Side-stream treatment of anaerobic digester filtrate by anaerobic ammonia oxidation

Anaerobic Ammonia Oxidation (Anammox) has become an important topic in environmental microbiology and engineering in the last 15 years. The application of Anammox in wastewater treatment provides many beneficial advantages over traditional nitrogen removal processes, particularly in treating ammonium-rich waste streams. In this study, the Anammox process was applied to a fed-batch reactor to treat raw digester filtrate from a local treatment plant. During initial treatment, the filtrate was diluted and an external nitrite source was supplemented. After reaching stable removal, a partial-nitritation (PN) reactor was started-up and fed with the same raw filtrate (undiluted). The effluent from the PN reactor was then fed directly to the Anammox (in place of diluted filtrate). A very long solids retention time (SRT) of 200 days was maintained throughout the study via manual wasting and decanting in order to produce very little sludge and still maintain efficient nitrogen removal. Sequence analysis and fluorescence in-situ hybridization (FISH) were performed on the biomass communities from both reactors. Automated ribosomal intergenic spacer analysis (ARISA) was also conducted on the Anammox biomass throughout the study period. The reactor operated at a moderate loading rate (average 0.33±0.03 with a max of 0.4 g N (L day)-1) comparable with many other fed-batch reactors in literature. It also achieved significant N removal (average of 82±4%) and specific removal rates (average 0.28±0.05 with max of 0.35 g N (g VSS day)-1) likewise comparable with similar studies despite maintaining a very long SRT. Sequence analysis and FISH showed that K. stuttgartiensis dominated the enriched Anammox community (approximately 65% of the biomass) along with several unidentified, but seemingly enriched, potential Anammox strains. ARISA analysis of the Anammox community showed no noticeable shift in the community profile despite the change in feed composition during the study period. It has been found in other studies that the species K. stuttgartiensis is capable of dissimilatory nitrate reduction to ammonium (DNRA), which would give it a selective advantage in conditions created by maintaining a long SRT. Ammonia oxidizing bacteria (AOBs) of the N. europaea lineage dominated the community in the PN reactor, agreeing with literature showing that lineage to dominate in oxygen-limited, ammonium-rich conditions.

SIDE-STREAM TREATMENT OF ANAEROBIC DIGESTER FILTRATE BY ANAEROBIC AMMONIA OXIDATION by Bryan Lars Mansell A thesis submitted to the faculty of The University of Utah in partial fulfillment of the requirements for the degree of Master of Science Department of Civil and Environmental Engineering The University of Utah May 2011 Copyright © Bryan Lars Mansell 2011 All Rights Reserved The Universi ty of Utah Graduate School STATEMENT OF THESIS APPROVAL The thesis of Bryan Lars Mansell has been approved by the following supervisory committee members: Ramesh K. Goel , Chair 3/18/2011 Date Approved Otakuye Conroy-­Ben , Member 3/18/2011 Date Approved Edward M. Trujillo , Member 3/18/2011 Date Approved and by Chris P. Pantelides , Chair of the Department of Civil and Environmental Engineering and by Charles A. Wight, Dean of The Graduate School. ABSTRACT Anaerobic Ammonia Oxidation (Anammox) has become an important topic in environmental microbiology and engineering in the last 15 years. The application of Anammox in wastewater treatment provides many beneficial advantages over traditional nitrogen removal processes, particularly in treating ammonium-rich waste streams. In this study, the Anammox process was applied to a fed-batch reactor to treat raw digester filtrate from a local treatment plant. During initial treatment, the filtrate was diluted and an external nitrite source was supplemented. After reaching stable removal, a partial-nitritation (PN) reactor was started-up and fed with the same raw filtrate (undiluted). The effluent from the PN reactor was then fed directly to the Anammox (in place of diluted filtrate). A very long solids retention time (SRT) of 200 days was maintained throughout the study via manual wasting and decanting in order to produce very little sludge and still maintain efficient nitrogen removal. Sequence analysis and fluorescence in-situ hybridization (FISH) were performed on the biomass communities from both reactors. Automated ribosomal intergenic spacer analysis (ARISA) was also conducted on the Anammox biomass throughout the study period. The reactor operated at a moderate loading rate (average 0.33±0.03 with a max of 0.4 g N (L day)-1) comparable with many other fed-batch reactors in literature. It also achieved significant N removal (average of 82±4%) and specific removal rates (average 0.28±0.05 with max of 0.35 g N (g VSS day)-1) likewise comparable with similar studies iv despite maintaining a very long SRT. Sequence analysis and FISH showed that K. stuttgartiensis dominated the enriched Anammox community (approximately 65% of the biomass) along with several unidentified, but seemingly enriched, potential Anammox strains. ARISA analysis of the Anammox community showed no noticeable shift in the community profile despite the change in feed composition during the study period. It has been found in other studies that the species K. stuttgartiensis is capable of dissimilatory nitrate reduction to ammonium (DNRA), which would give it a selective advantage in conditions created by maintaining a long SRT. Ammonia oxidizing bacteria (AOBs) of the N. europaea lineage dominated the community in the PN reactor, agreeing with literature showing that lineage to dominate in oxygen-limited, ammonium-rich conditions. TABLE OF CONTENTS ABSTRACT ……………………………………………………………………………. iii LIST OF FIGURES …………………………………………………………………….. vi LIST OF TABLES ……………………………………………………………………... vii ACKNOWLEDGMENTS …………………………………………………………….. viii Chapters I INTRODUCTION ……………………………………………………………..... 1 Current Filtrate Management Challenges …...…………………………………... 1 Introduction to Anammox …………………………………………….………..... 2 Application of Anammox in Treating Ammonium-rich Wastewater ….……..... 10 Research Hypothesis and Objectives …………………………………….…...... 21 II MATERIALS AND METHODS ………………………………………………. 23 Anammox Reactor Operation ….………………………………………………. 23 Partial-nitritation Reactor Operation …..………………………….……………. 25 Sample Collection and Analytical Methods …………………………………..... 27 Phylogenetic Analysis …………………………………………………...…..…. 28 III RESULTS AND DISCUSSION ……………………………………………….. 34 Anammox Reactor Performance …………...…………………………………... 34 Partial-nitritation Reactor Performance …………...……..…………………….. 37 Microbial Ecology of Anammox Bacteria …………….………..……………… 38 Microbial Ecology of Ammonia-oxidizing Bacteria …...………..…………….. 44 ARISA Analysis of Anammox Population ..……………………………….…... 47 IV CONCLUSION ……………………………………………………………….... 50 Conclusions from Study .……..………………………………………………… 50 REFERENCES …………………………………………………………………………. 52 LIST OF FIGURES Figure Page 1. Nitrogen cycle involved in tradition N removal and Anammox ...……..………... 6 2. Simple schematic of SHARON-Anammox process ………………………...…. 13 3. Simple schematic of CANON process ....………………………………………. 15 4. Schematic of Anammox reactor ……………………………………...………… 24 5. Schematic of partial-nitritation reactor ..………………………………………... 26 6. Graph of Anammox reactor performance ……………………………………… 34 7. Phylogenetic tree of Anammox community …………………………………… 39 8. Micrographs obtained from FISH analysis of biomass from Anammox reactor using AMX820 probe ……………………………….………………………….. 43 9. Phylogenetic tree of AOB community from partial-nitritation reactor ………… 45 10. Micrographs obtained from FISH analysis of biomass from the partial-nitritation reactor using Nm1 probe ……………………………………………………...... 46 11. ARISA profile of Anammox community over study period ………………….... 48 LIST OF TABLES Table Page 1. Growth characteristics of nitrifiers and Anammox ………………….…..……... 11 2. SRT values reported in studies involving Anammox reactors …………………. 20 3. 16S rDNA primer sets used to target specific Anammox genera …………….... 29 4. Loading and specific removal rate comparison with other Anammox studies that used fed-batch reactors ………………………..…………………………... 36 5. Comparison of dominant strains in various Anammox studies that used fed-batch reactors ………………………………………………………… 41 ACKNOWLEDGMENTS I wish to acknowledge the many people who helped me with my research leading to this thesis including: • First and foremost, my sweet wife, Jessica, who supported me through a year of getting home late and spending weekends at the lab. • My professor, Dr. Goel, who gave me the opportunity to work on this research and provided the materials and funding needed. • My lab mate, Shireen M. Kotay, for tutoring me in principles and methods of phylogenetic analysis, and giving considerable time in helping me with the phylogenetic portion of this study. • My lab mate, Mitch Hogsett, for getting me started in Anammox research and countless hours of help with building and maintaining the reactors. CHAPTER I INTRODUCTION Current Filtrate Management Challenges The use of anaerobic sludge digestion for the management of biosolids is a popular practice among municipal wastewater treatment plants around the world. The attractiveness is due to a reduction of solid waste, up to 50% (Metcalf and Eddy, 2003), and the energy-savings associated with harvesting and combusting biogas to cogenerate heat and power (CHP), which can be utilized on-site to heat and provide electricity to the facility and other treatment unit processes. Anaerobic digestion can also be used to reduce pathogens, yielding land-applicable biosolids (Iranpour et al., 2006), which can be sold as fertilizer to further subsidize operational costs. Yet, despite these benefits, the liquid effluent from anaerobic digesters is very rich in ammonium nitrogen. Anaerobic digesters typically produce filtrate with an ammonium concentration of about 1000 mg (L)-1 NH4-N (Dapena-Mora et al., 2004b). Often, the ammonium-rich filtrate is recycled back to the head of the plant for treatment. Yet, the recycled filtrate can increase the ammonium loading to the treatment train by as much as 30%, despite the very small contribution of recycled flow (about 1%) (Lackner et al., 2008). Ammonium is a common pollutant with a significant oxygen demand (up to 4.57 g O2 (g NH4 +-N)-1) and toxic to aquatic life. It is often regulated in wastewater discharge and is traditionally treated by means of nitrification in which ammonium is oxidized to 2 nitrite and nitrate, which process requires the addition of oxygen. The nitrate produced from nitrification is also commonly regulated, particularly because it contributes to eutrophication. Likewise, when receiving waters join potential drinking water sources, nitrates and nitrites may be restricted to prevent methemoglobinemia in infants. Nitrate is traditionally removed via denitrification, which reduces nitrate to dinitrogen gas and typically requires readily biodegradable organic substrate (rbCOD). The recycled nitrogen load from filtrate will increase the aeration requirement to achieve conventional nitrification and the addition of a supplementary rbCOD to carry out denitrification, if effluent standards require the removal of nitrogen. The increased oxygen requirements and additional organics contribute significantly to facility energy consumption and operational costs. Also, in climates with cold seasons, when the specific removal rates slow down, the additional ammonium load can potentially cause the treatment plant to fail to meet the NPDES permit limit. Introduction to Anammox Discovery and development Anaerobic ammonia oxidation (Anammox) was originally theorized using thermodynamic equations to explain observed soluble inorganic nitrogen losses in the biologically deprived (in terms of available carbon and nutrients) water column of our oceans (Broda, 1977). He proposed that "lithotrophs missing in nature" were carrying out denitrification with ammonium as the electron donor. The term Anammox, however, was not coined until the 1990s, when microbes were experimentally identified in a denitrifying fluidized bed reactor, in which ammonium was being oxidized in an anoxic environment, producing dinitrogen gas (Mulder et al., 1995; van de Graaf et al., 1995). 3 Subsequent studies showed that nitrite was the primary electron acceptor instead of oxygen (van de Graaf et al., 1995). Equation 1 represents the observed stoichiometry of the reaction including the consumption of bicarbonate and production of biomass (Strous et al., 1998). Based on this stoichiometry, the Anammox process can theoretically achieve 89% N removal. However, this can vary depending on the ratio of available nitrite and ammonium, as well as whether any nitrate is reduced (Caffaz et al., 2006). NH4 + + 1.32NO2 - + 0.066HCO3 - + 0.13H+ → 0.066CH2O0.5N0.15 + 1.02N2 + 0.26NO3 - + 2.03H2O (1) Since discovery, the investigation of the Anammox process has led to its uncovering in many diverse environments. It has been found in marine environments, such as the Black Sea (Kuypers et al., 2003), as well as freshwater environments, such as Lake Tanganyika in Tanzania (Schubert et al., 2006). Sediments, such as those in Chesapeake Bay, have also been found to contain Anammox bacteria (Rich et al., 2008). Anammox activity has even been reported in constructed wetlands (Paredes et al., 2007) as well as multiple wastewater and leachate treatment facilities (Dong and Tollner, 2003; Egli et al., 2001; Fujii et al., 2002; Helmer-Madhok et al., 2002; López et al., 2008; Pynaert et al., 2003; Schmid et al., 2003; Tal et al., 2003; Toh and Ashbolt, 2002). In fact, it is hypothesized that up to 50% of the atmospheric nitrogen is a result of widespread Anammox activity (Dalsgaard et al., 2005; Kuypers et al., 2003; Schmid et al., 2007; Strous and Jetten, 2004). 4 Phylogeny Because Anammox bacteria are strict anaerobes and autotrophic and have long doubling times, growth in pure culture has not yet been possible (Kuenen, 2008; Tsushima et al., 2007b). However, a considerable amount of information has been determined about the phylogeny, ultrastructure and function in lab-scale studies. Anammox bacteria form a deep-branching clade within the phylum planctomycetes (Schmid et al., 2005; Schmid et al., 2007; Strous et al., 1999b) and belong to the order Planctomycetales and family Anammoxiceae (Ping, 2009). So far, five genera of Anammox bacteria have been identified: "Candidatus Kuenenia" (Schmid et al., 2000), "Candidatus Brocadia" (Kartal et al., 2004; Kuenen and Jetten, 2001) "Candidatus Anammoxoglobus" (Kartal et al., 2007b), "Candidatus Scalindua" (Schmid et al., 2003) and most recently, "Candidatus Jettenia" (Quan et al., 2008). Research shows that Candidatus Brocadia and Candidatus Kuenenia are most commonly found in wastewater treatment plants and Anammox bioreactors (Kuenen, 2008; Schmid et al., 2000), as is the more recently discovered Candidatus Jettenia asiatica (Quan et al., 2008). Candidatus Anammoxoglobus propionicus thrives in enrichments containing ammonium, nitrite and propionate and has a competitive niche in such environments (Kartal et al., 2007b). "Candidatus Scalindua," on the other hand, is mostly found in natural habitats such as marine sediments and areas with minimal oxygen (Kuenen, 2008; Kuypers et al., 2003; Schmid et al., 2003; Schmid et al., 2007). However, strains of these Anammox communities differ among the various cultures (Mohan et al., 2004), and are typically found in mixed cultures (Dalsgaard et al., 2003; Dalsgaard et al., 2005; Kuypers et al., 5 2003; Risgaard-Petersen et al., 2003; Rysgaard et al., 2004; Thamdrup and Dalsgaard, 2002; van de Graaf et al., 1997). The evolutionary distances between the different species discovered is quite large (< 85% similarity in the 16S rRNA gene), yet they all share very similar physiologies, ultrastructure and metabolism, suggesting the likelihood of an early, rapid evolutionary change (Jetten et al., 2005a; Kuenen, 2008). Cellular characteristics Anammox bacteria have several unique cellular characteristics. For instance, unlike most bacteria, as members of the planctomycetales order, they lack peptidoglycan and have a proteinaceous cell wall (König et al., 1984; Liesack et al., 1986; Strous et al., 2006). They have no outer membrane and two inner membranes (Lindsay et al., 2001; Strous et al., 1999b). A third membrane surrounds an anammoxosome "organelle," which is unique to Anammox bacteria (van Niftrik et al., 2008b). Anammox membrane lipids are also unique, as they comprise a combination of ether-linked (typical of archaea) and ester-linked (typical of bacteria and eukarya) membrane lipids (van Niftrik et al., 2008a). Likewise, most of the lipids contain ladderane moieties (Sinninghe Damste et al., 2002; Sinninghe Damste et al., 2005). These ladderane lipid structures (built from concatenated cyclobutane rings) have only been found in Anammox bacteria and seem to render the anammoxosome less permeable to the toxic hydrazine, which is formed within the organelle as a metabolic intermediate (Boumann et al., 2006; Sinninghe Damste et al., 2005). Another unique feature of these cultures is their distinctive red color, resulting from high concentrations of cytochrome c, which is a component of the nitrite reductase (NirS) found in the anammoxosome (van Niftrik et al., 2008a; van Niftrik et al., 2008b). 6 Metabolic pathways The pathway for energy metabolism in Anammox (see Figure 1), which is energetically favorable to nitrification/denitrification processes (Jetten et al., 2001), includes the reduction of nitrite to hydroxylamine by hydroxylamine oxidoreductase, which is combined with ammonium by a membrane bound enzyme complex to form hydrazine. The hydrazine is oxidized by the same hydroxylamine oxidoreductase-like (HAO) enzyme, similar to that found in aerobic ammonia-oxidizing bacteria, forming dinitrogen gas and free electrons to reduce more nitrite (Jetten et al., 1998) as well as promote ATP generation (van Niftrik et al., 2008a; van Niftrik et al., 2008b). Figure 1. Nitrogen cycle involved in tradition N removal (black) and Anammox (red) [adapted from Ahn, 2006] NH3 NH2OH NOH HNO2 HNO3 HNO2 NO N2O N2 Denitrification Nitrification AOBs NOBs Nitrogen Fixation -3 -2 -1 0 +1 +2 +3 +4 +5 N2H4 7 With the discovery of an analogue of nitric-oxide producing nitrite reductase (NirS) in the Candidatus Kuenenia stuttgartiensis genome, possible variations of the originally proposed pathway have been investigated. One such variation is nitrite first being reduced to nitric-oxide by nitrite reductase (NirS) (Strous et al., 2006; van Niftrik et al., 2008b). Since nitric-oxide is a radical, its "direct attack of ammonium" and subsequent uptake of three more electrons would yield hydrazine, via the enzyme hydrazine hydrolase (van Niftrik et al., 2008b), forming another possible metabolic pathway (Kuenen, 2008; Strous et al., 2006). Both pathways would result in the production of hydrazine, which has been directly detected in previous studies (Jetten et al., 1998). The energy-rich hydrazine can donate its electrons to produce reduced ferredoxin (Kuenen, 2008), and is oxidized to dinitrogen gas by hydrazine/hydroxylamine oxidoreductase, an octaheme cytochrome c, also found in the anammoxosome (Schalk et al., 2000; Shimamura et al., 2007). The four electrons derived from this oxidation are transferred from ferredoxin to soluble cytochrome c electron carriers (Cirpus et al., 2005; Huston et al., 2007) and finally to nitrite reductase and hydrazine hydrolase, building up the proton motive force, as mentioned earlier, to synthesize ATP (van Niftrik et al., 2008a; van Niftrik et al., 2008b). However, the versatility of Anammox itself was yet expanded further by studies that showed certain Anammox strains capable of dissimilatory nitrate reduction to ammonium (DNRA), which is a secondary metabolic process found among sulfate reducing bacteria (Rysgaard et al., 1996). DNRA converts nitrate (which is a product of Anammox) into more ammonium and/or nitrite that can then be converted to dinitrogen gas via Anammox (Kartal et al., 2007a; Kuypers et al., 2005; Risgaard-Petersen et al., 8 2003). Even though Anammox are considered autotrophic, the DNRA process includes organic acid oxidation which serves as the electron donor for the nitrate reduction and which forms carbon dioxide (Guven et al., 2005). Thus, DNRA offers a competitive advantage for certain strains of Anammox to produce their own substrates (ammonium, nitrite and carbon dioxide) from nitrate and organics (Kartal et al., 2007a). Overall, the result is greater production of dinitrogen gas from nitrate via a pathway different than conventional denitrification. Although some studies suggest that this process is insignificant compared to denitrification (Risgaard-Petersen et al., 2003), others suggest it could be significant (Trimmer et al., 2003). One Anammox strain in particular, K. stuttgartiensis, is shown to be capable of DNRA (Kartal et al., 2007a). Growth conditions and inhibition Anammox processes are temperature-dependent. Bioreactors are typically optimally operated at temperatures of approximately 30-37°C (Jetten et al., 1998). However, in marine sediments, where Candidatus Scalindua is important in the nitrogen cycle, optimal Anammox activity occurs at temperatures ranging from 12°C to 15°C and decreases sharply above 25°C (Hietanen and Kuparinen, 2008). Although Anammox are also sensitive to pH, activity is detectable in a pH range between 6.4 and 8.3 (Schmidt et al., 2002), with an optimum pH value between 7.5 and 8.2 and inhibition of Anammox activity at values greater than 8.5 (López et al., 2008). Van de Graaf et al. (1996) found that if the pH regulation failed in a bioreactor, N2O was formed and disturbed the system. If the condition is kept anoxic by flushing with Ar/CO2 (95/5%), the CO2 present in the gas can be sufficient, if controlled, to buffer the solution 9 to a pH between 7.0 and 8.0 (Jetten et al., 2005b). However, if the pH is not buffered, the pH diverges away from an unstable neutral point and must be controlled by other means. Anammox bacteria are typically strict anaerobes and in bioreactors are inhibited by low amounts of oxygen (less than 1 μM) (Jetten et al., 2005a; Strous et al., 1997b), although marine Anammox processes do not seem to be constrained to fully anoxic environments (Jensen et al., 2008). Inhibition by dissolved oxygen in bioreactors can be overcome by simply purging with Argon or Nitrogen to restore anaerobic conditions. The most notable inhibitory compound of the Anammox process is elevated concentrations of nitrite. Nitrite concentrations greater than 10 mM (Strous et al., 1998) or 50-150 mg N (L)-1 (Strous et al., 1999a) in cultures not acclimated to converting such high concentrations will inhibit Anammox activity. However, this inhibition can also be overcome with the addition of either hydroxylamine or hydrazine, both of which are process intermediates (Strous et al., 1999a). Other compounds that have been found to be inhibitory to Anammox in some studies include acetylene, high phosphate concentrations (Dapena-Mora et al., 2007; van de Graaf et al., 1996), a high salt concentration (Dapena-Mora et al., 2007), as well as alcohols such as methanol (Guven et al., 2005; Jensen et al., 2007). A high organic content (C/N >2) is also found to be inhibitory due to competition with heterotrophs (Lackner et al., 2008). Acetate can actually increase activity at low concentration but begins to be inhibitory above 10mM (Dapena-Mora et al., 2007; van de Graaf et al., 1996). Sulfide is also shown to be inhibitory in most studies (Dapena-Mora et al., 2007; Jensen et al., 2008), although it has also been found that sulfide can stimulate Anammox activity when using nitrate as the electron donor, suggesting the nitrate could be reduced 10 to nitrite by sulfide (van de Graaf et al., 1996). Ammonium and nitrate have no effect on Anammox activity (Strous et al., 1999a), nor does chlorine seem to have any effect (van de Graaf et al., 1996). Application of Anammox in Treating Ammonium-rich Wastewater The growing understanding of the Anammox process and its advantages over conventional nitrification and denitrification has led to its incorporation into full-scale wastewater treatment in several European countries as a supplemental and/or alternative nitrogen removal process. The first full-scale reactor went online in 2002 in Rotterdam, Netherlands followed by several more in other parts of Europe (van der Star et al., 2007). To date, there are no full-scale Anammox reactors operating in the United States. In applying the Anammox process to ammonium-rich wastewater treatment, two main process designs have been developed: The two-reactor Anammox application (i.e. SHARON-Anammox or PN-Anammox) process and the one-reactor Anammox application (i.e. CANON) process, with acronyms developed for different variations of each (Li, 2008; van der Star et al., 2007; Wett, 2007). Both processes have been investigated and found to work successfully, although they each have distinct benefits and challenges (Schmidt et al., 2003). Primary advantages and disadvantages The primary advantages of Anammox over traditional nitrification and denitrification are that the bacteria responsible are autotrophic and strict anaerobes. As a result, no aeration or rbCOD addition is required, resulting in considerable cost savings (Jetten et al., 2001). This is particularly useful for waste streams that are rich in 11 ammonium and have low COD concentrations, such as digester filtrate. While treating such streams with traditional nitrification and denitrification would require substantial aeration and rbCOD supplementation, the low COD/N ratio found in anaerobic digester filtrate is actually favorable for the Anammox process (Lackner et al., 2008). Anammox bacteria are also very slow growers; about an order of magnitude slower than Nitrifiers, and with lower yield (Table 1). Although it can also be considered a disadvantage, due to potentially longer start-up periods for full-scale application, slow growth rates are usually compensated with higher substrate utilization rates (Kieling et al., 2007). Also, slow growth and low yield results in minimal sludge production (van Dongen et al., 2001), which will require less solids handling and disposal, further reducing operational costs. Altogether, no aeration or additional rbCOD requirement, and less sludge production are significant operational advantages (Caffaz et al., 2006; Fux et al., 2002; van Dongen et al., 2001). Some studies claim the Anammox process can reduce operating costs as much as 90% when compared to recycling filtrate back to the main treatment train to undergo traditional nitrogen removal processes (Jetten et al., 2001). Table 1: Growth characteristics of nitrifiers and Anammox [as reported by Jetten and Strous (Jetten et al., 2001)] Characteristic Nitrifiers Anammox Max specific growth rate, μm (h)-1 0.04 0.003 Doubling time, td (days) 0.73 10.6 Yield, YX/N (mol (mol C)-1) 0.08 0.07 12 Since the Anammox reaction requires an approximate 1:1 to 1.7:1 ratio of nitrite- N to ammonium-N, its application in treating ammonium-rich wastewater requires the partial conversion of ammonium to nitrite (partial-nitritation). Yet, only some of the ammonium must be converted to nitrite and no conversion of nitrite to nitrate is required, so the amount of oxygen required is as much as 60% less than that required for traditional nitrification (van Dongen et al., 2001). SHARON-Anammox application The SHARON-Anammox application (see Figure 2), was developed on principles of the SHARON (single reactor high activity ammonia removal over nitrite) process, originally intended for streamlined ammonia nitrogen removal (ammonia oxidation and denitrification) via nitrite (Hellinga et al., 1998). SHARON includes converting all ammonium to nitrite in an aerobic reactor and inhibiting the nitrite oxidizing bacteria (NOBs), to prevent the conversion of nitrite to nitrate. In a subsequent anaerobic reactor, denitrifiers convert the nitrite from the first reactor into nitrogen gas (Ahn, 2006). This process removes the conversion to and from nitrate, reducing the oxygen requirement, but still requires all the ammonium be converted to nitrite. By altering the process in the first reactor, so that only about half the ammonium is converted to nitrite, the second reactor can be replaced with Anammox. By replacing denitrification, associated with the original SHARON process, with Anammox, no organic carbon is needed (van Dongen et al., 2001). This combination has been called several different names, but is generally referred to as the SHARON-Anammox process or partial-nitritation (PN) - Anammox process (van Dongen et al., 2001). 13 Figure 2: Simple schematic of SHARON-Anammox process [adapted from Schmidt et al., 2003] The SHARON-Anammox (PN-Anammox) process is what is being used in the WWTP Dokhaven, Rotterdam, NL, as well as several other full-scale treatment plants in Europe (van der Star et al., 2007). It allows for little process control, high loading rates, low oxygen requirement in the first reactor, and little pH control (van Dongen et al., 2001). Using two separate reactors also allows less risk of Anammox inhibition by toxic compounds in influent (filtrate) (Vazquez-Padin et al., 2009a). Since anaerobic digester filtrate generally has plentiful bicarbonate and is typically alkaline, the free ammonia concentration inhibits NOBs, which are more sensitive to free ammonia than ammonia oxidizing bacteria (AOBs) (Anthonisen et al., 1976). Likewise, since only partial ammonium oxidation is required, the bicarbonate in filtrate is usually plentiful enough to buffer the pH change associated with ammonium oxidation (van Dongen et al., 2001). Plus, less aeration is required by using partial-nitritation than even the conventional SHARON-denitrification process (van Dongen et al., 2001). Plus, oxygen-limiting conditions helps to inhibit NOBs, which have lower oxygen affinity than AOBs (Vazquez-Padin et al., 2009a; Wiesmann, 1994). The first reactor can be run with or without solids retention. Some studies have run without solids retention, such that solids retention time (SRT) equals hydraulic retention time (HRT), which is one of the distinctions of the original SHARON process (van Dongen et al., 2001). Other studies that implemented solids retention of various 1 NH4 +-N 0.42 N2 0.16 NO3 --N 0.45 NH4 +-N 0.55 NO2 SHARON --N ANAMMOX 14 degrees (Fux and Siegrist, 2004; Vazquez-Padin et al., 2009a), still achieved successful partial-nitritation. Overall, a short SRT seems to be less important than a short HRT in preventing nitrite-oxidation. A short HRT (~1 day) as well as mesophilic temperatures (~30 °C) are typically required in order to give enough advantage to AOBs to inhibit the conversion of nitrite to nitrate (Wilsenach and van Loosdrecht, 2006), although some studies have investigated the possibility of operation at room temperature (Vazquez- Padin et al., 2009a). The ratios of nitrite to ammonium provided by the first reactor (partial-nitritation) will influence the Anammox reactor (Dapena-Mora et al., 2006). Thus, the previously mentioned measures are necessary to allow nitrite to accumulate in the partial-nitritation reactor to the appropriate ratio. Likewise, if too much nitrite is produced, raw filtrate can be added directly to the second stage (Anammox) to prevent nitrite accumulation in the Anammox reactor (Fux et al., 2002). CANON application The CANON (Completely Autotrophic Nitrogen removal Over Nitrite) application was developed specifically for the Anammox process (Jetten et al., 2001). The primary distinction of the CANON process is the use of a single reactor with a mixed culture to provide both partial-nitritation and anaerobic ammonia oxidation (Anammox) (see Figure 3). The ideology is similar to the SHARON-Anammox process in that the same reactions are taking place and NOBs are inhibited. However, the CANON process requires solids retention (SRT ≠ HRT) (Vazquez-Padin et al., 2009a), and both aerobic and anaerobic (oxygen-limiting) conditions must exist within the biomass in the reactor, (Jetten et al., 2001). 15 Figure 3: Simple schematic of CANON process [adapted from Schmidt et al., 2003] In order for the CANON application to work, Anammox bacteria must grow in symbiosis with the AOBs. The Anammox grow inside the granules surrounded by AOBs on the outside, which provides AOBs with ammonium and oxygen, and provides Anammox with ammonium and the nitrite produced, along with anoxic conditions (Nielsen et al., 2005; Vazquez-Padin et al., 2009a). The aeration of the reactor can be done in cycles (Third et al., 2005) or at a constant rate (Sliekers et al., 2003) to provide just enough oxygen for the AOBs to convert about half of the ammonium to nitrite, similar to the SHARON or partial-nitritation reactor, and the Anammox simultaneously converting the remaining ammonium and nitrite to nitrogen gas (Sliekers et al., 2003; Vazquez-Padin et al., 2009a). The CANON process is already being used in full-scale treatment of anaerobic digester filtrate at WWTP Strass, Austria as well as in Hattingen, Germany (Vazquez- Padin et al., 2009a). One of the main advantages of the CANON process is the use of a single reactor, which reduces the footprint and initial capital cost. Another benefit of the single reactor CANON application is that the NOBs are automatically inhibited as a result of having to compete with AOBs for limited oxygen and with Anammox for nitrite (Sliekers et al., 2003; Vazquez-Padin et al., 2009a). Because of this added advantage of AOBs over NOBs, the CANON process has been shown to work effectively at room temperature, which further removes heating costs normally associate with the SHARON 1 NH4 +-N 0.42 N2 0.16 NO3 CANON --N 16 process (Vazquez-Padin et al., 2009a). Although the nitrogen removal rates vary more widely among the CANON-based studies than SHARON-Anammox studies (Ahn, 2006), a recent study analyzing both the SHARON-Anammox and CANON processes showed the CANON process to achieve greater overall nitrogen removal rates (Vazquez-Padin et al., 2009a). The challenges encountered with the CANON application include the potential inhibition of Anammox if exposed to oxygen and balancing the activity of the mixed culture of AOBs and Anammox (Sliekers et al., 2003; Vazquez-Padin et al., 2009a). The CANON process is subject to sensitive operational characteristics in terms of dissolved oxygen, nitrogen load, biomass thickness and temperature (Ahn, 2006). Startup can be complicated and lengthy as a result of the time required to attain enriched Anammox within biomass granules and achieve steady partial-nitritation and Anammox activity, since both Nitrifiers and Anammox are very slow growers (Third et al., 2005). A common start-up method is to gradually decrease the oxygen in a nitrifying reactor until it is low enough to inoculate with Anammox (Vazquez-Padin et al., 2009a; Vazquez- Padin et al., 2009b). Start-up might include several phases of enriching the AOB community in addition to jump starting and stabilizing Anammox activity to get both processes working effectively (Third et al., 2005). Reactor designs Anammox studies have been conducted in both suspended growth and attached growth reactors including batch reactors (Strous et al., 1998; van de Graaf et al., 1995), fluidized bed reactors (Mulder et al., 1995; Strous et al., 1997a; van de Graaf et al., 1996), fixed bed reactors (Strous et al., 1997a; Zhang et al., 2005), gas lift reactors 17 (Dapena-Mora et al., 2004b; Sliekers et al., 2003), upflow sludge blanket reactors (Jin et al., 2008b), and membrane bioreactors (Trigo et al., 2006). Suspended growth reactors select for the well-settling biomass and wash out the undesired suspended solids, promoting the retention of slow growing Anammox granules (Dapena-Mora et al., 2004a; Kartal et al., 2008; Kieling et al., 2007; van der Star et al., 2007). These well settling granules are ubiquitous among Anammox and are formed with extracellular polymeric substances (EPS) (Kartal et al., 2008). Fixed film or biolfilm reactors promote the growth of Nitrosomonas-like aerobic ammonia-oxidizing bacteria on the surface, consuming any remaining oxygen and producing nitrite, creating a suitable environment for the Anammox beneath (Tsushima et al., 2007a). The support material, such as in an upflow biofilter (a specific type of biofilm reactor), can also promote retention of slow growing Anammox (Furukawa et al., 2003). However, when used in pre-Anammox (partial-nitritation) treatment, the very long SRT can result in accumulation of nitrate in the Anammox influent (Fux and Siegrist, 2004). Batch tests are limited in analyzing Anammox due to nitrite loading limitation, because nitrite cannot be loaded in high concentrations without inhibiting the Anammox (Strous et al., 1998; Strous et al., 1999a). Traditional sequencing batch reactors (SBRs) are similarly limited, although some studies have controlled the exchange volume to achieve exceptional removal rates (Fux et al., 2002). When operated as a fed-batch reactor, the continuous or semicontinuous nitrite loading and consumption prevents inhibitory concentrations (Kuenen, 2008; López et al., 2008). Studies show gas-uplift reactors to withstand greater loading rates than batch reactors (Dapena-Mora et al., 2004b; Sliekers et al., 2003), so long as shear stress is 18 managed properly (Arrojo et al., 2008); so does the upflow biofilter (Jin et al., 2008a). Upflow anaerobic sludge blanket reactors appear more robust than both sequencing batch reactors and fixed bed reactors (Jin et al., 2008b). However, generally speaking, sequencing batch reactors offer several advantages in analyzing Anammox communities and determining operational parameters, including simpler set-up, reliable operation over long periods, better biomass retention, simpler mass balance, more homogeneous mixture and easier scale-up (Strous et al., 1998). Start-up strategies Start-up of Anammox reactors has several potential complications such as long start-up times, biomass washout, and nitrite accumulation. Several start-up strategies have been used to overcome the complications and reach steady-state performance, yet a stable start up strategy is not well defined (Kieling et al., 2007). Start-up and/or enrichment of Anammox often take a long time due to slow growth rate compared to traditional activated sludge or nitrifying reactors (Third et al., 2005; Trigo et al., 2006; Zheng et al., 2004). Biomass is usually completely retained in the reactor during start-up in order to prevent washout of slow-growing Anammox (Third et al., 2005; Trigo et al., 2006). Likewise, loading rates must be controlled in order to prevent nitrite accumulation (Third et al., 2005). The control strategies depend on the substrate source. For Anammox studies using synthetic feed solution, control of loading rate is relatively simple (López et al., 2008). Studies involving the treatment of actual filtrate or leachate (very high ammonium concentrations) may require a method, such as dilution, to reduce the concentration during start-up in order to regulate loading rates (Caffaz et al., 2006; Ruscalleda et al., 19 2008; Vazquez-Padin et al., 2009a). Another option is to start with synthetic feed then switch to actual filtrate (Caffaz et al., 2006; Dapena-Mora et al., 2006). Start-up strategies are different for SHARON-Anammox (Hwang et al., 2005) as opposed to CANON (Vazquez-Padin et al., 2009b) applications in terms of treating actual ammonium-rich wastewater. For studies using SHARON (PN), it may be necessary to provide an alternative form of nitrite initially during start-up of the PN reactor. One way to do this is to add sodium nitrite in proportion to ammonium (Caffaz et al., 2006; Hwang et al., 2005). Another method is to add nitrate initially, allowing any denitrifiers in the inoculum sludge to reduce it to nitrite (Third et al., 2005). To retain biomass during start-up, different reactor types offer different amounts of retention efficiency. Membrane bioreactors (Trigo et al., 2006) and SBRs (Dapena- Mora et al., 2004a), in particular, can have excellent retention; yet some studies have used alternative measures to retain biomass in the system, such as an external settling device (Third et al., 2005). However, if start-up involves enriching Anammox from activated sludge (Chamchoi and Nitisoravut, 2007; Zheng et al., 2004) or digester sludge (Jianlong and Jing, 2005), some washout may be helpful in removing undesired communities (Kieling et al., 2007). Solids retention time Solids retention is a major component of the Anammox process even after start-up, since Anammox are very slow growers (van Dongen et al., 2001). Studies involving Anammox processes have a large degree of variability of operating solid retention times (SRT) (see Table 2), which are significantly longer for Anammox processes than for either heterotrophic or nitrification processes. 20 Table 2: SRT values reported in studies involving Anammox reactors Study SRT (days) Dapena-Mora et al. 2004a 35-130 van der Star et. al. 2007 45-160 Chamchoi et al. 2007 42 Vazquez-Padin et al. 2009a 30 Dosta et al. 2008 150 Park et al. 2010 25 Vazquez-Padin et al. 2009b 40-150 Wett et al. 2007 30 A very long SRT would reduce sludge production but also results in lower consumption rates and greater cell decay due to substrate limitation and unstable metabolism (Shuler and Kargi, 2002). In the case of Anammox, it can also allow heterotrophic denitrification, since dead cells provide organic matter that heterotrophic denitrifying bacteria can use with both nitrite and nitrate as electron acceptors for denitrification (Kieling et al., 2007). Denitrifiers not only coexist with Anammox, but can also compete with Anammox (Kindaichi et al., 2004; Kindaichi et al., 2007; Lackner et al., 2008; Mohan et al., 2004). However, some strains have also been found to carry out (along with Anammox) dissimilatory nitrate reduction to ammonium (DNRA), which involves the oxidation of organics to CO2 and reduction of nitrate to nitrite and ammonium. Thus, if the enriched culture is capable of DNRA, it could potentially use the organic matter from cell decay and available nitrate from Anammox to provide itself 21 with additional ammonium, nitrite and CO2 (Guven et al., 2005; Kartal et al., 2007a; Kuypers et al., 2005; Risgaard-Petersen et al., 2003; Trimmer et al., 2003). Research Hypothesis and Objectives Hypothesis A suspended-growth fed-batch Anammox reactor, kept at a very long SRT (200 days), can maintain efficient nitrogen removal at a loading rate comparable with similar studies. Objectives Objective A. Start-up Anammox reactor and reach steady-state conditions at moderate loading rate using diluted filtrate from local POTW, supplemented with sodium nitrite. Objective B. Maintain SRT of 200 days by careful, manual decanting and wasting. Objective C. Take regular measurements of biomass concentration in reactor, as well as nitrogen concentrations in Anammox feed and effluent to track N removal (in terms of Ammonium, Nitrite and Nitrate) and specific N removal (in terms of VSS). Objective D. After Anammox reactor is running at steady-state, start-up partial-nitritation (PN) reactor feeding with raw filtrate (from same location), and begin using partial-nitritation effluent as feed for Anammox. Continue to dilute and supplement sodium nitrite to Anammox feed as needed to maintain appropriate ratios until PN reactor reaches full performance. 22 Objective E. Perform automated ribosomal intergenic spacer analysis (ARISA) on Anammox biomass samples taken before PN effluent is used, during stabilization with PN effluent, and after reaching steady-state with only PN effluent fed to Anammox to analyze potential shift in community. Objective F. After both reactors have maintained long-term steady-state performance, conduct cloning and sequencing as well as fluorescence in-situ hybridization (FISH), to analyze enriched community within both reactors. Compare with ARISA results. CHAPTER II MATERIALS AND METHODS Anammox Reactor Operation A 5.0 L semicontinuously fed sequencing batch reactor (fed-batch reactor) was maintained to achieve simultaneous ammonium and nitrite removal (Anammox) (see Figure 4). The FBR was inoculated with Anammox biomass received from the City College of New York (Civil Engineering Department). Anaerobic digester filtrate, used as feed, was regularly acquired from the belt press of a local wastewater treatment plant (CVWRF, SLC, UT). This provided the nutrients required for bacterial growth as well as a high initial concentration of ammonium. During start-up, and phase 1, the reactor was fed with diluted filtrate supplemented with sodium nitrite. After maintaining steady-state for 60 days, phase 2 was initiated in which a preliminary step of biological partial-nitritation of the raw filtrate was included to achieve an approximate 1.2:1 ratio of nitrite- N to ammonium-N and to remove any BOD. This ratio was chosen in order to make nitrite the limiting substrate, in order to prevent nitrite accumulation, which leads to Anammox inhibition (Strous et al., 1999a). The FBR was operated with two cycles per batch, yielding an HRT of 4 days. Each cycle included 2.5 L of feed being added over a 48 h period (52 mL (h)-1) to reach a volume of 5.0 L, concluded by 30 min of settling and manually decanting of 2.5 L. Due to the large well-settling Anammox granules (Kartal et al., 2008)., careful decanting 24 Effluent 5L pH meter Heated water coils Influent Diluted filtrate with NaNO2 (Phase 1) Partial-nitritation effluent (Phase 2) Sample valve To gas pillows and submerged gas outlet 2.5L 12 L To submerged gas outlet N2 Anammox feed cylinder Anammox reactor (FBR) Anammox effluent carboy Ar/CO2 Waste/sample valve Figure 4: Schematic of Anammox reactor 25 and visual inspection ensured negligible biomass loss in effluent. A pH of 7.8±0.3 was maintained via bicarbonate addition to the feed and by the slow purging with a 95% Argon and 5% CO2 mixture (5- 60 mL (min)-1) depending on pH), also ensuring anaerobic conditions. The feed pump was automated with electronic timers (ChronTrol, San Diego, CA). The SRT in the FBR was maintained at 200 days by wasting mixed liquor from the FBR at the end of each cycle, prior to settling. The reactor was kept at 32° C using a water bath with warm water circulating in tubes around the reactor. Anaerobic conditions were maintained by keeping the reactor sealed and gas outlet tubing submerged, and by purging the feed with nitrogen gas. Partial-nitritation Reactor Operation During phase 2, a 2.0 L sequencing batch reactor (SBR) was incorporated to achieve partial-nitritation of the anaerobic digester filtrate (see Figure 5). The SBR was seeded with biomass from a nitrification SBR (Racz et al., 2010), kept in an anoxic holding tank during phase 1. The partial-nitritation (PN) reactor was operated on a 12-h cycle with two cycles per batch (HRT of 1 day). Each cycle consisted of the addition of 1 L of raw filtrate, 12 h of aerobic reaction, concluded by 30 min of settling and decanting of 1 L. Dissolved oxygen was maintained at 1.5±0.5 mg (L)-1 by aeration at approximately 2.5 liters per minute (LPM) with an aquarium pump. All pumps were automated with electronic timers (ChronTrol, San Diego, CA). Biomass was retained in the PN reactor by placing the decant tube at a depth corresponding to the settled volume of biomass required to carry out the desired partial-nitritation and allowing any growth above that depth to be removed with the supernatant at the end of each cycle. The reactor temperature was maintained at ~ 32° C using a 26 Influent Anammox feed (Phase 2) Gas outlet Air pH meter Waste/sample valve Filtrate carboy Partial-nitritation reactor (SBR) Partial-nitritation effluent carboy Figure 5: Schematic of partial-nitritation reactor 2L 1L Heated water coils Effluent 27 circulating water bath. The bicarbonate present in the raw filtrate primarily buffered the pH at 8.0±0.5, but a small amount of base and a pH controller (Cole Parmer Instrumentation Company, Vernon Hills, Illinois) was used as contingency. The short HRT, mesophilic temperature, alkaline pH, high-ammonium levels and low DO suppressed nitrite-oxidizing activity and allowed nitrite to accumulate (Vazquez-Padin et al., 2009a). Prior to being used as Anammox feed, effluent from the partial-nitritation reactor was stored for several days in 4° C and nitrogen compound concentrations were measured just in case the partial-nitritation reactor were to over-produce nitrite, which could be inhibitory to the Anammox reactor. Sample Collection and Analytical Methods Effluent samples were routinely collected, filtered (0.45 μm) and analyzed at the end of cycles. Anammox feed (partial-nitritation effluent) measurements were conducted in duplicates (one initial and one after any required ratio adjustments) to assure proper feeding ratios and prevent nitrite accumulation in the Anammox reactor. Chemical oxygen demand (COD), ammonia (NH3-N), nitrate (NO3 --N), and nitrite (NO2 --N) were quantified using HACH methods 8000, 10031 (Salicylate method), 10020 (Chromotropic Acid method), and 8153 (Ferrous Sulfate method), respectively. Mixed liquor samples were collected via valves located midheight on the bioreactors. The valve was opened and flushed briefly to remove any accumulated biomass. The mixed liquor solids concentrations were determined as total suspended solids (TSS) and as volatile suspended solids (VSS), according to Standard Methods (Clesceri et al., 1996). 28 Phylogenetic Analysis Phylogenetic analysis was conducted on biomass from both reactors. Cloning and sequencing along with FISH and quantification were conducted on biomass from both reactors while running at steady-state. ARISA was conducted on DNA samples extracted from the Anammox biomass collected at various times during phases 1 and 2. DNA extraction DNA was extracted from 1mL mixed liquor collected from the reactors using UltraClean Soil DNA kit (MoBio Laboratories, Solana Beach, CA) according to the manufacturer's protocol. The extraction was verified in 1% (w/v) agarose gel after staining with ethydium bromide. Anammox cloning and sequencing PCR-based Anammox-specific 16S rDNA amplification. Using the extracted DNA from biomass in the Anammox reactor, the 16S rDNA region was amplified using universal primers, 8f and 1492r, the product of which was used for nested PCR targeting regions specific for subgroups or genera of Anammox bacteria. PCR reaction volume of 25 μL included 12.5 μL 2X Mastermix (Promega M750B), 0.1 mg (ml)-1 BSA, 2.0 μL of DNA template and 1.0 μL of each primer. The final volume (25 μL) was reached by adding nuclease free water. The target genera and specific primer sequences used in amplification are listed in Table 3. The reaction mixes were placed in a gradient thermal cycler (Eppendorf, Hamburg, Germany) for target region amplification. The thermal cycle program included initial denaturing time of 4 min at 94 °C, followed by 30 cycles of amplification. Each 29 Table 3: 16S rDNA primer sets used to target specific Anammox genera [Primer Sequences were obtained from Amano et al.] (Amano et al., 2007) Target Genus/Genera Primer Sequence (5'-3') Specificity AMX 368F TTCGCAATGCCCGAAAGG All Anammox genera except Kuenenia Anammoxoglobus and/or Brocadia AMX 820R AAAACCCCTCTACTTAGTGCCC Candidatus Kuenenia/Brocadia AMX 368F TTCGCAATGCCCGAAAGG All Anammox genera except Scalindua Anammoxoglobus BS 820R TAATTCCCTCTACTTAGTGCCC Candidatus Scalindua Pla All Anammox 46F GGATTAGGCATGCAAGTC All Planctomycetes belonging to Planctomycetes AMX 1480R TACGACTTAGTCCTCCTCAC All known Anammox 30 cycle consisted of denaturing at 94 °C for 30 sec, followed by annealing at either 50 or 56 °C (56 °C for Kuenenia/Brocadia target genera and 50 °C for others) for 30 sec and finished with elongation for 1 min at 72 °C. A final elongation step of 7 min at 72 °C was used to finish any incomplete elongations. The size of the amplicons was verified on 1% agarose gel running against a 1kb DNA ladder (Fermentas). After gel electrophoresis, the PCR products were purified using QIAQuick PCR purification kit (Qiagen Inc., Valencia, CA). Generation of Anammox-specific 16S rDNA clone libraries and sequencing. The purified PCR products were ligated to a pCR®4-TOPO® (Invitrogen, CA) vector, and chemically competent E. coli cells were then transformed with ligated product following manufacturer's protocol. Plasmid DNA from the clones was extracted using the Zyppy™ Plasmid Miniprep Kit (Zymo Research, CA). To conduct sequencing, 1μL of the plasmid DNA was used as template with universal primers M13F (5'-GTAAAACGACGGCCAG- 3') for target genera Kuenenia/Brocadia and Scalindua, and EUB 338F (5'- ACTCCTACGGGAGGCAGC-3') for target genera including all Anammox. Cycle sequencing using ABI 3130 DNA sequencer (Applied Biosystems, Foster City, CA) was performed at the University of Utah Core Facilities. Partial-nitritation cloning and sequencing PCR-based amoA gene DNA amplification. From the extracted DNA of the biomass from the partial-nitritation reactor, the amoA rDNA gene was amplified using universal primers, 1F (5'-GGGGTTTCTACTGGTGGT-3') and 2R (5'- CCCCTCKGSAAAGCCTTCTTC-3'). PCR reaction volume of 25 μL included 12.5 μL 31 2X Mastermix (Promega M750B), 0.1 mg (ml)-1 BSA, 2.0 μL of DNA template and 1.0 μL of each primer. The final volume (25 μL) was reached by adding nuclease free water. The reaction mixes were placed in a gradient thermal cycler (Eppendorf, Hamburg, Germany) for target region amplification. The thermal cycle program included initial denaturing time of 4 min at 94 °C, followed by 30 cycles of amplification. Each cycle consisted of denaturing at 94 °C for 30 sec, followed by annealing at 56°C for 30 sec and finished with elongation for 1 min at 72 °C. A final elongation step of 7 min at 72 °C was used to finish any incomplete elongations. The size of the amplicons was verified on 1% agarose gel running against a 100bp DNA ladder (Fermentas). After gel electrophoresis, the PCR products were purified using QIAQuick PCR purification kit (Qiagen Inc., Valencia, CA). Generation of amoA gene DNA clone libraries and sequencing. The purified PCR products were ligated to a pCR®4-TOPO® (Invitrogen, CA) vector, and chemically competent E. coli cells were then transformed with ligated product following manufacturer's protocol. Plasmid DNA from the clones was extracted using the Zyppy™ Plasmid Miniprep Kit (Zymo Research, CA). To conduct sequencing, 1μL of the plasmid DNA was used as template along with the universal primer 1F (5'- GGGGTTTCTACTGGTGGT-3') for cycle sequencing using ABI 3130 DNA sequencer (Applied Biosystems, Foster City, CA) at the University of Utah Core Facilities. Sequence data analysis Sequences obtained from the clone libraries were compared with other identified species/ sequences using NCBI-BLAST 2.2.12 program. Reference sequences were then aligned with and trimmed to an appropriate common length. MEGA software version 4.0 32 (Tamura et al., 2007) was used to align sequences of the recovered clones with other published sequences and to construct phylogenetic trees using the maximum likelihood method. Bootstrap values were based on 100 trials. FISH and quantification Biomass was taken from both reactors and analyzed separately using FISH. The biomass was washed twice in PBS, purged and fixed in 4% (v/v) paraformaldehyde solution for 45 min. Following fixation, the cells were filtered, washed with distilled and deionized water, and placed on a gelatin-coated glass slide. The cells on the slide were then hybridized with 200 mL of (40%) formamide hybridization buffer and 7.5 mL of probe solution (12.5 mM). The probe used to hybridize with biomass from the Anammox reactor was AMX 820 labeled with Cy3, along with 40% hybridization buffer, as found in a study by Schmid and colleagues (Schmid et al., 2005). The probe used to hybridize with biomass from the partial-nitritation reactor was Nm1 labeled with Cy3, along with 35% hybridization buffer. The fixed cells were allowed to hybridize at 46 °C for 12-16 h after which the cells were washed 3-4 times in wash buffer (40% for AMX820 and 35% for Nm1) and then incubated for 20 min at 48 °C. The slide was then removed and washed 7-9 times with 4 °C distilled and deionized (DI) water and allowed to dry at room temperature in the dark. Following hybridization with the respective probe, the sample was stained with 100 mL of 4', 6'-diamidino-2-phenylindole (DAPI) (5 mg (ml)-1) for 5 min in the dark as counterstain to visualize nontarget cells. The slides were again washed with 4 °C DI water and allowed to air dry. The cells were viewed under epifluorescence microscope (Olympus BX51) equipped with a halogen lamp and CCD camera (Olympus DP71). 33 Communities targeted by the probes were quantified using imageJ. The background interference was removed by adjusting the brightness and contrast. Then, RGB analysis was done on overlaid images (Cy3 and DAPI). Quantification was based on percentage of red and green light over RGB light. ARISA analysis on Anammox population Automated Ribosomal Intergenic Spacer Analysis (ARISA) was done using PCR to amplify the 16S to 23S intergenic spacer regions, in the rRNA operons of the Anammox reactor population during phases 1 and 2 (Fisher and Triplett, 1999). The primers used were 1406F (5' -TGYACACACCGCCCGT- 3', labeled with HEX) and 23SR (5' -GGGTTBCCCCATTCRG- 3'). The thermal profile was as follows: denaturation at 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 45 sec, and elongation at 72°C for 2 min, with a polishing steps at 72°C for 2 min. Aliquots (2 mL) of 2x diluted PCR products were mixed with 0.5 mL of ROX-labeled GENEFLOt 625 internal length standard (CHIMERx, Milwaukee, WI) and 10mL of formamide. Samples were processed with an ABI 310 DNA sequencer (Applied Biosystems, Foster City, CA) at the University of Utah Core Facilities and analyzed using the GeneScan software (Applied Biosystems, Foster City, CA) version 2.6. CHAPTER III RESULTS AND DISCUSSION Anammox Reactor Performance Figure 6 illustrates the Anammox reactor performance over a 167-day period (days 40-207). Start-up of the reactor took approximately 40 days (days 1-39) to reach ~80% removal of influent total inorganic nitrogen (TIN - referred to in this and other similar studies as N). The Anammox reactor was fed with diluted filtrate and supplemented with sodium nitrite during days 40-100 (phase 1). During days 100-207 (phase 2), partial-nitritation was used as a preliminary step to Anammox. Figure 6: Graph of Anammox reactor performance 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% 0 200 400 600 800 1000 1200 1400 1600 1800 40 90 140 190 % TIN Removal TIN Concentration (mg/L) Days InNluent TIN EfNluent TIN TIN Removal EfNiciency PHASE 1 PHASE 2 35 Around day 100, the Anammox process became inhibited and nitrite accumulated. The cause is likely due to solvents from the new feed cylinder, which was built and put in place at that time (and only allowed to dry for one night). To mitigate nitrite accumulation, the feed was diluted and loading slowed, as well as 0.1mM of hydrazine added to restore reactor activity (Strous et al., 1999a; Third et al., 2005). The reactor returned to normal activity in approximately 5 days. The overall nitrogen loading rate to the Anammox was 0.33±0.03 g N (L-day)-1 with a maximum of 0.4 g N (L-day)-1. Average VSS concentration was 1109±189 mg VSS (L)-1 and average overall N removal efficiency was 82±4%. The average specific removal was 0.28±0.05 g N (g VSS-day)-1 with a maximum of 0.35 g N (g VSS-day)-1 over phases 1 and 2. Table 4 shows a comparison of the max loading and specific removal rate, as well as average removal efficiency, with other studies using fed-batch Anammox reactors. The average Anammox influent concentration over the entire 167 days period was 593±55 mg (L)-1 NH4 +-N, 698±57 mg (L)-1 NO2-N, and 8±8 mg (L)-1 NO3-N, with an average nitrite to ammonium ratio of 1.18±0.1 g NO2-N (g NH4 +-N)-1. The average Anammox effluent was 60±23, 5±5, and 66±21 mg (L)-1 as NH4 +-N, NO2-N, and NO3-N, respectively. Ammonium was always found in the effluent because nitrite-limitation was used as a process control, to prevent nitrite accumulation in the Anammox reactor. The average removal ratio of nitrite and ammonium was approximately 1.31±0.13, which agrees closely with Strous' empirical equation (Strous et al., 1998). The ratio of nitrate produced to ammonium consumed was approximately 0.11±0.05, less than the ratio of 0.26 reported by Strous (Strous et al., 1998). This was 36 Source Arrojo et al. 2008 Dosta et al. 2008 Vazquez-Padin et al. 2009a This Study Ruscalleda et al. 2008 Dapena-Mora et al. 2006 Reactor Temp (C°) 30 15-30 20-30 32 36 35 Average Removal Efficiency (%) 69-80 82 87 68 Max Specific Removal (g N (g VSS-day)-1) 0.35 0.4 0.28 0.35 0.45 Max Loading Rate (g N (L-day)-1) 0.3 0.3 0.28 0.4 0.53 0.7 Feed Synthetic Synthetic PN effluent PN effluent PN effluent PN effluent Table 4: Loading and specific removal rate comparison with other Anammox studies that used fed-batch reactors 37 expected as a result of running at a long SRT (which should produce organic acids via cell decay). The nitrate and organic acids being used in denitrification and/or DNRA, are evidenced by consistent mild reductions of COD seen in periodic COD measurements. This is also supported by many studies showing Anammox to coexist with denitrifiers (Dalsgaard et al., 2003; Dalsgaard et al., 2005; Kuypers et al., 2003; Risgaard-Petersen et al., 2003; Rysgaard et al., 2004; Thamdrup and Dalsgaard, 2002; van de Graaf et al., 1997), as well as studies confirming some Anammox strains carrying out nitrate reduction (DNRA), and organic acid oxidation, to produce nitrite, ammonium and carbon dioxide (substrates of the Anammox process) (Guven et al., 2005; Kartal et al., 2007a). Partial-nitritation Reactor Performance During the approximately 45-day start-up period (100-145) of the partial-nitritation reactor, process controls were optimized, including aeration rate and HRT. Also, some sodium nitrite was added to the effluent until the partial-nitritation reactor reached steady-state production of a ratio of approximately 1.2:1 nitrite-N to ammonium- N, needed for Anammox feed. The average filtrate concentration during the start-up period was 1230±61 mg (L)-1 NH4 +-N and average VSS in the PN reactor was 1171±156 mg (L)-1. The average effluent concentrations during start-up were 331±165 mg (L)-1 NO2-N, 861±159 mg (L)-1 NH4 +-N, and 38±15 mg (L)-1 NO3-N. During days 146 - 207, when the PN reactor ran at steady-state, the average filtrate concentration was 1334±69 mg (L)-1 NH4 +-N and the average VSS was 2070±259 mg (L)-1. Effluent concentrations at steady-state were 704±50 mg (L)-1 NO2-N, 607±76 mg (L)-1 NH4 +-N, and 23±11 mg (L)-1 NO3-N with an average nitrite to ammonium ratio 38 of approximately 1.18:1 g NO2-N (g NH4 +-N)-1, which is suitable for Anammox feed and promotes nitrite-limiting conditions, preventing nitrite accumulation in the Anammox. Microbial Ecology of Anammox Bacteria Cloning and sequence analysis results were obtained and compared with FISH results to qualitatively and quantitatively analyze the Anammox biomass community in the Anammox reactor. Phylogenetic classification based on Anammox-specific 16S rDNA regions Figure 7 represents the overall phylogeny of Anammox in the reactor. Based on a ≥ 99% homology, approximately 53% of the clones obtained using primer pair Pla 46F and AMX 1480R (specific to all known Anammox bacteria) were homologous to Kuenenia stuttgartiensis (CT573071). All the clones obtained using primer pair AMX 368F and AMX 820R (specific to Candidatus Kuenenia/Brocadia) were homologous to Candidatus Kuenenia, suggesting the likelihood of a complete absence of Brocadia. Although specific primers were used to target genera Scalindua, they were not found to be present in the clone library. Likewise, the genera Candidatus Jettenia and Candidatus Anammoxoglobus were not found. The apparent enrichment of K. stuttgartiensis in the Anammox population can be attributed to many months of steady-state performance. It is also supported by many other sources that found a dominance of Candidatus Kuenenia in enriched Anammox communities within lab-scale and full-scale bioreactors (Dosta et al., 2008; Hwang et al., 2005; Schmid et al., 2005; Strous et al., 2006). 39 Figure 7: Phylogenetic tree of Anammox community r c onditiarw o f ,orol ei m (.AY257181) ,!! ,~ CamF.daw.s &almdua brodafl (. H 154883j Candidarus Sca!indua WQg>I"ri (.4.1754882) w Candidatw Jlllrllnia asiatica (DQ3 015])) '"' Ctmdidntw Ana/f'llfloxoglobw (DQJ1760J) " Candidazw Brocadiafulgida (DQ4 59989) " '-.0 Ku",,,,'a srultgarl i£/lSis (CT5 7 30 71) '-;00 • OTUl (lJclolHJ) " • OTU4 (/cfoOU/) " • OTUl (Sc/OM:: ) ,~ • OTU5 (6dona ) • OTV6 (lclonilS) Planclam),cllS moris (.AJ23J /84) •• 40 Table 5 shows a comparison among other Anammox studies using fed-batch reactors. The comparisons are grouped according to the reported genus or genera enriched. Studies with positive hybridization of probes specific to certain strains or positive sequence homology to a certain strain were designated as containing that strain, while those that only report positive hybridization with general probes (i.e. AMX 820), with no other analyses conducted, were designated as containing the respective genus or genera (i.e. Candidatus Kuenenia and/or Brocadia). The strain K. stuttgartiensis is reported to be capable of DNRA and organic oxidation (Kartal et al., 2007a) which coincides with the Anammox reactor performance, finding that nitrate in the effluent was much less than the stoichiometric ratio reported by Strous (Strous et al., 1998). Since the loading rate throughout the entire study was modest, and the very long SRT would result in some cell decay (organic addition), the dominance of K. stuttgartiensis seems to be the result of a selective advantage over other Anammox communities in the reactor by its diverse metabolic capabilities; it has an alternative metabolic pathway, DNRA, which can be used to reduce nitrate (produced by the Anammox process) to nitrite and/or ammonium via organic oxidation, producing more substrates necessary for the Anammox process (Kartal et al., 2007a). Besides Candidatus Kuenenia, five other operational taxonomic units (OTUs) homologous to uncultured and/or unclassified Planctomycetes or Anammox bacteria were found within the clone library. It is interesting to note that, even though these OTUs do not match with published Anammox strains, there is significant enrichment even among them, evidenced by the few number of OTUs and the fact that most of these OTUs have multiple clones (see Figure 7). 41 Table 5: Comparison of dominant strains in various Anammox studies that used fed-batch reactors Configuration Feed Type Dominant Genus/Species Source Anammox Synthetic K. stuttgartiensis Arrojo et al. 2008 Anammox Synthetic K. stuttgartiensis Dosta et al. 2008 PN-Anammox PN effluent K. stuttgartiensis This Study PN-Anammox PN effluent Candidatus Kuenenia and/or Brocadia Dapena- Mora et al. 2006 CANON Filtrate Candidatus Kuenenia and/or Brocadia Vazquez- Padin et al. 2009a Anammox Synthetic Candidatus Kuenenia and/or Brocadia Jin et al. 2008a CANON Synthetic B. Anammoxidans Third et al. 2005 Anammox Synthetic B. Anammoxidans Lopez et al. 2008 Anammox Synthetic + propionate Candidatus Anammoxoglobus propionicus Kartal et al. 2007a 42 Anammox bacteria are a relatively recent discovery and new species/genus level diversity is still being discovered (Quan et al., 2008; Schmid et al., 2005); so it is very possible that the other unidentified OTUs could also be somewhat-enriched, novel strains carrying out Anammox, especially since cloning and sequencing was done with Anammox specific primers. However, further studies involving quantification and targeting genes specific to the Anammox process would be required to positively affirm the presence of novel group(s) of Anammox in the bioreactor. FISH analysis and quantification Figure 8 shows overlaid micrographs obtained from FISH performed on mixed liquor samples of the Anammox reactor. The results show a definite presence and likely dominance of Anammox bacteria in the reactor biomass. The probe used, AMX 820 (Cy3), was specific to Candidatus Kuenenia and/or Candidatus Brocadia. Based on the sequence analysis, the stained biomass (Cy3) is probably almost entirely K. stuttgartiensis. Quantification of that community showed their dominance within Anammox reactor to be approximately 65% of the biomass. Due to the specificity of the probe, and the observation of other (likely-Anammox) OTUs, it is likely that other Anammox strains are also present, but not shown (Cy3 labeled). It is also likely that much of the bacteria stained blue (DAPI) are denitrifiers, since occasional COD measurements in the feed and effluent consistently showed mild COD decreases in the Anammox reactor, and since Anammox bacteria have been consistently shown to coexist with denitrifiers (Ruscalleda et al., 2008). 43 Figure 8: Micrographs obtained from FISH analysis of biomass from Anammox reactor using AMX820 probe 44 Microbial Ecology of Ammonia-oxidizing Bacteria Cloning and sequence analysis results were obtained and compared with FISH results to qualitatively and quantitatively analyze the ammonia-oxidizing bacteria (AOB) community in the partial-nitritation reactor. Phylogenetic classification based on amoA gene DNA regions Figure 9 shows the sequence analysis results for the amoA-based clone library (AOBs in the PN reactor). Although none of the clones matched exactly with published sequences, all OTUs did fall under N. europaea lineage and none under N. oligotropha lineage. This agrees with many other studies that used partial-nitritation reactors, which report a large degree of dominance of the N. europaea lineage due to oxygen-limiting and concentrated ammonium conditions, characteristic of partial-nitritation processes (Nielsen et al., 2005; Otawa et al., 2006; Park et al., 2010; Pynaert et al., 2003; Quan et al., 2008). FISH analysis and quantification Figure 10 shows overlaid micrographs obtained from FISH performed on mixed liquor samples of the partial-nitritation reactor. The results show a definite presence and likely dominance of AOB bacteria in the reactor biomass. Based on the sequence analysis, the AOB community is probably almost entirely of the N. europaea lineage. Quantification of the hybridized AOB community suggests its dominance within the partial-nitritation reactor to be approximately 62% of the community. However, the probe used for FISH (Nm1) hybridizes to a conserved region for Nitrosomonas halophila (Park et al., 2010) and potentially other related strains. So, it is very likely that AOB 45 Figure 9: Phylogenetic tree of AOB community from partial-nitritation reactor 46 Figure 10: Micrographs obtained from FISH analysis of biomass from the partial-nitritation reactor using Nm1 probe 47 dominance in the overall community is much greater, since many other strains within the N. europaea lineage exist besides N. halophila and sequencing results showed OTUs outside of the N. halophila strain. It is also likely that some of the bacteria stained blue (DAPI) are heterotrophic in nature due to the semi-aerobic environment and consistent presence of COD in the filtrate. ARISA Analysis of Anammox Population ARISA results for days 95-207, with snapshots at days 95, 146 and 207, respectively, are represented in Figure 11. The continual enrichment of the dominant culture can be seen by the gradual reduction of competing populations (smaller peaks). The first ARISA (day 95) was just prior to the start of partial-nitritation reactor. Although the ARISA results are not qualitative, they do show the dominance of a particular group within the reactor. Using NCBI to isolate of the intergenic spacer region of the published partial-genome for Kuenenia stuttgartiensis, correlating with the primer set used, yields a length of approximately 800 base pairs, correlating with the dominant peak in the ARISA profiles and supporting the findings from the Sequences analysis and FISH results. The dominance of K. stuttgartiensis is over the entire period despite the shift from diluted filtrate with sodium nitrite to concentrated filtrate pretreated with partial-nitritation. Thus, the shift from phase 1 to phase 2 (around day 100) does not seem to have had any effect on the community other than sustaining the enrichment of the already dominant group. This may be a result of the filtrate being from the same source during both phases, such that most of macro- and micronutrients would have been similar in the feed, even though the concentrations were different due to dilution (phase 1) and nitrite 48 Figure 11. ARISA profile of Anammox community over study period 95 days 146 days 207 days 7000 6000 5000 4000 3000 2000 1000 7000 6000 5000 4000 3000 2000 1000 7000 6000 5000 4000 3000 2000 1000 Peak Height (Fluorescence Units) 100 200 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 Length (bp) 49 was supplied by two different means during each phase. Further investigation would add an interesting perspective to the finding that community enrichment is dependant on feed composition and concentration (Park et al., 2010). It may also be that the selective advantage of K. stuttgartiensis throughout the entire study, as described previously, played a greater role in supporting its enrichment than the filtrate composition. However, further analysis is needed to make any direct statements as to which factors controlled. CHAPTER IV CONCLUSIONS Conclusions from Study This study simulated a side-stream PN-Anammox process to treat filtrate at a very long SRT. Phylogenetic results were used to analyze the enriched communities, the degree of enrichment and whether shifting the feed caused a shift in the Anammox population. According to the results found, the following conclusions can be made: • The suspended-growth fed-batch Anammox reactor, fed with partial-nitritation effluent, kept at a moderate loading rate comparable with other fed-batch reactor studies and a very long SRT (200 days), reached steady-state performance and achieved an average N removal of 82% (≥ 80%), a maximum specific removal rate comparable with other similar studies, and little sludge production. • Maintaining a very long SRT and moderate loading rate resulted in selective enrichment of an Anammox community that is capable of DNRA (K. stuttgartiensis), which has an advantage in substrate-limiting conditions, due to its ability to utilize available nitrate and organics (from cell decay) to produce substrates for its primary metabolism (Anammox). • Shifting the Anammox feed from diluted filtrate and sodium-nitrite to undiluted filtrate with nitrite provided strictly via partial-nitritation caused no noticeable 51 shift in the Anammox population, only continued enrichment (dominance of K. stuttgartiensis and reduction of competing communities). • The partial-nitritation (PN) reactor community became enriched with AOBs within the N. Europaea lineage, which according to other literature is due to oxygen limitation and high ammonium concentrations in partial-nitritation reactors treating digester filtrate or a similarly ammonium-rich wastewater. The exact reason(s) for the lack of shift in the Anammox population seen throughout the study, despite change in the feed characteristics, would require further analysis, including repeating the shift under higher loading or shorter SRT (non-substrate- limiting) conditions. Likewise, further studies are needed to positively confirm novelty of the unidentified Anammox OTUs, and to clarify their role in the Anammox community. Applying the long SRT to full-scale treatment would likely be successful, especially since full-scale applications typically run at higher loading rates. The potential substrate-limiting conditions and endogenous decay that may result from the long SRT could facilitate the consumption of available nitrate by Anammox capable of DNRA. These could compete with denitrifiers for nitrate and organics and result in less biomass production while still achieving efficient nitrogen removal. REFERENCES Ahn, Y.-H. (2006) Sustainable nitrogen elimination biotechnologies: A review. Process Biochemistry, 41, 1709-1721. Amano, T.; Yoshinaga, I.; Okada, K.; Yamagishi, T.; Ueda, S.; Obuchi, A.; Sako, Y.; Suwa, Y. (2007) Detection of anammox activity and diversity of anammox bacteria-related 16S rRNA genes in coastal marine sediment in japan. Microbes Environment, 22, 232-242. Anthonisen, A. C.; Loehr, R. C.; Prakasam, T. B. S.; Srinath, E. G. (1976) Inhibition of Nitrification by Ammonia and Nitrous Acid. Journal (Water Pollution Control Federation), 48, 835-852. Arrojo, B.; Figueroa, M.; Mosquera-Corral, A.; Campos, J. L.; Mendez, R. (2008) Influence of gas flow-induced shear stress on the operation of the Anammox process in a SBR. Chemosphere, 72, 1687-1693. Boumann, H. A.; Hopmans, E. C.; Van De Leemput, I.; Op den Camp, H. J. M.; Van De Vossenberg, J.; Strous, M.; Jetten, M. S. M.; Sinninghe Damsté, J. S.; Schouten, S. (2006) Ladderane phospholipids in anammox bacteria comprise phosphocholine and phosphoethanolamine headgroups. FEMS Microbiology Letters, 258, 297-304. Broda, E. (1977) Two kinds of lithotrophs missing in nature. Z Allg Mikrobiol, 17, 491- 493. Caffaz, S.; Lubello, C.; Canziani, R.; Santlianni, D. (2006) Autotrophic nitrogen removal from anaerobic supernatant of Florence's WWTP digesters. Water Science and Technology, 53, 129-137. Chamchoi, N.; Nitisoravut, S. (2007) Anammox enrichment from different conventional sludges. Chemosphere, 66, 2225-2232. Cirpus, I. E. Y.; de Been, M.; Op den Camp, H. J. M.; Strous, M.; Le Paslier, D.; Kuenen, G. J.; Jetten, M. S. M. (2005) A new soluble 10 kDa monoheme cytochrome c-552 from the anammox bacterium Candidatus"Kuenenia stuttgartiensis". FEMS Microbiology Letters, 252, 273-278. Clesceri, L. S.; Eaton, A. D.; Greenberg, A. E.; Franson, M. A. H.; American Public Health Association.; American Water Works Association.; Water Environment Federation. (1996) Standard methods for the examination of water and wastewater. 20th ed. American Public Health Association: Washington, DC. 53 Dalsgaard, T.; Canfield, D. E.; Petersen, J.; Thamdrup, B.; Acuna-Gonzalez, J. (2003) N2 production by the anammox reaction in the anoxic water column of Golfo Dulce, Costa Rica. Nature, 422, 606-608. Dalsgaard, T.; Thamdrup, B.; Canfield, D. E. (2005) Anaerobic ammonium oxidation (anammox) in the marine environment. Research in Microbiology, 156, 457-464. Dapena-Mora, A.; Arrojo, B.; Campos, J. L.; Mosquera-Corral, A.; Méndez, R. (2004a) Improvement of the settling properties of Anammox sludge in an SBR. Journal of Chemical Technology and Biotechnology, 79, 1417-1420. Dapena-Mora, A.; Campos, J. L.; Mosquera-Corral, A.; Jetten, M. S.; Mendez, R. (2004b) Stability of the ANAMMOX process in a gas-lift reactor and a SBR. Journal of Biotechnology, 110, 159-170. Dapena-Mora, A.; Campos, J. L.; Mosquera-Corral, A.; Mendez, R. (2006) Anammox process for nitrogen removal from anaerobically digested fish canning effluents. Water Science and Technology, 53, 265-274. Dapena-Mora, A.; Fernandez, I.; Campos, J. L.; Mosquera-Corral, A.; Mendez, R.; Jetten, M. S. M. (2007) Evaluation of activity and inhibition effects on Anammox process by batch tests based on the nitrogen gas production. Enzyme Microb Tech, 40, 859-865. Dong, X.; Tollner, E. W. (2003) Evaluation of Anammox and denitrification during anaerobic digestion of poultry manure. Bioresource Technology, 86, 139-145. Dosta, J.; Fernandez, I.; Vazquez-Padin, J. R.; Mosquera-Corral, A.; Campos, J. L.; Mata-Alvarez, J.; Mendez, R. (2008) Short- and long-term effects of temperature on the Anammox process. Journal of Hazardous Materials, 154, 688-693. Egli, K.; Fanger, U.; Alvarez, P. J.; Siegrist, H.; van der Meer, J. R.; Zehnder, A. J. (2001) Enrichment and characterization of an anammox bacterium from a rotating biological contactor treating ammonium-rich leachate. Archives of Microbiology, 175, 198-207. Fisher, M. M.; Triplett, E. W. (1999) Automated approach for ribosomal intergenic spacer analysis of microbial diversity and its application to freshwater bacterial communities. Applied and Environmental Microbiology, 65, 4630-4636. Fujii, T.; Sugino, H.; Rouse, J. D.; Furukawa, K. (2002) Characterization of the microbial community in an anaerobic ammonium-oxidizing biofilm cultured on a nonwoven biomass carrier. Journal of Bioscience and Bioengineering, 94, 412-418. Furukawa, K.; Rouse, J. D.; Yoshida, N.; Hatanaka, H. (2003) Mass Cultivation of Anaerobic Ammonium-Oxidizing Sludge Using a Novel Nonwoven Biomass Carrier. Journal of Chemical Engineering of Japan, 36, 1163-1169. 54 Fux, C.; Boehler, M.; Huber, P.; Brunner, I.; Siegrist, H. (2002) Biological treatment of ammonium-rich wastewater by partial nitritation and subsequent anaerobic ammonium oxidation (anammox) in a pilot plant. Journal of Biotechnology, 99, 295-306. Fux, C.; Siegrist, H. (2004) Nitrogen removal from sludge digester liquids by nitrification/denitrification or partial nitritation/anammox: environmental and economical considerations. Water Science and Technology, 50, 19-26. Guven, D.; Dapena, A.; Kartal, B.; Schmid, M. C.; Maas, B.; van de Pas-Schoonen, K.; Sozen, S.; Mendez, R.; Op den Camp, H. J. M.; Jetten, M. S. M.; Strous, M.; Schmidt, I. (2005) Propionate Oxidation by and Methanol Inhibition of Anaerobic Ammonium- Oxidizing Bacteria. Applied and Environmental Microbiology, 71, 1066-1071. Hellinga, C.; Schellen, A. A. J. C.; Mulder, J. W.; van Loosdrecht, M. C. M.; Heijnen, J. J. (1998) The sharon process: An innovative method for nitrogen removal from ammonium-rich waste water. Water Science and Technology, 37, 135-142. Helmer-Madhok, C.; Schmid, M.; Filipov, E.; Gaul, T.; Hippen, A.; Rosenwinkel, K. H.; Seyfried, C. F.; Wagner, M.; Kunst, S. (2002) Deammonification in biofilm systems: population structure and function. Water Science and Technology, 46, 223-231. Hietanen, S.; Kuparinen, J. (2008) Seasonal and short-term variation in denitrification and anammox at a coastal station on the Gulf of Finland, Baltic Sea. Hydrobiologia, 596, 67-77. Huston, W. M.; Harhangi, H. R.; Leech, A. P.; Butler, C. S.; Jetten, M. S. M.; Op den Camp, H. J. M.; Moir, J. W. B. (2007) Expression and characterisation of a major c-type cytochrome encoded by gene kustc0563 from Kuenenia stuttgartiensis as a recombinant protein in Escherichia coli. Protein Expression and Purification, 51, 28-33. Hwang, I. S.; Min, K. S.; Choi, E.; Yun, Z. (2005) Nitrogen removal from piggery waste using the combined SHARON and ANAMMOX process. Water Science and Technology, 52, 487-494. Iranpour, R.; Cox, H. H.; Oh, S.; Fan, S.; Kearney, R. J.; Abkian, V.; Haug, R. T. (2006) Thermophilic-anaerobic digestion to produce class A biosolids: initial full-scale studies at Hyperion Treatment Plant. Water Environment Research, 78, 170-180. Jensen, M. M.; Thamdrup, B.; Dalsgaard, T. (2007) Effects of specific inhibitors on anammox and denitrification in marine sediments. Applied and Environmental Microbiology, 73, 3151-3158. Jensen, M. M.; Kuypers, M. M. M.; Lavik, G.; Thamdrup, B. (2008) Rates and regulation of anaerobic ammonium oxidation and denitrification in the Black Sea. Limnology and Oceanography, 53, 23-36. 55 Jetten, M. S.; Wagner, M.; Fuerst, J.; van Loosdrecht, M.; Kuenen, G.; Strous, M. (2001) Microbiology and application of the anaerobic ammonium oxidation ('anammox') process. Current Opinion in Biotechnology, 12, 283-288. Jetten, M. S.; Cirpus, I.; Kartal, B.; van Niftrik, L.; van de Pas-Schoonen, K. T.; Sliekers, O.; Haaijer, S.; van der Star, W.; Schmid, M.; van de Vossenberg, J.; Schmidt, I.; Harhangi, H.; van Loosdrecht, M.; Gijs Kuenen, J.; Op den Camp, H.; Strous, M. (2005a) 1994-2004: 10 years of research on the anaerobic oxidation of ammonium. Biochemical Society Transactions, 33, 119-123. Jetten, M. S.; Schmid, M.; van de Pas-Schoonen, K.; Sinninghe Damste, J.; Strous, M. (2005b) Anammox organisms: enrichment, cultivation, and environmental analysis. Methods in Enzymology, 397, 34-57. Jetten, M. S. M.; Strous, M.; van de Pas-Schoonen, K. T.; Schalk, J.; van Dongen, U. G. J. M.; van de Graaf, A. A.; Logemann, S.; Muyzer, G.; van Loosdrecht, M. C. M.; Kuenen, J. G. (1998) The anaerobic oxidation of ammonium. FEMS Microbiology Reviews, 22, 421-437. Jianlong, W.; Jing, K. (2005) The characteristics of anaerobic ammonium oxidation (ANAMMOX) by granular sludge from an EGSB reactor. Process Biochemistry, 40, 1973-1978. Jin, R. C.; Zheng, P.; Hu, A.-H.; Mahmood, Q.; Hu, B.-L.; Jilani, G. (2008a) Performance comparison of two anammox reactors: SBR and UBF. Chemical Engineering Journal, 138, 224-230. Jin, R. C.; Hu, B. L.; Zheng, P.; Qaisar, M.; Hu, A. H.; Islam, E. (2008b) Quantitative comparison of stability of ANAMMOX process in different reactor configurations. Bioresource Technology, 99, 1603-1609. Kartal, B.; van Niftrik, L.; Sliekers, O.; Schmid, M. C.; Schmidt, I.; van de Pas- Schoonen, K.; Cirpus, I.; van der Star, W.; van Loosdrecht, M.; Abma, W.; Kuenen, J. G.; Mulder, J.-W.; Jetten, M. S. M.; den Camp, H. O.; Strous, M.; van de Vossenberg, J. (2004) Application, eco-physiology and biodiversity of anaerobic ammonium-oxidizing bacteria. Reviews in Environmental Science and Biotechnology, 3, 255-264. Kartal, B.; Kuypers, M. M.; Lavik, G.; Schalk, J.; Op den Camp, H. J.; Jetten, M. S.; Strous, M. (2007a) Anammox bacteria disguised as denitrifiers: nitrate reduction to dinitrogen gas via nitrite and ammonium. Environmental Microbiology, 9, 635-642. Kartal, B.; Rattray, J.; van Niftrik, L. A.; van de Vossenberg, J.; Schmid, M. C.; Webb, R. I.; Schouten, S.; Fuerst, J. A.; Sinninghe Damste, J.; Jetten, M. S. M.; Strous, M. (2007b) Candidatus "Anammoxoglobus propionicus" a new propionate oxidizing species of anaerobic ammonium oxidizing bacteria. Systematic and Applied Microbiology, 30, 39-49. 56 Kartal, B.; Van Niftrik, L.; Rattray, J.; Van De Vossenberg, J. L. C. M.; Schmid, M. C.; Sinninghe Damsté, J.; Jetten, M. S. M.; Strous, M. (2008) Candidatus ‘Brocadia fulgida': an autofluorescent anaerobic ammonium oxidizing bacterium. FEMS Microbiology Ecology, 63, 46-55. Kieling, D. D.; Reginatto, V.; Schmidell, W.; Travers, D.; Menes, R. J.; Soares, H. M. (2007) Sludge wash-out as strategy for Anammox process start-up. Process Biochemistry, 42, 1579-1585. Kindaichi, T.; Ito, T.; Okabe, S. (2004) Ecophysiological Interaction between Nitrifying Bacteria and Heterotrophic Bacteria in Autotrophic Nitrifying Biofilms as Determined by Microautoradiography-Fluorescence In Situ Hybridization. Applied and Environmental Microbiology, 70, 1641-1650. Kindaichi, T.; Tsushima, I.; Ogasawara, Y.; Shimokawa, M.; Ozaki, N.; Satoh, H.; Okabe, S. (2007) In Situ Activity and Spatial Organization of Anaerobic Ammonium- Oxidizing (Anammox) Bacteria in Biofilms. Applied and Environmental Microbiology, 73, 4931-4939. König, E.; Schlesner, H.; Hirsch, P. (1984) Cell wall studies on budding bacteria of the Planctomyces/Pasteuria group and on a Prosthecomicrobium sp. Archives of Microbiology, 138, 200-205. Kuenen, J. G.; Jetten, M. S. M. (2001) Extraordinary anaerobic ammonium-oxidizing bacteria. American Society for Microbiology News, 67, 456-463. Kuenen, J. G. (2008) Anammox bacteria: from discovery to application. Nature Reviews Microbiology, 6, 320-326. Kuypers, M. M. M.; Sliekers, A. O.; Lavik, G.; Schmid, M.; Jorgensen, B. B.; Kuenen, J. G.; Sinninghe Damste, J. S.; Strous, M.; Jetten, M. S. (2003) Anaerobic ammonium oxidation by anammox bacteria in the Black Sea. Nature, 422, 608-611. Kuypers, M. M. M.; Lavik, G.; Woebken, D.; Schmid, M.; Fuchs, B. M.; Amann, R.; Jørgensen, B. B.; Jetten, M. S. M. (2005) Massive nitrogen loss from the Benguela upwelling system through anaerobic ammonium oxidation. Proceedings of the National Academy of Sciences of the United States of America, 102, 6478-6483. Lackner, S.; Terada, A.; Smets, B. F. (2008) Heterotrophic activity compromises autotrophic nitrogen removal in membrane-aerated biofilms: results of a modeling study. Water Research, 42, 1102-1112. Li, A. S., Guoping; Xu, Meiying. (2008) Recent Patents on Anammox Process. Recent Patents on Engineering, 2, 189-194. Liesack, W.; König, H.; Schlesner, H.; Hirsch, P. (1986) Chemical composition of the peptidoglycan-free cell envelopes of budding bacteria of the Pirella/Planctomyces group. Archives of Microbiology, 145, 361-366. 57 Lindsay, M.; Webb, R.; Strous, M.; Jetten, M.; Butler, M.; Forde, R.; Fuerst, J. (2001) Cell compartmentalisation in planctomycetes: novel types of structural organisation for the bacterial cell. Archives of Microbiology, 175, 413-429. López, H.; Puig, S.; Ganigué, R.; Ruscalleda, M.; Balaguer, M. D.; Colprim, J. (2008) Start-up and enrichment of a granular anammox SBR to treat high nitrogen load wastewaters. Journal of Chemical Technology and Biotechnology, 83, 233-241. Metcalf and Eddy. (2003) Wastewater engineering : treatment and reuse. 4th ed. McGraw-Hill: Boston. Mohan, S. B.; Schmid, M.; Jetten, M.; Cole, J. (2004) Detection and widespread distribution of the nrfA gene encoding nitrite reduction to ammonia, a short circuit in the biological nitrogen cycle that competes with denitrification. FEMS Microbiology Ecology, 49, 433-443. Mulder, A.; van de Graaf, A. A.; Robertson, L. A.; Kuenen, J. G. (1995) Anaerobic ammonium oxidation discovered in a denitrifying fluidized bed reactor. FEMS Microbiology Ecology, 16, 177-184. Nielsen, M.; Bollmann, A.; Sliekers, O.; Jetten, M.; Schmid, M.; Strous, M.; Schmidt, I.; Larsen, L. H.; Nielsen, L. P.; Revsbech, N. P. (2005) Kinetics, diffusional limitation and microscale distribution of chemistry and organisms in a CANON reactor. FEMS Microbiology Ecology, 51, 247-256. Otawa, K.; Asano, R.; Ohba, Y.; Sasaki, T.; Kawamura, E.; Koyama, F.; Nakamura, S.; Nakai, Y. (2006) Molecular analysis of ammonia-oxidizing bacteria community in intermittent aeration sequencing batch reactors used for animal wastewater treatment. Environmental Microbiology, 8, 1985-1996. Paredes, D.; Kuschk, P.; Köser, H. (2007) Influence of Plants and Organic Matter on the Nitrogen Removal in Laboratory-Scale Model Subsurface Flow Constructed Wetlands Inoculated with Anaerobic Ammonium Oxidizing Bacteria. Engineering in Life Sciences, 7, 565-576. Park, H.; Rosenthal, A.; Jezek, R.; Ramalingam, K.; Fillos, J.; Chandran, K. (2010) Impact of inocula and growth mode on the molecular microbial ecology of anaerobic ammonia oxidation (anammox) bioreactor communities. Water Research, 44, 5005-5013. Ping, Z. (2009) Characterization and classification of anaerobic ammonium oxidation (anammox) bacteria. Zhe Jiang Da Xue Xue Bao (Nong Ye Yu Sheng Ming Ke Xue Ban ), 35, 473-481. Pynaert, K.; Smets, B. F.; Wyffels, S.; Beheydt, D.; Siciliano, S. D.; Verstraete, W. (2003) Characterization of an Autotrophic Nitrogen-Removing Biofilm from a Highly Loaded Lab-Scale Rotating Biological Contactor. Applied and Environmental Microbiology, 69, 3626-3635. 58 Quan, Z.-X.; Rhee, S.-K.; Zuo, J.-E.; Yang, Y.; Bae, J.-W.; Park, J. R.; Lee, S.-T.; Park, Y.-H. (2008) Diversity of ammonium-oxidizing bacteria in a granular sludge anaerobic ammonium-oxidizing (anammox) reactor. Environmental Microbiology, 10, 3130-3139. Racz, L.; Datta, T.; Goel, R. K. (2010) Organic carbon effect on nitrifying bacteria in a mixed culture. Water Science and Technology, 61, 2951-2956. Rich, J. J.; Dale, O. R.; Song, B.; Ward, B. B. (2008) Anaerobic ammonium oxidation (anammox) in Chesapeake Bay sediments. Microbial Ecology, 55, 311-320. Risgaard-Petersen, N.; Nielsen, L. P.; Rysgaard, S.; Dalsgaard, T.; Meyer, R. L. (2003) Application of the isotope pairing technique in sediments where anammox and denitrification coexist. Limnology and Oceanography: Methods, 1, 63-73. Ruscalleda, M.; Lopez, H.; Ganigue, R.; Puig, S.; Balaguer, M. D.; Colprim, J. (2008) Heterotrophic denitrification on granular anammox SBR treating urban landfill leachate. Water Science and Technology, 58, 1749-1755. Rysgaard, S.; Risgaard-Petersen, N.; Sloth, N. P. (1996) Nitrification, denitrification, and nitrate ammonification in sediments of two coastal lagoons in Southern France. Hydrobiologia, 329, 133-141. Rysgaard, S. r.; Glud, R. N. h.; Risgaard-Petersen, N.; Dalsgaard, T. (2004) Denitrification and Anammox Activity in Arctic Marine Sediments. Limnology and Oceanography, 49, 1493-1502. Schalk, J.; de Vries, S.; Kuenen, J. G.; Jetten, M. S. M. (2000) Involvement of a Novel Hydroxylamine Oxidoreductase in Anaerobic Ammonium Oxidation. Biochemistry, 39, 5405-5412. Schmid, M.; Twachtmann, U.; Klein, M.; Strous, M.; Juretschko, S.; Jetten, M.; Metzger, J. W.; Schleifer, K. H.; Wagner, M. (2000) Molecular evidence for genus level diversity of bacteria capable of catalyzing anaerobic ammonium oxidation. Systematic and Applied Microbiology, 23, 93-106. Schmid, M.; Walsh, K.; Webb, R.; Rijpstra, W. I.; van de Pas-Schoonen, K.; Verbruggen, M. J.; Hill, T.; Moffett, B.; Fuerst, J.; Schouten, S.; Damste, J. S.; Harris, J.; Shaw, P.; Jetten, M.; Strous, M. (2003) Candidatus "Scalindua brodae", sp. nov., Candidatus "Scalindua wagneri", sp. nov., two new species of anaerobic ammonium oxidizing bacteria. Systematic and Applied Microbiology, 26, 529-538. Schmid, M. C.; Maas, B.; Dapena, A.; van de Pas-Schoonen, K.; van de Vossenberg, J.; Kartal, B.; van Niftrik, L.; Schmidt, I.; Cirpus, I.; Kuenen, J. G.; Wagner, M.; Sinninghe Damste, J. S.; Kuypers, M.; Revsbech, N. P.; Mendez, R.; Jetten, M. S.; Strous, M. (2005) Biomarkers for in situ detection of anaerobic ammonium-oxidizing (anammox) bacteria. Applied and Environmental Microbiology, 71, 1677-1684. 59 Schmid, M. C.; Risgaard-Petersen, N.; Van De Vossenberg, J.; Kuypers, M. M. M.; Lavik, G.; Petersen, J.; Hulth, S.; Thamdrup, B.; Canfield, D.; Dalsgaard, T.; Rysgaard, S.; Sejr, M. K.; Strous, M.; Op den Camp, H. J. M.; Jetten, M. S. M. (2007) Anaerobic ammonium-oxidizing bacteria in marine environments: widespread occurrence but low diversity. Environmental Microbiology, 9, 1476-1484. Schmidt, I.; Sliekers, O.; Schmid, M.; Cirpus, I.; Strous, M.; Bock, E.; Kuenen, J. G.; Jetten, M. S. M. (2002) Aerobic and anaerobic ammonia oxidizing bacteria - competitors or natural partners? FEMS Microbiology Ecology, 39, 175-181. Schmidt, I.; Sliekers, O.; Schmid, M.; Bock, E.; Fuerst, J.; Kuenen, J. G.; Jetten, M. S. M.; Strous, M. (2003) New concepts of microbial treatment processes for the nitrogen removal in wastewater. FEMS Microbiology Reviews, 27, 481-492. Schubert, C. J.; Durisch-Kaiser, E.; Wehrli, B.; Thamdrup, B.; Lam, P.; Kuypers, M. M. (2006) Anaerobic ammonium oxidation in a tropical freshwater system (Lake Tanganyika). Environmental Microbiology, 8, 1857-1863. Shimamura, M.; Nishiyama, T.; Shigetomo, H.; Toyomoto, T.; Kawahara, Y.; Furukawa, K.; Fujii, T. (2007) Isolation of a multiheme protein with features of a hydrazine-oxidizing enzyme from an anaerobic ammonium-oxidizing enrichment culture. Applied and Environmental Microbiology, 73, 1065-1072. Shuler, M. L.; Kargi, F. (2002) Bioprocess engineering. Prentice Hall: Upper Saddle River, NJ. Sinninghe Damste, J. S.; Strous, M.; Rijpstra, W. I. C.; Hopmans, E. C.; Geenevasen, J. A. J.; van Duin, A. C. T.; van Niftrik, L. A.; Jetten, M. S. M. (2002) Linearly concatenated cyclobutane lipids form a dense bacterial membrane. Nature, 419, 708-712. Sinninghe Damste, J. S.; Rijpstra, W. I.; Geenevasen, J. A.; Strous, M.; Jetten, M. S. (2005) Structural identification of ladderane and other membrane lipids of planctomycetes capable of anaerobic ammonium oxidation (anammox). FEBS Journal, 272, 4270-4283. Sliekers, A. O.; Third, K. A.; Abma, W.; Kuenen, J. G.; Jetten, M. S. (2003) CANON and Anammox in a gas-lift reactor. FEMS Microbiology Letters, 218, 339-344. Strous, M.; Van Gerven, E.; Zheng, P.; Kuenen, J. G.; Jetten, M. S. M. (1997a) Ammonium removal from concentrated waste streams with the anaerobic ammonium oxidation (Anammox) process in different reactor configurations. Water Research, 31, 1955-1962. Strous, M.; Van Gerven, E.; Kuenen, J. G.; Jetten, M. (1997b) Effects of aerobic and microaerobic conditions on anaerobic ammonium-oxidizing (anammox) sludge. Applied and Environmental Microbiology, 63, 2446-2448. 60 Strous, M.; Heijnen, J. J.; Kuenen, J. G.; Jetten, M. S. M. (1998) The sequencing batch reactor as a powerful tool for the study of slowly growing anaerobic ammonium-oxidizing microorganisms. Applied Microbiology and Biotechnology, 50, 589-596. Strous, M.; Kuenen, J. G.; Jetten, M. S. (1999a) Key physiology of anaerobic ammonium oxidation. Applied and Environmental Microbiology, 65, 3248-3250. Strous, M.; Fuerst, J. A.; Kramer, E. H. M.; Logemann, S.; Muyzer, G.; van de Pas- Schoonen, K. T.; Webb, R.; Kuenen, J. G.; Jetten, M. S. M. (1999b) Missing lithotroph identified as new planctomycete. Nature, 400, 446-449. Strous, M.; Jetten, M. S. (2004) Anaerobic oxidation of methane and ammonium. Annual Review of Microbiology, 58, 99-117. Strous, M.; Pelletier, E.; Mangenot, S.; Rattei, T.; Lehner, A.; Taylor, M. W.; Horn, M.; Daims, H.; Bartol-Mavel, D.; Wincker, P.; Barbe, V.; Fonknechten, N.; Vallenet, D.; Segurens, B.; Schenowitz-Truong, C.; Medigue, C.; Collingro, A.; Snel, B.; Dutilh, B. E.; Op den Camp, H. J.; van der Drift, C.; Cirpus, I.; van de Pas-Schoonen, K. T.; Harhangi, H. R.; van Niftrik, L.; Schmid, M.; Keltjens, J.; van de Vossenberg, J.; Kartal, B.; Meier, H.; Frishman, D.; Huynen, M. A.; Mewes, H. W.; Weissenbach, J.; Jetten, M. S.; Wagner, M.; Le Paslier, D. (2006) Deciphering the evolution and metabolism of an anammox bacterium from a community genome. Nature, 440, 790-794. Tal, Y.; Watts, J. E. M.; Schreier, S. B.; Sowers, K. R.; Schreier, H. J. (2003) Characterization of the microbial community and nitrogen transformation processes associated with moving bed bioreactors in a closed recirculated mariculture system. Aquaculture, 215, 187-202. Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Molecular Biology and Evolution, 24, 1596-1599. Thamdrup, B.; Dalsgaard, T. (2002) Production of N2 through anaerobic ammonium oxidation coupled to nitrate reduction in marine sediments. Applied and Environmental Microbiology, 68, 1312-1318. Third, K. A.; Paxman, J.; Schmid, M.; Strous, M.; Jetten, M. S.; Cord-Ruwisch, R. (2005) Enrichment of anammox from activated sludge and its application in the CANON process. Microbial Ecology, 49, 236-244. Toh; Ashbolt. (2002) Adaptation of anaerobic ammonium-oxidising consortium to synthetic coke-ovens wastewater. Applied Microbiology and Biotechnology, 59, 344-352. Trigo, C.; Campos, J. L.; Garrido, J. M.; Mendez, R. (2006) Start-up of the Anammox process in a membrane bioreactor. Journal of Biotechnology, 126, 475-487. 61 Trimmer, M.; Nicholls, J. C.; Deflandre, B. (2003) Anaerobic Ammonium Oxidation Measured in Sediments along the Thames Estuary, United Kingdom. Applied and Environmental Microbiology, 69, 6447-6454. Tsushima, I.; Ogasawara, Y.; Kindaichi, T.; Satoh, H.; Okabe, S. (2007a) Development of high-rate anaerobic ammonium-oxidizing (anammox) biofilm reactors. Water Research, 41, 1623-1634. Tsushima, I.; Kindaichi, T.; Okabe, S. (2007b) Quantification of anaerobic ammonium-oxidizing bacteria in enrichment cultures by real-time PCR. Water Research, 41, 785- 794. van de Graaf, A. A.; Mulder, A.; de Bruijn, P.; Jetten, M. S.; Robertson, L. A.; Kuenen, J. G. (1995) Anaerobic oxidation of ammonium is a biologically mediated process. Applied and Environmental Microbiology, 61, 1246-1251. van de Graaf, A. A.; de Bruijn, P.; Robertson, L. A.; Jetten, M. S. M.; Kuenen, J. G. (1996) Autotrophic growth of anaerobic ammonium-oxidizing micro-organisms in a fluidized bed reactor. Microbiology, 142, 2187-2196. van de Graaf, A. A.; de Bruijn, P.; Robertson, L. A.; Jetten, M. S. M.; Kuenen, J. G. (1997) Metabolic pathway of anaerobic ammonium oxidation on the basis of 15N studies in a fluidized bed reactor. Microbiology, 143, 2415-2421. van der Star, W. R. L.; Abma, W. R.; Blommers, D.; Mulder, J. W.; Tokutomi, T.; Strous, M.; Picioreanu, C.; Van Loosdrecht, M. C. M. (2007) Startup of reactors for anoxic ammonium oxidation: Experiences from the first full-scale anammox reactor in Rotterdam. Water Research, 41, 4149-4163. van Dongen, U.; Jetten, M. S.; van Loosdrecht, M. C. (2001) The SHARON-Anammox process for treatment of ammonium rich wastewater. Water Science and Technology, 44, 153-160. van Niftrik, L.; Geerts, W. J.; van Donselaar, E. G.; Humbel, B. M.; Yakushevska, A.; Verkleij, A. J.; Jetten, M. S.; Strous, M. (2008a) Combined structural and chemical analysis of the anammoxosome: a membrane-bounded intracytoplasmic compartment in anammox bacteria. Journal of Structural Biology, 161, 401-410. van Niftrik, L.; Geerts, W. J. C.; van Donselaar, E. G.; Humbel, B. M.; Webb, R. I.; Fuerst, J. A.; Verkleij, A. J.; Jetten, M. S. M.; Strous, M. (2008b) Linking Ultrastructure and Function in Four Genera of Anaerobic Ammonium-Oxidizing Bacteria: Cell Plan, Glycogen Storage, and Localization of Cytochrome c Proteins. Journal of Bacteriology, 190, 708-717. Vazquez-Padin, J. R.; Fernadez, I.; Figueroa, M.; Mosquera-Corral, A.; Campos, J. L.; Mendez, R. (2009a) Applications of Anammox based processes to treat anaerobic digester supernatant at room temperature. Bioresource Technology, 100, 2988-2994. 62 Vazquez-Padin, J. R.; Pozo, M. J.; Jarpa, M.; Figueroa, M.; Franco, A.; Mosquera-Corral, A.; Campos, J. L.; Mendez, R. (2009b) Treatment of anaerobic sludge digester effluents by the CANON process in an air pulsing SBR. Journal of Hazardous Materials, 166, 336-341. Wett, B. (2007) Development and implementation of a robust deammonification process. Water Science and Technology, 56, 81-88. Wiesmann, U. (1994) Biological nitrogen removal from wastewater, Biotechnics/Wastewater. Springer Berlin / Heidelberg, pp. 113-154. Wilsenach, J. A.; van Loosdrecht, M. C. M. (2006) Integration of Processes to Treat Wastewater and Source-Separated Urine. Journal of Environmental Engineering, 132, 331-341. Zhang, S.-h.; Zheng, P.; Hua, Y.-m. (2005) Nitrogen removal from sludge dewatering effluent through anaerobic ammonia oxidation process. Journal of Environmental Sciences, 17, 1030-1033. Zheng, P.; Lin, F. M.; Hu, B. L.; Chen, J. S. (2004) Performance of Anammox granular sludge bed reactor started up with nitrifying granular sludge. Journal of Environmental Sciences (China), 16, 339-342.