/Plenum Publishers, New York. 215-230. 10. Fang, F. C. 2004. Antimicrobial reactive oxygen and nitrogen species: concepts and controversies. Nat Rev Microbiol 2:820-832. 11. Marshall, H. E., K. Merchant, and J. S. Stamler. 2000. Nitrosation and oxidation in the regulation of gene expression. Faseb J 14:1889-1900. 12. Brune, B., and O. Cantoni. 2000. Nitric oxide-mediated redox reactions in pathology, biochemistry and medicine. Cell Death Differ 7:1018-1020. 67 68 13. Hooper, N. M. 1999. Detergent-insoluble glycosphingolipid/cholesterol-rich membrane domains, lipid rafts and caveolae. Mol Membr Biol 16:145-156. 14. McInnes, I. B., and F. Y. Liew. 1999. Immunomodulatory Actions of Nitric Oxide. F. Fc, ed. Kluwer Academics/Plenum Publishers, New York. 199-209. 15. Pineda-Molina, E., and S. Lamas. 2001. Nitric oxide as a regulator of gene expression: studies with the transcription factor proteins cJun and p50. Biofactors 15:113-115. 16. Perez-Sala, D., and A. Rebollo. 1999. Novel aspects of Ras proteins biology: regulation and implications. Cell Death Differ 6:722-728. 17. Spek, E. J., T. L. Wright, M. S. Stitt, N. R. Taghizadeh, S. R. Tannenbaum, M. G. Marinus, and B. P. Engelward. 2001. Recombinational repair is critical for survival of Escherichia coli exposed to nitric oxide. J Bacteriol 183:131-138. 18. Lobysheva, I. I., M. V. Stupakova, V. D. Mikoyan, S. V. Vasilieva, and A. F. Vanin. 1999. Induction of the SOS DNA repair response in Escherichia coli by nitric oxide donating agents: dinitrosyl iron complexes with thiol-containing ligands and S-nitrosothiols. FEBS Lett 454:177-180. 19. Kim, S. O., K. Merchant, R. Nudelman, W. F. Beyer, T. Keng, J. DeAngelo, A. Hausladen, and J. S. Stamler. 2002. OxyR: a molecular code for redox-related signaling. Cell 109:383-396. 20. Hausladen, A., C. T. Privalle, T. Keng, J. DeAngelo, and J. S. Stamler. 1996. Nitrosative stress: activation of the transcription factor OxyR. Cell 86:719-729. 21. Ding, H., and B. Demple. 2000. Direct nitric oxide signal transduction via nitrosylation of iron-sulfur centers in the SoxR transcription activator. Proc Natl Acad Sci U S A 97:5146-5150. 22. Deupree, S. M., and M. H. Schoenfisch. 2009. Morphological analysis of the antimicrobial action of nitric oxide on gram-negative pathogens using atomic force microscopy. Acta Biomater 5:1405-1415. 23. Raivio, T. L. 2005. Envelope stress responses and Gram-negative bacterial pathogenesis. Mol Microbiol 56:1119-1128. 24. MacRitchie, D. M., D. R. Buelow, N. L. Price, and T. L. Raivio. 2008. Two-component signaling and gram negative envelope stress response systems. Adv Exp Med Biol 631:80-110. 68 69 25. Majdalani, N., and S. Gottesman. 2005. The Rcs phosphorelay: a complex signal transduction system. Annu Rev Microbiol 59:379-405. 26. Raivio, T. L., and T. J. Silhavy. 2001. Periplasmic stress and ECF sigma factors. Annu Rev Microbiol 55:591-624. 27. Otto, K., and T. J. Silhavy. 2002. Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc Natl Acad Sci U S A 99:2287-2292. 28. Prigent-Combaret, C., E. Brombacher, O. Vidal, A. Ambert, P. Lejeune, P. Landini, and C. Dorel. 2001. Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene. J Bacteriol 183:7213-7223. 29. Hung, D. L., T. L. Raivio, C. H. Jones, T. J. Silhavy, and S. J. Hultgren. 2001. Cpx signaling pathway monitors biogenesis and affects assembly and expression of P pili. Embo J 20:1508-1518. 30. Hernday, A. D., B. A. Braaten, G. Broitman-Maduro, P. Engelberts, and D. A. Low. 2004. Regulation of the pap epigenetic switch by CpxAR: phosphorylated CpxR inhibits transition to the phase ON state by competition with Lrp. Mol Cell 16:537-547. 31. De Wulf, P., O. Kwon, and E. C. Lin. 1999. The CpxRA signal transduction system of Escherichia coli: growth-related autoactivation and control of unanticipated target operons. J Bacteriol 181:6772-6778. 32. Gal-Mor, O., and G. Segal. 2003. Identification of CpxR as a Positive Regulator of icm and dot Virulence Genes of Legionella pneumophila. J Bacteriol 185:4908-4919. 33. Nevesinjac, A. Z., and T. L. Raivio. 2005. The Cpx envelope stress response affects expression of the type IV bundle-forming pili of enteropathogenic Escherichia coli. J Bacteriol 187:672-686. 34. Nakayama, S., and H. Watanabe. 1995. Involvement of cpxA, a sensor of a two-component regulatory system, in the pH-dependent regulation of expression of Shigella sonnei virF gene. J Bacteriol 177:5062-5069. 35. Nakayama, S., and H. Watanabe. 1998. Identification of cpxR as a positive regulator essential for expression of the Shigella sonnei virF gene. J Bacteriol 180:3522-3528. 69 70 36. Mitobe, M., T. Yoshida, H. Sugiura, S. Shirota, K. Tsuchiya, and H. Nihei. 2005. Oxidative stress decreases klotho expression in a mouse kidney cell line. Nephron Exp Nephrol 101:e67-74. 37. Mulvey, M. A. 2002. Adhesion and entry of uropathogenic Escherichia coli. Cell Microbiol 4:257-271. 38. De Wulf, P., A. M. McGuire, X. Liu, and E. C. Lin. 2002. Genome-wide profiling of promoter recognition by the two-component response regulator CpxR-P in Escherichia coli. J Biol Chem 277:26652-26661. 39. Leclerc, G. J., C. Tartera, and E. S. Metcalf. 1998. Environmental regulation of Salmonella typhi invasion-defective mutants. Infect Immun 66:682-691. 40. Humphreys, S., G. Rowley, A. Stevenson, M. F. Anjum, M. J. Woodward, S. Gilbert, J. Kormanec, and M. Roberts. 2004. Role of the two-component r