Linking synaptotagmin to vesicle fusion

Synaptotagmin 1 is an integral synaptic vesicle protein and is believed to be the major calcium sensor in synaptic vesicle fusion. Loss of synaptotagmin 1 from the nematode C. elegans results in an uncoordinated phenotype and decreased levels of neurotransmitter release. Synaptotagmin consists of two calcium/lipid binding C2 domains (C2A and C2B) separated by a short flexible linker (12 AA). While the role of the C2 domains has been extensively studied, the role of the short linker domain between them has not. It has been proposed that the linker sequence may be important in interacting with the SNAREs and with positioning the C2 domains in relation to each other and the SNARE complex. We explore two models for the role of the linker domain. 1) The sequence of the linker is important for function. To test the effects of the linker sequence the sequence was replaced with a flexible sequence consisting of repeats of glycine-glycine-serine (GGS). 2) The length of the linker is critical for its function. To test the effects of increasing the length of this linker domain the sequence was repeated, doubling the length. Initial results show partial rescue of endocytosis and exocytosis function for the flexible and double linker constructs. This suggests the sequence and length of the linker is important, but not vital, for synaptotagmin function. The next step is to determine whether endocytosis or exocytosis is being affected by these mutations.

LINKING SYNAPTOTAGMIN TO VESICLE FUSION by Nathaniel Morris Barusch A Senior Honors Thesis Submitted to the Faculty of The University of Utah In partial Fulfillment of the Requirements for the Honors Degree of Bachelor of Arts In Biology �'�h� �D"� Approved: ,d;?U Darryl Kropf Robert Hobson (For Erik Jorgensen) Supervisor Departmental Honors Adviser Martha S. Bradley Neil Vickers Director Honors program Chair of the department of Biology ��00 May 2009 II To my grandfather, grandfather, whose love of of science has rubbed offon off on me fo r 22 years and count ing And to my parents, who have tolerated me for counting Thanks to Robert Hobson, Hobso n, Erik Jorgensen, and the rest of of the Jorgense Jorgensenn lab III Ill Abstract Synaptotagmin Synaptotagmin 1 is an integral synaptic vesicle protein and is believed to be the major synaptotagmin 1 from from the major calcium sensor in synaptic vesicle fusion. Loss of ofsynaptotagmin nematode C. C. elegans of elegans results in an uncoordinated phenotype and decreased levels of neurotransmitter neurotransmitter release. Synaptotagmin consists of calcium/lipid binding C2 domains (C2A and C2B) Synaptotagmin of two calcium/lipid separated by a short flexible linker (12 AA). While the role of of the C2 domains has been extensively studied, the role of the short linker domain between them has not. It has been ofthe extensively proposed that the linker sequence may be important important in interacting with the SNAREs and with positioning the C2 domains in relation to each other and the SNARE complex. We explore two models for the role of of the linker domain. 1) The sequence of of the linker is important important for function. To test the effects effects of of the linker sequence the sequence was replaced of repeats of of glycine-glycine-serine glycine-glycine-serine (GGS). replaced with a flexible sequence consisting of 2) The length of of the linker is critical for its function. To test the effects effects of of increasing the of this linker domain the sequence was repeated, doubling the length. Initial length of t1exible and results show partial rescue of of endocytosis and exocytosis function for the flexible of the linker is double linker constructs. This suggests the sequence and length of important, but not vital, for tor synaptotagmin synaptotagmin function. The next step is to determine whether endocytosis or exocytosis is being affected affected by these mutations. whether IV IV Table of of Contents Background _ _ _ _ _ _ _ _ __ _ _ _ _ _ _ _ _ _ _ _ 5 14 Methods Methods . • ' " " Results _ _ _ __ _ _ _ _ _ _ _ _ _ _ _ _ _ __ _ _ 24 Results ____ . — " Discussion _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _~28 28 Discussion ., Wo rks Cited _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ __ Works 1 Background Neurons communicate with each other rapidly via action potentials. A signal, either inhibitory or excitatory, is received at the dendrites and passed along to the soma of the dendritic signals (which could come from from (cell body). At the soma the sum of of different different dendrites) results in an all-or-nothing response. If If the signal is thousands of sufficient an action potential travels down the axon to the synapse. At the synapse the sufficient of neurotransmitter neurotransmitter electrical signal must be converted into a chemical signal in the form of release. Neurotransmitters are released from synaptic vesicles through the cell membrane, diffuse diffuse across the synapse, and bind receptors on the dendrites of of the next cell (1). (i). In order to control complex behavior, and to respond quickly to a stimulus, the process of of cell-to-cell communication communication must be very rapid. The transmission of of an action potential from once cell to the next takes about a millisecond (2). For rapid signal transfer transfer to occur the neuron must be able to turn the electric action potential into release of the chemical neurotransmitter quickly. of quickly, synaptotagmin synaptotagmin 1 is one of of the proteins invo lved in this rapid process. involved At rest, a neuron maintains a potential of mY. This is accomplished by of about -70 mV. 2 pumping positive ions such as Na t and Ca of the cell. When an action potential C a + out of + 2+ reaches an axon, voltage-dependent voltage-dependent calcium channels open, depolarizing the cell, which in tum intracellular calcium triggers turn opens more calcium channels (3). At the synapse intracellular the release of of neurotransmitters. This process is extremely rapid, with synaptic vesicles after calcium influx influx (4). Synaptic vesicle fusion is dependent fusing less than 0.1 msec after on the SNARE proteins (soluble N-ethylmaleimide sensitive factor attachment receptor). 2 (4). However, other components are required to confer confer calcium sensitivity to synaptic calcium sensitivity vesicle fusion. Synaptotagmin Synaptotagmin 1 is believed to be this calcium sensor (5). Synaptotagmin Synaptotagmin 1 is a synaptic vesicle protein consisting of of a short N-terminal transmembrane domain followed followed by a soluble flexible 'linker' and two calcium/lipid binding C2 domains (C2A and C2B) separated by a short flexible linker (See figure 1). The C2 domains adopt a beta sandwich structure in which five conserved aspartate residues bind three Ca C a2+ atoms in C2A and 2 C Caa2+ atoms in C2B. (See figure 2) Calcium 2+ 2+ stimulates binding of of synaptotagmin to the SNARE complex as well of the C2 domains ofsynaptotagmin as partial penetration of the plasma membrane (5). It is synaptotagmin's synaptotagmin's binding and penetration of penetration of fusion penetration of the plasma membrane and the SNAREs that is proposed proposed to stimulate fusion of the synaptic vesicle with the plasma membrane upon calcium influx of influx (6). Previous studies have focused synaptotagmin and in calcium and focused on the roles of of the C2 domains of of synaptotagmin lipid binding and have revealed an essential function of these domains in the calcium function of sensitivity of of synaptic vesicle exocytosis. However, little is known about the roles of of the linker linking the transmembrane domain to the C2 domains and the linker sequence between of synaptotagmin. between the C2 domains of The synaptotagmin synaptotagmin fami ly is known to have 15 isoforms in mammals, (14) seven family Drosophila. (15) and 6 in C. elegans elegans (13). The most conserved of of the synaptotagmin in Drosophila, isoforms is synaptotagmin-l synaptotagmin-1 (16). Synaptotagmin-l Synaptotagmin-1 facilitates synaptic transmission (17) isoforms although transmission continues at reduced levels in synaptotagmin-l synaptotagmin-1 knockouts ((18). although 18). Synaptotagmin has been suggested Synaptotagmin suggested to serve four functions: 1) It docks synaptic vesicles at the synapse, 2) it facilitates rapid release of of neurotransmitters into the synapse, 3) it 3 serves as the Ca2+ te, and 4) it is involved in endocytosis of synaptic vesicles Ca2 binding si site, endocytosis of + (19). (19). synapfic vesIcle synaptotagmln Figure 11 ofSynaptotagmin el al. (33). Basic structure of Synaptotagmin 1 adapted from from Georgiev et QuckTime™ and a 0.0<:1; .."" .. ..... decompressor dKOmll<"_ •are •• needed _ •• to ,ooq ,... picture pOOl.", see. this Figure 2 Calcium is bound at 3 sites in the C2A by aspartate residues Calciwn residues and at al 2.2 sites C2B. al. si tes in C2 B. Adapted from from Fernandez-Chacon, Fernandez-Chacon. R., R.o et al. 1 Synaptotagmin ' s broad phylogenetic (found in animals from Synaptoragmin phylogenetic distribution distributio n (found nematodes to ma mmal s) and relatively relatively co nserved nature provides evidence of mammals) conserved of early almost universally in animals evolution of fo und almost an imal s with neurons. The evolut ion of evolution. It is found 4 synaptotagmin and its associated proteins may have been one of synaptotagmin of the original evolutionary communication as a separate form of of extra-cellular extra-cellular events that led to neural communication communication. In all its forms it maintains the following characteristics: one transtrans­ membrane span, short luminal domains, and a long cytoplasmic region containing two calcium binding C2 domains connected by a short linker. (23). Synaptotagmin-I is likely to be involved in synchronous neurotransmitter neurotransmitter release of vesicles fuse in the wild in mice. When a neuron receives a stimulus an equal number of type and in mutants lacking synaptotagmin-1 differ synaptotagmin-I (null mutants). Where null mutants differ from from the wild type is their inability to release the neurotransmitter neurotransmitter as synchronously as wild-type animals. This suggests that there is a calcium sensitive mechanism mechanism for asynchronously synaptotagmin-l. asynchronously releasing neurotransmitters neurotransmitters that is not dependent on synaptotagmin-1. This hypothesis is supported fact that loss of from mouse neurons supported by the fuct of synaptotagmin 1 from of neurotransmitter results in the loss of of fast synchronous component of neurotransmitter release, without of release or the size of affecting asynchronous component component of affecting of the vesicle pool (7). Furthermore asynchronous release must be inhibited in the presence of of synaptotagmin since its rates rise in null mutants to a degree that compensates for the loss of of synaptotagmin activity (20). synaptotagmin Synaptotagmin may also inhibit spontaneous release of Synaptotagmin of neurotransmitters neurotransmitters by of the synaptic vesicle to the plasma membrane. Spontaneous rates are preventing fusion of elevated in Drosophila Drosophila knockouts. Synaptotagmin Synaptotagmin may be involved in stabilizing the docked state of of a neurotransmitter neurotransmitter along the cell membrane. An electron microscopy synaptotagmin 1I null mutants in Drosophila Drosophila showed a reduction in the number study of ofsynaptotagmin of docked synaptic vesicles at the synapse than is seen in wild-type animals (21). of (21 ). 5 In addition to synaptotagmin' synaptotagmin'ss role in exocytosis there is strong evidence that synaptotagmin is also involved in endocytosis. Jorgensen Jorgensen showed that in synaptotagmin synaptotagmin knockouts synaptic vesicles are depleted depleted in C. C. elegans elegans (34). This depletion is not due to increased synaptic vesicle release or decreased transport to the synapse. Instead it appears to be due to decreased decreased levels of of retrieval of of synaptic vesicles from from the plasma membrane (34). (34). This suggests that synaptotagmin functioning synaptic is vital vital to to synaptic membrane This suggests that proper proper synaptotagmin functioning is vesicle endocytosis. vesicle recycling recycling via via endocytosis. fo Howing model of function (19). Loewen propose the following of synaptotagmin synaptotagmin function Synaptotagmin Synaptotagmin I1 docks synaptic vesicles to the neuron's release site by interacting with SNAREs (19). This interaction is not dependent on Ca2 Ca2+.. The docking interaction + primes the vesicle so when synaptotagmin synaptotagmin binds Ca2 Ca2+ it can position its Ca2 Ca2" active site + + adjacent to the membrane, minimizing the time required between Cat adjacent Ca2 binding and + neurotransmitter release. The protein is repelled by the membrane until Ca2 Ca2+ binds to neurotransmitter + synaptotagmin calcium has bound synaptotagmin synaptotagmin the protein is no longer synaptotagmin 1. Once calcium repelled by the negatively charged membrane, allowing the C2 domains to penetrate the penetration results in local induction of membrane (19). The penetration of positive membrane curvature. The membrane buckles up beneath the SNARE complex and comes into close proximity to the synaptic vesicle. The positive curvature reduces the activation energy Synaptotagmin's affinity necessary for the two membranes to fuse (6). Synaptotagmin's affinity for calcium goes further evidence that up significantly significantly in the presence of of phospholipids, providing further between the basic phospholipid binding involves changes in the electrostatic interactions between phospholipid residues and the phospholipids phospho lipids ((12). 12). 6 of synaptotagmin function proposes it may work with An alternative model of synaptotagmin mnction Complexin to inhibit neurotransmitter neurotransmitter release until calcium is present. Complexin may be an inhibitory protein that synaptotagmin synaptotagmin 1 deactivates. It has been proposed that complexin binds to a fully assembled SNARE complex, holding it in a pre-fusion pre-fusion state. Vesicle fusion is only possible when complexin releases the SNARE complex (see figure figure 3). Synaptotagmin would to induce induce complexin's release of of the the 3). Synaptotagmin would be be the the best best candidate candidate to complexin's release SNARE complex. complex. Synaptotagmin Synaptotagmin has for the SNARE bonding than SNARE has aa higher higher affinity affinity for the SNARE bonding site site than + complexin under salt conditions in the (9). Several Several complexin under physiological physiological salt conditions in the presence presence of of Ca2 Ca2 + (9). studies have have supported supported this cause studies this model model (10) (10) (11). (11). However However synaptotagmin synaptotagmin may may not not cause complete dissociation dissociation of complexin from SNARE complex. complex. Synaptotagmin Synaptotagmin has been complete of complexin from the the SNARE has been shown to to induce (9). It It is these to require require complexin complexin to induce neurotransmitter neurotransmitter release release (9). is likely likely that that these shown two proteins stimulate fusion. fusion. The The linker segment of of synaptotagmin synaptotagmin 11 may may two proteins interact interact to to stimulate linker segment play crucial role process. playaa crucial role in in this this process. While synaptotagmin I (snt 1) may be the best understood of the understood member of synaptotagmin family, there are many other synaptotagmins. One of synaptotagmin of the most common is synaptotagmin synaptotagmin VII (snt VII). Like snt I, snt VII is a calcium sensor controlling exocytosis. snt VII has a broader broader tissue distribution than snt 1.I. snt VII occurs in the lysosomes of of kidney, pancreas, heart, lung, and spleen tissue (24), while snt I occurs only in the neurons, neurons. snt VII is also found in insulin-secreting insulin-secreting granules of of the pancreas (25). Like snt I, snt VII induces exocytosis as a response to a calcium calcium influx, and it appears to bind to SNAREs to do so. snt VII has an affinity affinity for calcium that is approximately approximately ten I. This increased increased sensitivity to calcium means synaptotagmin times greater than snt 1. function function is activated at much lower calcium concentrations. Additionally, the 7 dissociation ofcaJcium meaning the protein is active for a of calcium from snt VII is much slower, slower, meaning longer period (23). , .--....,... . . .-- "", ... ~ ==- -- , Figure 3 The proposed "clamp release" mechanism ofsynaplotagmin's of synaptotagmin's interaction with 1lle complex !n. A) Synaptic vesicle dock's at the synaptic stimulating the complexin. synaptic membrane, stimulating complexin-SNARE to assemble assemble B) Synaplotagmin Synaptotagmin binds the complex complexin-Snare in-Snare complex in-SNARE complexes 10 of calc calcium, Ca2 influx ium. inhibiting inhibiting docking docki ng C) Ca2' influx causes complex in the absence of synaptotagmin 10 to release complexin complexin and membrane fusion lusion occurs (9). Reprinted from synaplotagmin al, 2005. McNew et ai, + of the While synaptotagmin I (snt 1) I) may be the best understood member member of of the most co common synaptotagmin family, fami ly. there are many other synaptotagmins. One of mmon is synaptotagmin VII). sensor controlling syna ptotagmin VII (snt VII ). Like ssnt nt I.I, snt VII VI I is a calcium sensor snt VII has a broader tissue distribution than ssnt exocytosis. sm nt I. snt VII V[J occurs in the lysosomes of kidney, pancreas, heart, lung, and spleen tissue (24), while snt I occurs only Iysoso mes of pancreas. heart. in the neurons. neurons, sm snt VII is also found in insulin-secreting insulin-secreting granules of the pancreas (25). granules orthe snt I. I, snt VII induces exocytosis as a response to a calcium Like Silt ca lcium influx, influx. and it appears to so. snt VII has an affinity approximately ten bind to SNAREs to do so. aflinity for fo r calcium that is approximately 8 times greater than snt 1. calcium means synaptotagmin I. This increased sensitivity to calcium synaptotagmin function is activated at much lower calcium concentrations. Additionally, the function of calcium from snt VII is much slower, meaning the protein is active for a dissociation of longer period (23). potential application involves synaptotagmin's synaptotagmin's role in One particularly relevant potential muscle tissue. Insulin regulates blood glucose levels by stimulating fat and muscle transported into tissues to absorb glucose from the blood in its presence. Glucose is transported muscle tissue by GLUT4. GLUT4 is stored in intracellular intracellular vesicles, which are brought + into contact with the plasma membrane after after insulin-receptor insulin-receptor activation. Ca2+ Ca2 plays an important important role in this process although the exact mechanism mechanism is not known. It is believed synaptotagmin VII is involved in this process (26). When this insulin-dependent that synaptotagmin insulin-dependent of synaptotagmin pathway is disturbed disturbed diabetes occurs. A better knowledge of synaptotagmin will help determine whether its function function contributes to diabetes. Advantages of of C. C e/egans elegans elegans an ideal model for our study ofsynaptotagmin's Several features make C. elegans of synaptotagmin's of linker. First, it has a simple nervous system that is easily studied using a variety of assays detailed below. Second, the animals can survive with a severely compromised nervous systems, which allows the study of of the role of of a mutation that may be lethal in more complex organisms. Third, it is possible to inject inject DNA into the gonad of of a hermaphrodite causing the offspring injected DNA array. Fourth, because offspring to express the injected so much research has been done on C. C. elegans elegans the genome is well understood and many 9 usefully usefully mutations exist; in the case of of our research the synaptotagmin-null synaptotagmin-null mutant md290 md290 was used. Finally, genetics is made easier by the fact that the two genders of of C. elegans elegans are hermaphrodite and male. This makes maintaining mutants with severely compromised compromised nervous systems simple since the mutants can fertilize themselves. Models Previous studies of of synaptotagmin function function largely ignored the function function of of the linker region between the C2 domains but the region is highly conserved in mammal and nematode synaptotagmins suggesting evolution did not favor mutations to this sequence. To examine the role of of the role of of the of these domains we tested two possible models of linker. The Flexible Linker Model: The physical properties of of the linker segment functioning of segment are important to the functioning Synaptotagmin ofSynaptotagmin Synaptotagmin 1. The conserved sequence of Synaptotagmin 1 is DIAPPPDDKEAE. The aspartic acid and glutamic acid residues give the sequence a negative charge, which influence on the electrostatic interactions between the protein and lipid could have an influence of three prolines is extremely stiff. Changing membrane. More importantly the series of this sequence to the flexible glycine serine sequence GGSGGSGGSGGS GGSGGSGGSGGS should change the electrostatics and inhibit protein function. Glycine's small size allows for easy rotation while serine's hydroxy group makes the sequence soluble. Increasing the of the linker may prevent the C2 domains from being oriented in the correct flexibility flexibility of location (see figure 4). 10 le linker model is correct we could expect a flexible construct to If the flexib flexible inhibit cxocytosis mains exocytosis without impairing endocytosis since the positioning of of the C2 do domains hese results would ideally present is not believed to be important to endocytosis. T These inhib ited, and themse lves as punctate GFP at the synapse, which shows endocytosis is not inhibited, themselves decreased levels of ing decreased levels of of thrashing, suggest suggesting of exocytosis. Sy naplOta gmin SN '" \ ~I'~I _ _-=I[::S~==~~~~ ___ P]n m<l P l as m a Memb M e m b rraa ne ne Wi ld Type Wild Type Flexible lilinker nker Figure 4 flexible linker model, C2B straddle the SNA SNARE complex, The flexible model. C2A and C28 RE complex. pushing push ing it into the membrane upon Ca2+ fusion. fusion. Lengthening the this linker may hinder th is process. model: The yoke model: The length of ker between the C2 domains ofsynapt otagmin is essential for of the lin linker of synaptotagmin synaptotagmin function. approximatelyy lo long functio n. The linker section is approximatel ng enough to accommodate complex two C2 domains and aalso accommoda te the SNARE co mplex between the twO lso puts put s the residues correct that the C2 domains domains rrect orientation so thai resid ues involved with SNARE binding in the co II 11 lcium stimulation the C2 domains bind the are 'straddling 'straddling'' the SNARE complex. Upon ca calcium SNARE complex and penetrate the lipid bilayer, here the linker between the C2 domains would act as a yoke on the SNAREs, pushing them down into the membrane and if the linker is increased in size this th is would stimulating fusion (see figure 5). Again, if reduce the efficacy efficacy of of the yoke function. It is also possible that the C2A and C28 C2B rest on the same side of of the SNARE comp complex lex rather than straddling it. If If this is the case the of the linker may still be important for proper placement of length of of the two domains. r.... " ' Wild TYr~ ,."", .,,1. CaJ + Double Dnubh.: linker l in k~ r CaJI Figure 5 model: wild type synaptolagmin synaptotagmin straddles the SNARES. SNARES, The yoke mode!: enter the plasma membrane. membrane, upon calcium influx the C2 domains enler down the Ihe SNAREs which draw the synaptic vesicle into the pushing dov.'fJ membrane. A double linker mutant fails faits to draw the SNAREs down on influx, resulting in a failure of of the calcium influx. tbe synaptic vesicle to fuse with the membrane. If the yoke model If mode l is correct we would expect the double linker mutation to fail to SNARES down, and fusion to be inh inhibited. endocytosis. RE S down. ibited. This should not impact t:ndocytos is. draw the SNA The results we would expect for fo r this model are the same as for fo r the flexible linker mutant. 12 The double mutant should rescue endocytosis and not exocytosis. This would present itse lf as punctate GFP and decreased thrashing co mpared to the wild wi ld type itself compared 13 Methods t) Constructing an expression plasmid 1) FP) tagged synaptotagmin-I A) Making a green fluorescent fluorescent protein (G (GFP) synaptotagmin-1 expression vector OUf fir st step was to make a synaptotagmin-l Our first synaptotagmin-1 mutant with a Green Fluorescent Prote in (G FP) marker on the N-terminus. N-tenninus. A synaptotagminProtein (GFP) synaptotagmin-1I template was amplified by PCR, GFP temp template. synaptotagmin-1I and GFP GFP eDNA cDNA were then joined via peR, as was a GFP late. The synaptotagminof DNA that have 15 base an In-Fusion (Clontech) reaction. In-Fusion joins two pieces of of homologous regions at their ends. In-Fusion reagent removes 15 nucleotides pairs of 3 ' end of of eDNA cDNA leaving a 15 base pair 5' overhang. This leaves two from the 3' of DNA that can fuse using their respective 5' end endss (see figure complementary strands orONA 6). QuickTirre 1M and a QuickTime™ decompressor decompressor picture.. are needed to see this picture Figure 6 14 An In-fusion In-fusion reaction joins any linearized linearized peR PCR vector with 15 base pair complementary ends by cutting 15 base pairs off off the 3' end of of the complementary vectors. (35). After the In-Fusion reaction a Gateway (Invitrogen) LR reaction was used to After of expression create an expression clone. Gateway technology allows the rapid creation of of DNA in a single reaction (Figure 8). The clones by combining multiple pieces of Gateway reagent allows the creation of of expression clones, which will express any cDNA Gateway in any tissue we desire in the worm. It does this be combining any promoter, with any of promoters that express in a construct, and a 3' untranslated region. We have a library of variety of of neuron types. In the case of of synaptotagmin-1 pEntry[4-l][Prab-3] synaptotagmin-l we use the pEntry[ 4-1 ][Prab-3] promoter, which expresses in all neurons for the thrashing assays (see below). This is an appropriate promoter because synaptotagmin synaptotagmin is present in all neurons in wild-type animals. For imaging we used pEntry[4-l][Unc-17] which expresses in cholinergic cholinergic neurons only, allowing a clear image of of individual synapses. The promoter is combined with the cDNA from the In-Fusion reaction and unc-54-UTR unc-54-UTR (Untranslated (Untranslated region), which is necessary for the processing of of the RNA. These three plasmids are represented by the three plasmids in Figure 77.. .:rhere There are two possible ways by which the three products can be recombined as shown in the figure. The desired product is selected for in programmed cell death gene while the desired two ways. The by-product includes a programmed product contains an antibiotic resistance gene, allowing it to grow on an antibiotic medium. 15 Prab·3 Prab-3 Unc-54-UTR ~ ~ I n'" .... _ , ....tA -0t4 L i ~\ _ - .~ .. -" Sm-l Snt-1 I ..." ,1000., I'",,, n l n . '--~ I,... It • k \V - '" ... It ~101 put ~I .. M n. »..m' r! \\ M \II~' Prao-3 Prab-3 _ unc-~ "", -UTR unc-54-UTR snr-l snM ~ _ . ! ....! ! It " .'i " • \ j . t f«» <v N • ^ '" , _ Selected ampicil in resista nce Selected for by ampicilin resistance _ 1 M "wv"". ," Selected against by Selected hy ampicillin ampici ll in and lethal eedB ccdB gene Fi gure 7 Figure A Gateway (invilrogen) reaction. Two plasmids combine to form (invitrogen) LR reaction. one expression expression clone. A by-product is eliminated eliminated by a programmed programmed cell death death gene Gateway reoonib 1 I ...7 . ,, ,." re 1092..... "&I 1104 T~'OII'2 .1361 /(at'IfI 248' ... 32$' Gateway Recon*2 2228 Gat-,-1\oocoN:I2 22211 ••.2222 .2222 Figure 8 pRH95 the plasmid plasmid that serves as a template for the tlexible pRH95 flexible and double synaptotagmin mutants. Sites for gateway recombination are linker synaptotagmin shown in red. shm>.TI 16 The Gateway reaction produces a very small amount of of DNA that must be separated from the DNA byproducts. The DNA was amplified amplified by transforming transforming the separated desired plasmid plasmid into competent bacterial cells. The cells take up the plasmid during the transformation of ampicillin transformation process. The bacteria are incubated incubated in the presence of providing a positive selection for the bacterea containing the ampicillin resistance gene. This process stocks from from minimal amounts of After the the of DNA. DNA. After This process produces produces ample ample DNA DNA stocks minimal amounts bacteria kit. bacteria have have been been incubated incubated the the plasmids plasmids can can be be recovered recovered with with aa DNA DNA mini-prep mini-prep kit. To prepare the DNA we performed performed a miniprep, which allows a desired plasmid to be isolated from the bacteria. The plasmid miniprep is based on the alkaline lysis Birnboim and Doly Do ly in 1979. The process permits separation of procedure developed developed by Birnboim of plasmid DNA from from bacterial genomic DNA because of of the relatively small and tightly coiled nature of of the plasmid DNA in comparison comparison to the genomic DNA (28). We used the commercial Qiagen miniprep kits. We used restriction endonuclease digestion to confirm confirm that we had the desired of DNA. plasmid. Restriction endonucleases recognize and cut specific specific sequences of different restriction endonucleases exist, each recognizing its own, unique Hundreds of of different DNA sequence. To determine the sequence of of a given plasmid one or more restriction endonucleases are selected. For our research we used primarily: PVUI which cuts the CGACTG sequence, AFL1II AFLIII which cuts the ACRYGT ACRYGT sequence, and Eco Rl RI which cuts TTC sequence. Given a predicted sequence these enzymes should cut a given the GAA GAATTC of times at specific of DNA that should be cut. If If number of specific places. We predict the sizes of after agarose Gel electrophoresis (see below) we can be the expected sizes are found after relatively confident confident that we have the desired sequence (29). 17 Following Fo llowing a restriction restrict ion endonuclease endonuclease digestion digestion we we determined determined the the size size of of the the cut DNA segments segme nts by by running running them through through aa 1% 1% agorose agorose gel. When When aa greater greater degree degree of of accuracy accuracy was was required required than restriction enzyme enzyme digestion could could offer offer we we had had the DNA 0 A sequenced at the University of Utah central ceorra l facility. faci lity. sequenced University of wi ld type+GFP type+G FP constructs constructs were were available avai lable we created created two two mutations mutations to Once the wild test test the role ro le ooff the linker section. A double do uble linker linker mutant, mutant, and a flexible flex ib le linker linker mutant, both bot h with w ith GFP. G FP. The T he constructs const ructs are shown shown in figure figu re 9. 9. Linker Linker Snt-l Wild Type Snt-l Double Linker Mutatio Mutationn Snt-I N II . "': I 1 ',',,_ Snt-l Flexible Linker-Mutati Linker^vlutation Snt-I on N . '. ' .... ...... k. •• ""."", • -)-f. iJ 4 ~ -----------G G S G G S G G S G G S II II GGSGGSGGSGGS Figure 9 Wild-type, nexibJe. flexible, and a n d double linker linker constructs. constructs. Wild-type. 18 synaptotagmin flflexible ex ible mutant B) Creating Creating a synaptotagmin Two Primers Primer s were designed: one consisting of of an annealing section section and the code repeats; section of 15 nucleotides for 4 GGS repeal s; the other had an annealing sec tion and a sequence of that we were complementary to the other primer, primer. allowing allow ing In-Fusion In-Fu sio n to join the two. The re complementary sequence of of the primers is shown in figure 11 The primers attached at opposite ends of of figu re 11 the linker sectio section. synaptotagmin DNA st strand n. This results in a linear lin ea r synaptotagmin rand that lacks a linker section. section. sec tion. Instead, the primer's primer's code for 4 GGS repeats repea ts becomes beco mes the linker linker sect ion. The circular SNT gene sequence was joined jo in ed together together by an an In-Fusion In- Fusion reaction, reactio n, resulting result ing in a circular with w ith a flflexible exib le linker linke r (see figure fi gu re 10) J 0) li nker mutant a Gateway reaction was used to create an Having obtained a flexible linker A expression clone as detailed in step step A C2A . linker Rest of snt C2B CZA C2A Snt Snt C2B C2B (,1,\\ I '••'•"> C2A C2A Slit Snt C28 C2B 1,1,\\, <.<;sxi Primers with loose flexible ne~lble Primers linker sectJon linker section attach and replicate replica le gene, resulting in In a linear linear segment of DNA of DNA In-fusion cuts pairs 01 of In·fu§lon tu t~ 15 IS base b~~e palB ends both leading end~ Complimentary (omohmentaf'/ ends end~ fuse, fuse. makIng another ano ther (Irtulu making circular pta~ mld with WIth 2 linur§ plasmid linkers Figure 10 Constructing flexible linker mutant ann In-fusion reactionn Constnlcl lIl g a:t !lcxlbk mutant using u~mg a [n-liJslOn reactio 19 Primer Sequence Silt·] snt-1 flexible ccggatccacctgaccctccactcccacctgcaatatccttccattcttcgataacagc ccggatccacctgaccctccactcccacctgcaatatccttccartcrtcgataacagc linker reverse snt-I snt-1 flexible flexible gtcaggtggatccggaggtagtggtgacatttgcttctcacrtcgg gtcaggtggatccggaggtagtggtgacatttgcttctcacttcgg linker forward forward Sllt-\ snt-1 double GCTTTTTTCgGCcTCCTTaTCgTCcGGtGGaGGactcttctcagcttctttgtcatctgg GCTTTTTTCgGCcTCCTTaTCgTCcGGtGGaGGactcttctcagcllclllgtcatctgg linker reverse silt-I uble snt-1 do double GAgGCcGAAAAAAGCcllggtgacatllgCtlctcacttcgg GAgGCcGAAAAAAGCcttggtgacatttgcttctcacttcgg linker forward forward Figure 11 11 Sequence of primers used Seq uence of synaptotagmin C) Creating a sy naptotagmin I double double linker linker mutant expression ex pression plasmid The process of le of creating a double linker is nearly identical to creating a flexib flexible link er. The differences Instead of of the primers being on opposite oppos ite ends of of the linker. differences being that instead of the code for 4 GGS repeats the primer linker they are on the same ends. ends, and instead of contained the code for tor a second linker sequence. The sequence of a f the primers is sshown hown of primers anneal annea l on the same end is synaptocagmin of figure II 11 The result of of having the primers synaptotagmin is replicated into a linear DNA strand with the original linker from linker section and a second one fro m the primer. As in the flexible flexible mutant, Infusion Infusion joined jo ined the ends of of the gene together resulting in a double linker mutant, mutant. (see figure 12). The double linker plasmid was then entered into an expression clone via a Gateway reaction reaclion as detailed in step A. 20 Rest of snt linker linker C2A linker CZA . ----------_~ __C~A ___ . linker C2A I Hnke C2A _ C2B ~ _"._. C2J~ ~_ Sill Silt Rest of snt C2B Snt S.U .„ '•: ._ linker linker C2B _ C2B Pnmers Joose tether Primers with loose tether section attach and aod replicate in replicate gene. gene, resulting resulting in a a linear linear segment segment of DNA DNA In -fUSion (utI IS b~se 01 Infusion cuts 15 base pairs of bo th leading ludin, ends both | linker Complimentary (om plimtn lilly ends fuse, lUII', making ;!Oot lle!" ("cui., another circular plasmid pl~smld with Wllh 2 linkers Figure 12 in-fusion reaction Creating na synaptotagmin double mutant using using an in-fusion 3 ) Injection assays 3) Inj ection and assays The expression clones werejnjected were_injected into int o the dista o f the gonad of distall arm of of C. elegans. Along with a Pmyo2:mChcrry Pmyo2:mCherry co coinjection elegans. injection marker which expresses a red fluorescent phurynx, and a DNA ladder which facilitates laci litates the DNA uptake by fluorescent tag in the pharynx, the eggs. The womlS worms eggs pick up the injected offspring express it, injected DNA and the offspring altho although ugh it is not incorporated into inlo their Iheir chromoso chromosomes. me s. Worms Wonns with wilh the expre expression ss ion clo clone ne are eas easily selected. The co coinjection light. il y sclectcd. injcclion marker markcr proteins glow brightly brightl y under a mercury lighl. Wild type and synaptotag synaptotagmin-null min -nul l mutants mUlanl s were injected. The wild type were used to determine if the mutati mutations dominant effects and the synaplOtagmin-null synaptotagmin-null mutants detenlline ons had do minant effects mutant s were used to detemline determine rescue. 21 21 Rescue was quantified quantified by measuring the number of of times an animal thrashes per ion it arcs its body back and forth. One minute. When a wild type worm is placed in solut solution defined as moving from onc posit ion to the invert and back. The change in thrash is defined one body position body shape follows the pattern shown in figure 13. Figure 13 A typical thrashing movement for lor a wild type worm L4 worms were selected and allowed al lowed to mature marure overnight to young adulthood. solutionn ofM9 of M9 and given a minute The worms were then placed in a solutio minut e to acclimate. Then performed in a minute were measured. This process was assayed the number of of thrashes performed on at least 15 different different animals for each line and an average was taken. Normal No rmal worms synaptotagmin-1 knockout worms thrash rapidly when placed in a liquid while synaptotagmin.l wonns do not of thrashes per minute in the experimental an animals imals reflects reflects the thrash. The number of degree to which the construct rescues. 22 The synaptotagmin-l synaptotagmin-1 mutants were tagged with GFP. The protein was then imaged using a confo cal microscope. Confocal Confocal microscopy produces a 3-D image of of the confocal worm by scanning a laser across the worm. worm . Using this th is image we can determine if if diffuse in the neuron. Functioning synaptotagmin is punctate or is diffuse Functioning synaptotagmin synaptotagmin would be expected to be located in the synaptic region of of the neuron, resulting in clear, clear, punctate sections of GFP FP along the synapse. If If the modified modified synaptotagmin construct is not sectio ns ofG localizing correct correctly ly GFP may be more morc diffuse diffuse around the neuron or simply simp ly not no t present. We ca cann aalso the synaptotagmin is being produced correct correctly trafficked jrthe ly and is being trafficked lso tell if cellll body and to the axon. out of of the ce 23 Results: Thrashing assays of flexible and double linker arrays showed partial partia l rescue resc ue of of flexible of synaptotagmin synaptotagmin+GFP resc rescued synaptotagm in function function when compared to wild type synaptotagmin+GFP ued FP mutants rescue synaptotagmin-l ani mals. We found the wild wi ld type synaptolagmin+G animals. synaptotagmin+GFP synaptotagmin-1 mals. The delete rious dominance effects null mutants while having no deleterious effects on wild-type ani animals. results of of the thrash thrashing ing assays are shown in figure 14. \4. Snt-l ible Linker Mutants Snt-1 Rescue in Flex Flexible ~ c " II :E .. .c l! ~ 180 160 140 120 100 80 60 40 20 -i o Key N2=Wild "normarl" worms N2= Wild type "nomla Snt synaptotagmin knockout mutant S nt Null=md290 Nu ll= md 290 synaplotagmin Snt Rescue=Md290+normal arrayy SOl Rescue=Md290+normal synaptotagmin+GFP synaplolagmin+GFP arra Flex=synaptotagmin expressed promoter Snt Flex=synaptotagm in flexible flexible linker mutant muta lll +GFP exp ressed by Rab-3 Rub-3 pro moter double= +GFPP ex expressed Snt do uble= synaptotagmin double linker mutant +GF pressed by Rab-3 promoter Figure 14 Thrashing assay on wild type, TIu<lshing :lssay performed performed on type. synaptotagmin synaplOt agm in null, nu ll. flexible construct. construct, and double construct ssynaptotagmin ~11aptO!agmm rescue, rescue. nexible con struct worms. Resultss showed partial rescue for Result lor the flexible nexiblc and double constructs when synaptotagmin null animals. when compared compared to the s~maplOtagl11in 24 In both the flexible and double mutations partial rescue was observed. Wild type and Snt rescue worms thrashed consistently and with great amplitude. The double and flexible construct animals thrashed with less amplitude and had a greater tendency to pause or curl up. This initial result suggests that the physical properties and the length of synaptotagmin 1 function, though are not absolutely vital to the linker section influence influence synaptotagmin endocytosis and exocytosis. We see partial rescue of of thrashing in double and flexible flexible linker mutations. mutations. The The two-tailed two-tailed pp tests tests show show values less than than .000 .00011 between between animals animals linker values less rescued with + GFP GFP (the (the control) control) and and those flexible those rescued rescued with with flexible rescued with normal nonnal synaptotagmin synaptotagmin + linker synaptotagmin + GFP. The mean mean control control value value was 120 thrashes thrashes per minute. linker synaptotagmin + GFP. The was 120 per minute. Average for flexible synaptotagmin 11 rescue range from from 60 to 80. 80. The The average average A verage values values for t1exible synaptotagmin rescue range 60 to difference between the the control control group group and and flexible flexible synaptotagmin synaptotagmin 11 mutants mutants is is 50 50 with with aa difference between 95% confidence confidence interval between 25 and 60. Similarly, the double linker + GFP showed a p value ofless of less than .0001 .0001 when compared to wild type + GFP. The mean number of thrashes for the double linker mutants was 83.7 with a range from 60 to 105. Although variations in expression level may slightly confident that the ~ightly impact the results, we can be confident difference synaptotagmin 1 control group and the flexible difference between between the synaptotagmin t1exible control group is significant. signi fie ant. injected with the unc-17 For imaging, the constructs were injected unc-l 7 promoter, which expresses only in the cholinergic neurons, allowing us to image individual synapses without being overwhelmed overwhelmed by fluorescence fluorescence from other types of of neurons. The transgenic animals showed somewhat punctate GFP localized at the synapses as shown below: 25 QuickT,rne'" QuickTime™ anj and a cIecompressor decompressor are needed los to see picture. ate ee this pictu~. A) B) Figure!155 Figure A)) TIle The ventral nerve cord of of C. C. e//!gans elegans that has been rescued by a A nonnal normal synaplotagmin synaptotagmin + GF GFPP array expressed in the P unc·]7 unc-17 (cholinergic) promoter. B» The Ventra! egalls expressing flexible linker B)) Ventral Nerve Cord of C. C. el elegans array. The array is somewhat punctate at cholinergic syn apses synapses W hile the GFP marker was relatively relati vely punctate in the flexible mutant, it did not While appear to be as punctate as wild type synaptotagmin. This suggests that endocytosis may not be fully rescued. Decreased levels leve ls ooff endocytosis mean more synaptotagmin is remain ing in the plasma membrane rather than being be ing recycled back into synaptic vesicles. remaining As the synapl otagmin remains in the membrane it diffuses ion of synaptotagmin diffuses out of of the synaptic sect section the membrane, resulting in a diffuse diffuse pattern. vin marker can be used as a contro luate levels of A synaptobre synaptobrevin controll to eva evaluate of endocytosis. Synaptobrevin is punctate in wild type wo nns (see figure 15) and ddiffuse iffuse in worms synap totagm in null mutant s. (see figu re 16). This is because becau se synaptobrevin synaptotagmin mutants, figure synaptobrevin,. like synaptotagm in is recycled into synapt ic ves ic les by endocytosis. In synaptotagmin null synaptotagmin synaptic vesicles Wit hout a way out of mutant s endocytosis is impaired. mutants impaired. Without of the ce cellll membrane synaptobrevin synaptobrevin me mbrane rather than staying in the synapt ic sec tion of the diffu ses around the membrane diffuses synaptic section membrane. 26 26 QuickTime™ and a QuickTime™ a nd a ddecompressor ecompressor aare r e needed n e e d e d ttoo see s e e this picture picture. A) A) B) B) Figure 16 A) synaptobrevin marker in in wild type worms. The marker is is very punctate, localizing at the synapse, suggesting proper endocytosis endocytosis punctate. local izing at the synapse. function. We hope to synaptotagmin marker with the flexible to inject inject aa synaptotagmin the flexible equallyy punctate in mutants to to see if synaptobrevin is is equall in the the mutant lines. 8 ) Ventral nerve cord of C. elegans lacking snt-1 snt-l and a B) elegans lacking is diffuse diffuse at synaptobrcvin marker. synaptobrcvin synaptobrevin GFP G F P marker marker, synaptobrevin is the synapse synapse in the absence of snl-l. snt-1. The thrashing thrash in g assays have sho wn that mutations to the length and physical shown properties ofsynaptOiagmin of synaptotagmin interfere interfere with the proteins proteins function in the worms. wo rms. Imaging of this impairment may be due to endocytosis deficit deficits. of o our suggests part oflhis s. The results result s or ur research are su summarized below.. mmarized in Figure 17 below Synaptotagmin SynaptOlagmin Marker Punctate Punctate X Somewhat Somew hat punctate Somewhat Somewhat punctate Synaptobrevin Marker Punctate Diffuse Diffuse To Be Be determined To be detennined Thrashes 160 160 determined detennined 10 10 80 80 80 80 Fi gure 17 17 Figure The quali quality synaptotagmin markers, synaptobrevin TIle ty of synapwtagmin markers. synapwb rcvin markers, markcrs. and and thrashes III in wild type, null, and tlex thrashcs wIld tY1K null. and Hcx mutant worm 27 Somewhat So mewhat punctate punctate Synaptobrevin Marker Punctate Diffuse Diffuse To Be Be detennined determined To be be dctennined determined Thrashes 160 10 80 80 28 It is possible that exocytosis is inhibited by the mutations. This would suggest the flexibility and length of synaptotagmin function, supporting flexibility of the linker are important important to synaptotagmin the linker and the charge models put forward in the results section. However these models predicted complete rescue of of endocytosis. This was not supported supported by the somewhat somewhat diffuse diffuse GFP seen. If If this is the case the flexible linker must be less effective effective at assembling is that failure assembling the the protein protein complex complex needed needed for for endocytosis. endocytosis. A A final final possibility possibility is that failure to is due folding improperly. is unlikely since we we to completely completely rescue rescue is due to to the the protein protein folding improperly. This This is unlikely since the protein synapse. . see see that that the protein makes makes it it to to the the synapse. It is likely that synaptotagmin synaptotagmin interacts with complexin to stimulate fusion (9). The linker segment playaa crucial role in this process. The 12 Amino acid sequence segment may play is approximately approximately the right size to straddle the same SNARE site that complexin may attach to. Changing the properties of of the linker may have a deleterious effect effect on synaptotagmin's from the SNAREs. This model is synaptotagmin's ability to release complexin from compatible with our findings. If affinity for the If the mutations lower synaptotagmin's affinity SNARE site shared by complexin synaptotagmin synaptotagmin would bind with less frequency, frequency, resulting in lower exocytosis rates. Using the clamp model modelofsynaptotagmin's of synaptotagmin's interaction with complexin complexin discussed in methods it is possible that the mutations inhibit of exocytosis the clamp, but rescue endocytosis. This would result in decreased levels of and could be tested by measuring aldicarb sensitivity. Wild type wonns worms release acetylcholine, which is normally degraded by acetylcholinesterase. In the presence of of wonns. The Aldicarb the acetylcholine stays in the synapse, eventually paralyzing the worms. speed at which this occurs tells us how much exocytosis is taking place. If the complexin speed clamp-release clamp-release model is correct and synaptotagmin's synaptotagmin' s ability to release complexin is 29 reduced by the mutations we predict decreased decreased levels of of exocytosis, causing paralysis to occur more slowly. It is also possible our mutants cause exocytosis rates to increase, accelerating paralysis. If If the complexin complexin clamp is inhibited by the synaptotagmin synaptotagmin mutations we would expect increased increased aldicarb sensitivity. determined that there is partial rescue in the double and flexible linker We have determined mutants. The primary question that remains is whether this is due to endocytosis or exocytosis deficits. Unfortunately difficult to separate these two Unfortunately it is extremely difficult processes. We plan to add a Synaptobreven Synaptobreven Coinjection Coinjection marker to gain a better view of the degree of of endocytosis rescue in out mutants. Synaptobrevin is punctate in wild type worms where endocytosis is functioning. In synaptotagmin-1 synaptotagmin-l null worms where diffuses endocytosis stops synaptobrevin synaptobrevin remains in the plasma membrane and slowly diffuses around the cell, resulting in a diffuse diffuse image. Seeing whether or not Synaptobrevin Synaptobrevin is punctate in the flexible mutants will help us determine whether endocytosis is impaired by the mutation. A better understanding ofthe of the role of of the synaptotagmin synaptotagmin 1 linker is vital to creating a clear model of of how synaptotagmin facilitates endocytosis and exocytosis. We have shown that modifications modifications to the linker impact both functions of of synaptotagmin. As we learn more about the reason for these impairments we will better understand understand what role the linker plays synaptotagmin'ss broad phylogenic presence suggests that this p lays in the process, process. synaptotagmin' research may have applications to the understanding of of neuron function function in all species. 30 Works Cited 1) Fraser, Neil. "The Biological Neuron." Virtual Ventures - Home. 32 Sept. 1998. <http://vv.carleton.ca/~neil/neural/neuronCarleton University. 16 Feb. 2009 <http://vv.carleton.caJ~neilJneuralJneuron­ a.html 2) Basic Concepts for Neural Networks." Cheshire Engineering Engineering Corporation. 16 Feb. 2009 <http://www.cheshireeng.comlNeuralyst/nnbg.htm>. <http://www.cheshireeng.com/Neuralyst/nnbg.htm>. 3) Excitable Cells." RCN I| Digital Cable TV, High-Speed Internet Service & Phone in Boston, Chicago, New York City, Philadelphia, Washington, D.C. and the Lehigh Valley. 17 July 2003. 16 Feb. 2009 <http://users.rcn.comljkimball.ma.ultranet/BiologyPages/EIExcitableCells.html>. <http://users.rcn.eom/jkimball.ma.ultranet/BiologyPages/E/ExcitableCells.html>. of synaptic transmission." Annual 4) Sabatini, L. B., and W. G. Regehr. "Timing of of Physiology 61 Review of 61 (1999): 521-42. "Synaptotagmin I functions 5) Fernandez-Chacon, R., et al. "Synaptotagmin functions as a calcium regulator of of release probability." Nature 41 (2001). 6) S, Martens, et al. "Synaptotagmin-1 "Synaptotagmin-l utilizes membrane bending and SNARE binding to drive fusion pore expansion." Molecular Biology of of the Cell 12 (2008): 5093-103 7) Geppert, M., et al. "Intracellular "Intracellular calcium dependence of of large dense-core vesicle ofSynaptotagmin of the national exocytosis in the absence of Synaptotagmin 1." I." Proceedings of academy of of science USA 98 (2001): 11680-1685 11680-1685 8) Weeks, Eric. "How does a confocal confocal microscope work?" How does a confocal confocal microscope work? Emory University. 06 Apr. 2009 <http://www.physics.emory.edu/~weeks/confocalJ>.Schaub <http://www.physics.emory.edu/~weeks/confocal/>. Schaub JR, Lu X, Doneske B, - 9) Shin YK, McNew JA (2006) Hemifusion Hemifusion arrest by complexin is relieved by Ca2+-Synaptotagmin 1. Bioi 13: Ca2+-Synaptotagmin I. Nat Struct Mol Biol 13: 748-750 748-750 10) Dai H, Shen N, Arac D, Rizo J (2007) A quaternary SNARE-SynaptotagminSNARE-SynaptotagminCa2+-phospholipid 848Ca2+-phospholipid complex in neurotransmitter neurotransmitter release. J Mol Biol Bioi 367: 848863 Sudhof "A single C2 domain from Synaptotagmin 11) Davletov, B. A., and T. C. Sudhof. Synaptotagmin I is sufficient affinity Ca2+/phospholipid Ca2+/phospholipid binding." Journal of of biological sufficient for high affinity chemistry chemistry 268 (1993): 26386-6390 12) Huang, H., and D. S. Cafiso. "Conformation Position of "Conformation and Membrane Position of the Region Linking the Two C2 Domains in Synaptotagmin Synaptotagmin 1 by Site-Directed Site-Directed Spin Labeling." Biochemistry Biochemistry (2008). 13) StidhofTC. Chern 2002;277(10):7629-32. Sudhof TC. Synaptotagmins: why so many? J BioI Biol Chem Adolfsen B, Saraswati S, Yoshihara Synaptotagmins are 14) Adolfsen Yoshihara M, M. Littleton JT. Synaptotagmins trafficked subcellular domains including the postsynaptic compartment. compartment. trafficked to distinct subcellular The Journal of of cell biology 2004;166(2):249-60. 2004:166(2):249-60. " 31 Sudhof TC, Rizo 1. J. Structural basis 15) Dai H, Shin OH, Machius M, Tomchick Tomchick DR, StidhofTC, for the evolutionary inactivation inactivation of of Ca2+ binding to Synaptotagmin 4. Nature structural & molecular molecular biology 2004;11(9):844-9. 16) Loewen CA, Mackler JM, Reist NE. Drosophila Drosophila Synaptotagmin Synaptotagmin I null mutants survive to early adulthood. Genesis 2001 ;31 ;31(l):30-6. (l ):30-6. 17) Mackler JM, Drummond Drummond JA, Loewen CA, Robinson 1M, IM, Reist NE. The C2B Ca2+-binding of Synaptotagmin is required for synaptic transmission in motifofSynaptotagmin Ca2+-binding motif vivo. Nature 2002;418(6895):340-4. 18) Reist, Noreen, and Carin Loewen. Synaptotagmin: transducing Ca2+-binding Ca2+-binding to vesicle fusion. Colorado State University, 2009 StidhofTC. Autonomous function function of of Synaptotagmin Synaptotagmin 1 in triggering 19) Maximo Maximov v A, Sudhof TC. Autonomous synchronous release independent independent of of asynchronous release. Neuron 2005;48(4):547-54. 2005;48( 4):547-54. 20) Reist, N. E., et al. "Morphologically "Morphologically Docked Synaptic Vesicles Are Reduced in Synaptotagmin Mutants of Synaptotagmin of Drosophila." Journal of of Neuroscience 1 (1998): 7662663. Fernandez-Chacon R, Shin OH, Konigstorfer K6nigstorfer A, et al. Structure/function 21) Fernandez-Chacon Structure/function analysis of of Synaptotagmin of Ca2+ binding to the C2A domain of Synaptotagmin 1. J Neurosci 2002;22(19):8438-46. 22) Andrews, N. W., and S. Chakrabarti. "There's more to life than VIL" Trends in neurotransmission: the regulation of of exocytosis by Synaptotagmin Synaptotagmin VII." Cell Biology 15 (2005): 626-31. aI., Ca(2+)-dependent 23) C. Li et al., Ca(2+)-dependent and -independent activities of of neural and nonneural Synaptotagmins, Nature 375 (1995), pp. 594-599. 24) Z. Gao et ct al., aI., Synaptotagmin III/VII isoforms isoforms mediate Ca2+-induced Synaptotagmin II1/VII Ca2+-induced insulin secretion in pancreatic islet beta -cells, J. Biol. BioI. Chem. Chern. 275 (2000), pp. 3607936085. of insulin secretion and GLUT4 tra3cking by the 25) Yanyan, Li, Et a1. al. "Regulation "Regulation of calcium sensor Synaptotagmin Synaptotagmin VII." Biophysical Research VIL" Biochemical and Biophysical Communications (200?): 658-64. Communications 362 (2007): of Polymerase Chain Reaction." Methods in 26) Bartlett, Johns M. "A Short History of Molecular Biology 225 (2003): 3-6. 27) Knight, Ivor, and Jonathan Monroe. "Plasmid Miniprep." Advanced Molecular Molecular Biology. 7 Sept. 2000. James Madison University. 26 Feb. 2009 <http://csm.jmu.edu/biology/courses/bio480_580/mblab/miniprep.html>. <http://csm.jmu.edw'bio logyl courses/bi0480 _5801mb 1ab/min iprep.html>. 28) Kimball, John W. "Restriction "Restriction Enzymes." Kimball's Biology Pages. 9 June 2003. 26 Feb. 2009 <http://users.rcn.comljkimball.ma.ultranet/BiologyPages/RlRestrictionEnzymes.h <http://users.rcn.com/jkimball.ma.ultranet/Bio logyPages/R/RestrictionEnzymes.h tml>. microinjection." WormBook. 2006. 26 29) Evans, Thomas C. "Transformation "Transformation and microinjection." Feb. 2009 <http://wwvv.wormbook.org/chapters/www_transformationmicroinjectionytransfor <http://www. wormbook.org/chapters/www _ transformationmicroinjectionltransfor mationmicroinjection.html>. mationmicroinjection.html> . 30) How do we Sequence DNA'?" DNA?" University of of Michigan DNA Sequencing Core. 26 Feb. 2009 <http:'!!seqcore.brcf.med. <http://seqcore.brcf.med.umich.edn doc/educ/dnapr/sequencing.html>. umie h.eduldoc/educ/dnapr/sequencing.html>. / 32 31) Chronin, Christopher Christopher J" J., er et at. al. "An automated system for measuring parameters parameters of of sinusoidal nematode sinuso idal movement." Biomed Central Genetics (2005). 33) Georgiev, Danko D., and James F. Glazebrook. Subneuronal processing of information by solitary waves and stochastic processes. Nano and Molecular (2007). Electronics Handbook (2007). 34) Jorgensen, Erik, and Et Al. AI. "Defective tic vesicles ves icles in "Defective recycling of of synap synaptic Synaptotagmin mutants ofCaenorhabditis of Caenorhabditis elegans." Nature 378 (1995): 196-99. 35) PCR Cloning Kits -- In-Fusion." Clontech:: Clontech :: Home. Clontech. 02 Apr. 2009 <http://www.ciontech.comlproducts/detail.asp?product id= 16227 5&tabno=2>. <http://www.clontech.com/products/detail.asp?product_id=162275&tabno=2>. 36) Jorgensen Lab. "Mosl mediated Single Copy Insertion (MosSCI)." 07 Apr. 2009 <http://sites.google.com/site/jorgensenmossci/Home>. <http://sites.goog Ie .co mls ite!jo rgensenmo sse i/H0 me>.