Regulation of pap pilin phase variation

The regulation of expression of the pyelonephritis-associated pili (pap) pilin gene in Escherichia coli was investigated using a single copy lacZYA fusion system. The expression of pap-encoded pili is under the control of a heritable phase variation mechanism. Pap phase-variation is transcriptionally regulated and responsive to changes in the carbon source used for growth and the incubation temperature. Pilin phase variation occurs without DNA rearrangement of pap DNA sequences. Analysis of the DNA regulatory region upstream of the papBA promoter showed that there are two nearly perfect 27 base pair inverted repeats separated by 89 base pairs. Each inverted repeat contains a single Dam (deoxyadenosine methylase) methylation site (GATC1028 and GATC1130 sites). Using a pap-lac gene fusion, as well as primer extension analysis of papB mRNA, it was found that the dam gene product is required for pap transcription. The methylation states of the GATC028 and GATC1130 sites in DNAs isolated from transcriptionally phase on and phase off cells were different as evidenced by Southern blot experiments. The GATC1028 site was found to be unmethylated only in DNA isolated from phase on populations. Conversely, GATC1130 sites were unmethylated in DNA isolated from phase off populations. E. coli mutants were isolated that failed to protect both the GATC1028 and GATC 1130 sites from methylation by Dam. The defective gene(s) in these mutants was cloned and designated as mbf for methylation blocking factor. The mbf gene is located at 19.6 min on the E. coli chromosome. In mbf+ E. coli the GATC1130 site is umethylated (the phase off methylation state) in the absence of any pap-encoded proteins. Methylation protection of GATC1028 (the phase on methylation state) requires both mbf and papI, a regulatory gene within the pap operon, indicating that pap pilin phase variation requires the action of at least two genes, papI and mbf. A model is presented for pap pilin phase variation which predicts that the GATC methylation state regulates Mbf and PapI binding to pap DNA and that binding of Mbf and PapI inhibits the methylation of GATC sites by Dam methylase.

THE REGULATION OF PAP PILIN PHASE VARIATION by Lawrence Bnlce Blyn A dissertation subnutted to the faculty of The University of Utah in partial fulfillnlent of the requirements for the degree of Doctor of Philosophy Departnlent of Experinlental Pathology The University of Utah June 1991 Copyright © Lawrence Bruce Blyn 1991 All Rights Reserved THE UNIVERSITY OF UTAH GRADUATE SCHOOL SUPERVISORY COMMITTEE APPROVAL of a dissertation submitted by Lawrence B. Blyn This dissertation has been read by each member of the following supervisory committee and by majority vote has been found to be satisfactory. Jaona ry II, 1 QQ 1 January 11, 1991 January 11, 1991 January 11, 1991 January 11, 1991 THE UNIVERSITY OF UTAH GRADUATE SCHOOL FIN AL READING APPROV AL To the Graduate Council of the University of Utah: I have read the dissertation of Lawrence H. B lyn in its final fonn and have found that (1) itS format, citations and bibliographic style are consistent and acceptable; (2) its illustrative materials including figures, tables, and charts are in place; and (3) the final manuscript is satisfactory to the supervisory corrunittee and is ready for submission to The Graduate School. January 11, 1991 :r!~'ct-=vf) ft/ ,/~~- Date David A. Low Chair. Supervisory Committee Approved for the Major Department Approved for the Graduate Council B. Gale Dick Dean of The Graduate School ABSTRACf The regulation of expression of the pyelonephritis-associated pili (pap) pilin gene in Escherichia coli was investigated using a single copy lacZY A fusion system. The expression of pap-encoded pili is under the control of a heritable phase variation mechanism. Pap phase-variation is transcriptionally regulated and responsive to changes in both the carbon source used for growth and in the incubation temperature. Pilin phase variation occurs without DNA rearrangement of pap DNA sequences, distinguishing this system from previously described phase variation systems. Analysis of the DNA regulatory region upstream of the papBA promoter showed that there are two nearly perfect 27 base pair inverted repeats separated by 89 base pairs. Each inverted repeat contains a single Dan1 (deoxyadenosine methylase) methylation site (GATC1028 and GA TC 1130 sites). U sing a chromosomally located pap-lac gene fusion, as well as primer extension analysis of papB mRNA, it was found that the dam gene product is required for pap transcription. The methylation states of the GATCI028 and GATCl130 sites in DNAs isolated from transcriptionally phase on and phase off cells were different as evidenced by Southern blot experiments. Importantly, the GATCI028 site was found to be unmethylated only in DNA isolated from phase on populations. Conversely, GATC1130 sites were unmethylated in DNA isolated from phase off populations. E. coli mutants were isolated that failed to protect both the GATCI028 and GATCl130 sites from methylation by Dam. The defective gene(s) in these mutants was cloned and designated as mbffor methylation blockingfactor. The mbfgene is located at 19.6 min on the E. coli chromosome. In mbr- E. coli the GATCl130 site is unmethylated (the phase off methylation state) in the absence of any pap-encoded proteins. In contrast, methylation protection ofGATCl028 (the phase on methylation state) requires both mbJandpap/, a regulatory gene within the pap operon. These results indicate that phase variation of transcription from the papBA promoter requires the action of at least two genes, pap! and mbf This is the fIrst observation of differential heritable methylation states in bacteria. A model is presented for pap pilin phase variation which predicts that the GATC methylation state regulates Mbf and PapI binding to pap DNA and that binding of Mbf and PapI inhibits the methylation ofGATC sites by Dam methylase. v This thesis is dedicated to all of my family who have always provided the support and encouragement I have needed to accomplish this work. It is also dedicated to all of those people who throughout the years I have had the joy of calling friends. All of you have contributed in large part to this work. TABLE OF CONTENTS ABSTRACT ......................................................................................... iv ACKNOWLEDGMENTS ......................................................................... ix Chapter I. INTRODUCTION ............................................................................. 1 Pili Expression by Uropathogenic coli ..................................................... 2 Pyelonephritis Associated Pili (Pap) ......................................................... 4 Regulation of Pilin (PapA) Gene Expression ............................................... 6 Phase Variation ................................................................................. 11 Introduction to Work Presented in Thesis ................................................... 19 References ...................................................................................... 20 II. PHASE-VARIA TION OF PYELONEPHRmS-ASSOCIA TED PILI IN ESCHERICHIA COll: EVIDENCE FOR TRANSCRIPTIONAL REGULATION ................................................................................ 30 Introduction ..................................................................................... 31 Results ........................................................................................... 31 Discussion ...................................................................................... 35 Materials and Methods ......................................................................... 37 Acknowledgements ............................................................................ 38 References ...................................................................................... 38 III. REGULATION OF PAP PILIN PHASE VARIATION BY A MECHANISM INVOLVING DIFFERENTIAL DAM METHYLATIONSTATES ...................... 39 Introduction ..................................................................................... 40 Results ........................................................................................... 40 Discussion ...................................................................................... 46 Materials and Methods ......................................................................... 48 Acknowledgements ............................................................................ 49 References ...................................................................................... 49 IV. EVIDENCE FOR A METHYLATION BLOCKING FACTOR (MBF) LOCUS INVOLVED IN PAP PILUS EXPRESSION AND PHASE VARIATION IN ESCHERICHIA COLI .................................................. ..................... 50 Materials and Methods ......................................................................... 51 Results ........................................................................................... 53 Discussion ...................................................................................... 59 Acknowledgements ............................................................................ 61 References ...................................................................................... 62 V. SUMMARy .................................................................................... 63 References ...................................................................................... 84 APPENDIX A. IDE NTIFICA TION OF AN ESCHERICHIA COll GENETIC LOCUS INVOLVED IN THERMOREGULATION OF THE PAP OPERON ................................. 89 Materials and Methods ......................................................................... 91 Results ........................................................................................... 92 Discussion ...................................................................................... 94 Acknowledgenlents ............................................................................ 96 Literature Cited ................................................................................. 96 viii ACKNOWLEDGMENTS I would like to thank IRL Press for pennission to use the articles from The EMBO Journal which appear in Chapter I (Phase-variation of pyelonephritis-associated pili in Escherichia coli: Evidence for transcriptional reguation. Vol. 8, No.2, pp. 613-620, 1989) and in Chapter II (Regulation of pap pilin phase variation by a mechanism involving differential Dam methylation states. Vol. 9, No. 12, pp. 4045-4054, 1990). I would also like to thank ASM Press for pennission to use the articles from The Journal of Bacteriology which appear in Chapter III (Evidence for a Methylation-Blocking Factor (mbf) locus involved in pap pilus expression and phase variation in Escherichia coli. Vol. 173, No. 5, pp. 1789-1800, 1991) and the Appendix (Identification of an Escherichia coli genetic locus involved in thermoregulation of the pap operon. Vol. 172, No.4, pp. 1775-1782, 1990). CHAPTER I INTRODUCTION Pili Expression by Uropathogenic E. coli The first step in the colonization of a host by most bacterial pathogens is attachment to host tissues (1). Attachment is mediated by bacterial cell surface adhesins, which specifically recognize and bind to eukaryotic cell surface receptors. In many cases, bacterial adhesins are associated with the tips of long, hair-like cell surface structures known as pili (fimbriae) in a pili-adhesin complex. In this thesis, I have concentrated on understanding the molecular basis of the regulation of pili expression by an Escherichia coli strain that can cause urinary tract infections (UTIs) in its mammalian hosts. UTI is often defined as the microbial colonization of the urine and invasion of the lower urinary tract (bladder infections) and/or upper urinary tract (pyelonephritis) (2). Although a number of organisms, including viruses and yeast, can cause UTIs in humans, the most common etiologic agents are bacteria. Of the human UTIs caused by bacteria, approximately 60-85% are due to E. coli (3, 4, 5). It has been suggested that the large intestine may serve as the major reservoir for these organisms in humans (6), In this case, infection of the bladder in women would be preceded by colonization of the vaginal introitus via fecal contamination (7, 8). A number of bacterial virulence factors have been identified in organisms that cause UTI. These factors include hemolysin production and the ability to adhere to uroepithelial cells (9, 10, 11). It has been demonstrated that E. coli isolates from patients with cystitis adhere to uroepithelial cells better than normal fecal isolates (11, 12). There exists significant evidence that bacterial pili and their associated adhesins playa role in attachment to mucosal surfaces (11,13,14,15,16,17). Several types of pili appear to be important in the adhesion of uropathogenic E. coli including type 1, X and P pili (15, 18, 19, 20, 21). In general, these pili are part of pili-adhesin complexes and these complexes may allow a more effective presentation of the adhesin proteins to their respective receptors on host tissues. Type 1 pili are found on the surface of most E. coli and a variety of other Gram negative bacteria (22, 23). These pili mediate hemagglutination of various types of erythrocytes and may also agglutinate other types of eukaryotic cells (24,25, 26). Type 1 2 pili hemagglutination is inhibited by D-mannose and certain D-mannose-containing oligosaccharides and is therefore referred to as mannose sensitive hemagglutination (27, 28). Type 1 pili consist of a major pilin subunit of about 17-21 kilodaltons (kd) and a number of minor proteins (29). The D-mannose binding site is not part of the major subunit, but perhaps is part of a minor protein (28-31 kd) located either at the tip of the pilus or periodically along the structure (30, 31, 32). The major subunit of type 1 pili exhibits considerable antigenic variation among different enteric species, but the adhesin protein is, in general, well-conserved (33). The role of type 1 pili in bacterial pathogenesis is not clear (2, 34). Nonpiliated and piliated strains of Salmonella typhimurium display similar virulence when orally administered to mice (35). Bacteria that express type 1 pili bind to Tamm-Horsfall protein, which is produced in the kidney and released into the urine (36, 37, 38). One function of Tamm-Horsfall protein may be to block the attachment of type 1 pili to D-mannose moieties on the eukaryotic cell surface. X pili are those that display adhesin specificities which differ from those of type 1 pili and P pili (21). Some of the X adhesins have been shown to have specificity for sialylgalactosides and these are also called S adhesins (39). Using a mouse model, it was shown that bacterial strains expressing S pili were highly virulent (40). Interestingly, the production of S pili is regulated by the specific growth rate of the bacteria (41). At low specific growth rates S pili were only expressed under anaerobic conditions, while at high specific growth rates the pili were expressed under both anaerobic and aerobic growth conditions. Osmolarity and temperature also affected S pili expression (41). High salt concentrations reduced S pili expression and low temperature (20°C) eliminated the expression altogether. Furthermore, catabolite repression was shown to act on S pili expression (41). When bacteria were grown on media containing glucose as a carbon source, no expression of S pili was observed. Interestingly, a nonpili associated X adhesin has been identified in E. coli pyelonephritis strains (42,43). This adhesin is known as A.FA and the afa operon is composed of five genes. The afaA -D genes are required for adhesin expression and are conserved among various strains of bacteria that express AF A. The adhesin gene, afaE, 3 has a variable structure between differing strains of bacteria. Another X adhesin, closely related to the nonpili associated AFA adhesin, is the Dr hemagglutinin (42, 44). The Dr adhesin is a pili associated adhesin originally found in a serotype 075 E. coli strain isolated from a patient with pyelonephritis (45, 46). The Dr adhesin is so named because its receptor on erythrocytes is the Dr blood-group antigen (47), Most E. coli isolates from patients with pyelonephritis also express P pili on their surface (1). P pili hemagglutinate erythrocytes in the presence of man nose and, consequently, this type of hemagglutination is referred to as mannose resistant hemagglutination in contrast to that mediated by type 1 pili which is mannose sensitive (48). This pili-adhesin complex mediates the attachment of bacteria expressing it to the globoseries of glycolipids located on uroepithelial cells of the mammalian host (13, 19). The minimal structure of this host cell receptor is the digalactoside a-D-Galp-(1-4)-(3-D­Galp (49). This receptor is present as part of the P blood group antigens on human erythrocytes (50). The genes encoding proteins necessary for the production of P pili are located on the bacterial chromosome (51), These genes are termed pap (pyelonephritis associated pili) and are organized in an operon. Many clinical isolates contain two or more pap operons, each encoding distinct pilin and adhesin gene products (52, 53, 54). For example, the E. coli uropathogenic strain C1212 contains two distinct pap gene clusters that produce antigenically distinct pili, both of which can be expressed by anyone isolate (52). Pyelonephritis Associated Pili (Pap) Qn~anization of the Vap locus At least 10 closely linked genes (papA, B, C, D, E, F, G, H, I, and 1) are located in the pap gene cluster and are involved in pap pili biogenesis (31, 32, 55, 56, 57, 58), An eleventh open reading frame, papK, located between the pap] and the papE genes, potentially encodes a protein of unknown function (55). The functions of many of the proteins encoded by the pap operon have been studied. The papl and papB genes encode proteins involved in the regulation of pili expression (59). The PapA, E, F, G, Hand J proteins form the heteropolymeric structure that makes 4 up the Pap pili (31, 56, 60, 61, 62, 63). Lastly, the papC and papD genes both encode proteins involved in pili assembly (64, 65). Pilus structure and assembly Recently, a great deal of progress has been made in understanding the structure of Pap pili and the way in which these pili are assembled on the bacterial cell surface. The pili are heteropolymers made up of approximately 1000 molecules of the major pilin subunit (PapA) and one, or perhaps a few, copies each of the minor pilins PapE and PapF (63, 66). The two minor pilins are located at the tip of the pilus in complex with the PapG adhesin (61, 62). The other two proteins that make up the pilus structure are PapH and PapJ. PapH appears to anchor the pilus to the bacterial surface and also to regulate pilus length (56). Bacteria in which the papH gene was deleted released intact pili into the culture medium. Furthennore, changes in the ratio of PapA to PapH caused changes in overall length of the pilus. The PapJ protein is a periplasmic protein involved in the maintenance of pilus structural integrity (55). Bacteria with deletions in the pap] gene released fragmented pili into the growth medium. The precise role of the PapJ protein in the structure and assembly of the Pap pili is not known. Interestingly, PapJ shows significant homology to a number of proteins that are themselves in a larger family of proteins containing ATP-binding subunits (55). It has been postulated that PapJ, through the binding and utilization of A TP, may energize the process of pilus assembly, perhaps through confonnational modification of the proteins that interact with PapD. Assembly of the multiple pap gene products into an oligomeric pilus structure requires the coordinate expression of PapC and PapD. The PapD protein is localized to the periplasm and fonns 1:1 complexes with PapE and PapF, and probably also with PapA and PapG (65, 67). It is thought that the PapD protein stabilizes and then transports these proteins to the outer membrane-associated PapC protein (64, 65). PapC is speculated to function as a transmembrane channel that acts as a polymerization center for the assembly of the pilus. In two related studies, it was demonstrated that the fonnation of a Pap pilus structure 5 and the ability of bacteria containing pap DNA sequences to agglutinate red blood cells (RBCs) were genetically dissociable (31, 66). Specifically, nonpolar mutations in the papA gene did not prevent agglutination of RBCs. However, the papC and papD genes, as well as the genes for the minor pilins papE and papF and the adhesin gene, papG, were necessary for agglutination. Mutations downstream of the papD gene allowed the production of pilus structures containing PapA, the major pilin subunit, but the ability of these pili to agglutinate RBCs was abolished. These studies indicated that pili could be produced in the absence of the minor pilins and the adhesin protein. Furthermore, they demonstrated that these minor pilins and the adhesin protein could be expressed on the bacterial surface in a functional configuration in the absence of the PapA pilus component. Regulation of Pilin (PapA) Gene Expression Re2ulation by PapB and Papl The regulation of the production and assembly of Pap pili is complex and is probably controlled at the transcriptional, translational and posttranslationallevels. The regulation of expression of the major pilin subunit, PapA, has been extensively studied. The papB and the papA genes are contained on a polycistronic mRNA such that initiation of transcription of the papA gene occurs just upstream of the papB gene at the papBA promoter (59, 68). The pap/ gene and the papB/papA genes are transcribed from divergent promoters that are contained within an approximately 500 base pair (bp) regulatory region which separates these genes. Efficient transcription of the papA gene was shown to be dependent on the presence of the regulatory region and both the papB and pap/ gene products (59). This study was done using a variety of lacZ gene fusion constructs in which the lacZ gene was transcriptionally fused to the papA gene. p-galactosidase activity was then used as a measure of the transcriptional activity of the papB promoter. Because papB and papA are on a polycistronic message, these fusions reflect transcription of the papA gene. The presence of the pap regulatory region was found to have a large influence on the transcriptional activity from the papBA promoter since transcriptional activity of this promoter was 50 times greater in the presence of this region than in its absence. This 6 regulatory region dependent activation required an intact papB gene and implicated PapB as a positive activator of papA transcription. The presence of PapI in trans was also found to stimulate transcription. Very little is understooo about the mechanism of action of Pap!. Substantially more is known about the role of the PapB protein in pilin gene regulation. By measuring the level of PapA protein expression with minicells, Forsman et al. found that the level of the PapB protein in cells containing intact pap operons affected the level of PapA found in those cells (69). Since the papB and papA genes share a common promoter, these data would suggest that PapB levels are autoregulated. In this study, it was found that relatively low amounts of PapB protein induced increased expression of PapA, while higher levels of PapB caused repression of PapA expression. This indicated that the PapB protein might serve a dual role as both a positive and a negative regulator of Pap pili proouction. U sing a pap-lac fusion construct, it was shown that both the positive and negative effects of PapB on PapA expression were at the transcriptional level. In agreement with these data, gel retardation and footprinting experiments demonstrated that PapB bound to at least three sites in the pap operon (69). Two of these sites were in the regulatory region and one site was inside the papB coding region. The highest affinity site was located significantly upstream of the papB gene between positions -285 and -234 (relative to the papB transcriptional start site). The second highest affinity binding site for PapB is located near position -20. These binding sites were predicted to playa positive role in PapA expression. The third binding site was only found using high levels of PapB protein. It was located between positions +92 and + 125, inside the papB cooing region. Presumably, binding within the coding sequence of the papB gene would have a negative affect on PapB and PapA expression. The level of PapB protein in the cell is controlled at multiple stages and is influenced by PapB itself, PapI and other factors to be discussed below. One very interesting aspect of control ofPapB proouction is at the level ofmRNA stability. PapB and papA are both encoded on one polycistronic message, which would imply a similar stability for both messages. However, Baga et al. found that this polycistronic message is subject to a processing event that produces two mRNAs of differing stability (70). An mRNA cleavage 7 event, mediated by an unknown RNAse, occurs between the papB and the papA genes. The half-lives of the two resulting mRNAs differ; the mRNA for PapA has a half-life of 27 +/- 5 minutes and the half life of the mRNA for PapB is 2.5 +/- 0.5 minutes. This approximately IO-fold difference in mRNA stability would lead to an accumulation of PapA mRNA relative to that of PapB. PapA is required in a large quantity for pili production. The relative stability of its transcript would allow for greater quantities of protein to be made from small amounts of RNA. PapB, as an autoregulatory protein with both positive and negative effects, might be required in much lower amounts. The short half-life of PapB mRNA would allow for the specific limitation of PapB protein production. Catabolite repression Another aspect of regulation of expression from the papBA promoter is that of environmental control. It had been found previously that regulation of the pap operon was influenced by carbon source and by temperature (59, 71). Baga et al. found that the presence of glucose in the medium reduced the transcriptional activity from the papBA promoter presumably by lowering the intracellular level of cAMP (59). The main role of cAMP in bacteria is thought to be modulation of gene expression at the level of transcription (72, 73, 74). The operons in E. coli that are controlled by the cAMP receptor protein, CRP, in complex with cAMP comprise a global regulon called the cAMP-CRP regulon (75). The operation of this regulon involves the utilization of environmentally provided carbon and energy sources by the bacteria. Deletions of the crp gene in strains containing the papA-ZacZ gene fusions were found to eliminate transcriptional activity from the papBA promoter (59). This result, in combination with the results obtained using glucose and the presence of a consensus cAMP-CRP DNA binding site in the pap regulatory region, indicated that transcription from the papBA promoter was controlled by cAMP-CRP complex levels in the cell. It was demonstrated in a later study that CRP did bind to the consensus binding sequence within the pap regulatory region in a cAMP dependent manner (68). Furthermore, it was shown that the binding of the cAMP-CRP complex to this region positively stimulated transcription of both the papB and the pap/ genes. PapB was also shown to positively 8 regulate the pap! transcript. Interestingly, the primary PapB DNA binding site (positions -285 to -234) is near the consensus DNA binding site for the cAMP-CRP complex. The binding of PapB close to the cAMP-CRP binding site might indicate a positive regulatory role for this site. TberIDoreeulatiou As discussed above, Pap pili expression is under control by catabolite repression. Pap pili are also subject to a thermoregulatory control mechanism (71, 76 and appendix). It was originally obselVed by Goransson et al. that strains carrying plasmid-borne copies of the pap operon were able to agglutinate RBCs after growth at 37°C, but not after growth at 22°C (76). Quantitation of the major pilin subunit by an enzyme-linked immunoadsorbent assay (ELISA) indicated that the synthesis of the subunits was reduced by 20-fold at 22°C as opposed to 37°C. Measurement of ~-galactosidase activity using papA-ZacZ fusions grown at both 22°C and 37°C indicated that this temperature regulation was at the transcriptional level. PapB does not appear to playa role in thermoregulation of Pap pili expression based on data obtained with apapB insertion (knockout) mutation (76). Thermoregulation of the pap operon was shown to occur at the transcriptional level (77). Transcription of both the pap! and the papB genes was greatly reduced at 26°C. Importantly, it was demonstrated that PapI acted as a positive regulator of PapB expression, and that overproduction of PapI abrogated thermoregulation of transcription of the pap! and the papB genes. This result suggested that negative regulation of transcription through the papB promoter might be controlled at the level of PapI expression. There are several possible mechanisms by which PapI itself could modulate thermoregulation of pap expression. These mechanisms include temperature-dependent conformational changes in the PapI protein as well as temperature-dependent effects on DNA binding by Pap!. However, Goransson et al. postulated the existence of another regulatory pathway that might impinge on the transcription of the pap! gene. In this case, PapI protein would function as a "slave" to an unidentified thermoregulatory protein. Experimental data supporting this idea were generated using a papB-ZacZ fusion that contained a pap! gene deletion. Although expression was consistently low in this clone, it 9 displayed temperature-dependent regulation of papB gene expression. This supported the idea that a factor other than PapI might be involved in the thermoregulation of pap. Using spontaneous mutants that no longer showed temperature-dependent regulation of papB transcription, Goransson et al were able to demonstrate that a nonpap gene was involved in the thermoregulation of pap expression (76). In these mutant strains,the pap/ and papB genes were transcribed at 26°C. These mutations were mapped to a single gene located at 27.5 minutes on the E. coli chromosome. This gene was termed drdX for derepressed expression. DNA sequence analysis of the drdX gene showed that the deduced amino acid sequence of DrdX was identical to a previously described protein, H-NS (78). This protein appears to be a histone-like protein and is found as a heat-stable protein in deoxyribonucleoprotein particles in E. coli (79). Purified H-NS protein binds to double stranded DNA and increases the thennostability of the DNA. It is not yet clear how this protein might function to control thermoregulation of pap expression. Recently, it has been demonstrated that the gene encoding H-NS (DrdX) is identical to another previously described gene, osmZ (80). The osmZ locus has been implicated in the control of gene expression and overall DNA topology in response to environmental signals (81). Interestingly, several other mutations in addition to drdX and hns have been shown to be alleles of osmZ (80, 81, 82). One of these mutational alleles is in the pilG locus, which is involved in the regulation of the frequency of site-specific inversion during the phase variation of type 1 pili (see below) (83). Another mutation shown to be an allele of osmZ is in the bglY gene. Mutations in this gene increase the frequency of chromosomal deletions and derepress expression of the bgl operon, which is sensitive to DNA supercoiling (84, 85). Lastly, mutations in the virR gene have been shown to be osmZ alleles. VirR mutations abolish temperature-dependent regulation of virulence gene expression in Shigella flexneri (86, 87). While many genes are unaffected by mutations in osmZ, other genes have displayed either repression or derepression (80, 81, 88). All of the effects of osmZ on the various genetic loci may be secondary effects of changes in DNA supercoiling and thus share a common mode of action (81, 87). Work by White-Ziegler et al. in our laboratory (see Appendix) has shown that another nonpap gene, independent of drdX, is involved in the thermoregulation of pap 10 expression. This gene was identified by using mini-TnlO (mTnlO) insertions in the E. coli chromosome and selecting for mutations that abrogated thermoregulation at 23°C. A number of mutations were selected and mapped to approximately 23.4 minutes on the chromosome. This locus was named tcp for thermoregulatory control of pap. Mutations in this locus do not affect pap expression at 26°C as does drdX and these mutants do not exhibit many of the growth characteristics observed in hns mutants. Thus, tcp appears to influence the thermoregulation of pap expression in a manner independent of that found for the drdX gene. The mechanism of action of the tcp gene product(s) is currently under investigation. Phase Variation Pap phase variation Most of the studies discussed above were done in E. coli K-12 using multicopy plasmids containing pap sequences. None of those studies addressed regulation of pap expression in a wild-type urinary tract isolate. Low et al. addressed the regulation of pap expression in an E. coli urinary tract isolate using immunofluorescent and electron microscopic analysis of pili expression (52). In that study, the uropathogenic E. coli strain C1212 was used. C1212 contains two different pap operons, each of which is capable of producing Pap pili. The two operons encode distinct major pilin subunits: one encodes a 17 kd subunit (Pap 17) and the other encodes a 21 kd subunit (Pap21). Using specific antibodies to either Pap17 or Pap21 , it was shown that in strain C1212 about 85% of the cells expressed Pap21 pili while only about 5% of the cells expressed Pap 17 pili. Interestingly, using specific immunogold staining of either Pap 17 or Pap21 followed by electron microscopy, it was shown that a small subset of cells were able to display both Pap17 and Pap21 on their surface. All of the cells contained the DNA sequences necessary for pili expression, but not all of the cells actually produced pili. These data indicated that the expression of Pap pili was not constitutive, but was instead under regulatory control. Another very important result of this study was to show that the presence of multiple copies of Pap17 in the E. coli laboratory strain HB 101 abrogated this regulation and almost 100% of the cells produced Pap 17 pili. The cloning of Pap 17 into a 11 low copy number vector restored near wild-type levels of expression. This indicated that the regulation seen using multicopy pap sequences may not be representative of that seen in the wild-type uropathogenic strains. The regulation observed by Low et aL suggested that the expression of Pap pili was under the control of a switch mechanism by which cells could either express pili or not (phase variation). The expression ofpilus-adhesin complexes might allow organisms to colonize host tissues, but may also elicit host humoral and cell-mediated immune responses (89,90). Therefore, the expression of these pilus-adhesin complexes may have both positive and negative effects on bacterial virulence. Phase variation of expression of the pilus-adhesin complex would allow some bacteria to express these structures while others did not. Organisms that could phase vary the expression of pili on their surface might be able to colonize the host while escaping the host immune response. A number of phase variation systems have been examined and analysis of the mechanisms involved in phase variation have been carried out. The best studied of these systems include type 1 pili, Salmonella flagella and the pilus of Neisseria gonorrhoeae. While the mechanistic details of phase variation differ for each system, each of the known phase variation systems operates via an inversion, rearrangement or recombination of DNA. The details of a number of these systems and others will be presented below. Type 1 pili phase yariation E. coli which express type 1 pili alternate between a piliated and a nonpiliated state (23,91, 92). By the use of lacZ fusions to the major pilin subunit (ftmA), Eisenstein demonstrated that the phase variation of type 1 pili was under transcriptional regulation (93). Furthermore, it was shown that the phase variation between a piliated (phase on) and a nonpiliated (phase oft) state was RecA independent and occurred at the rate of 10-3 events/ceIVgeneration. DNA sequence analysis of semipurified populations of phase on and phase off cells showed that a 314 base pair (bp) DNA segment immediately preceding the fimA gene was in a different orientation for the phase on and the phase off states (94, 95). This 314 bp fragment of DNA contains thefimA promoter. When the fragment is in one orientation, the promoter is oriented so as to allow expression of the fimA gene, 12 whereas the opposite orientation precludes expression (95, 96). A number of genes are involved in phase variation of type 1 pili. ThefimB andfimE (hyp) genes are located upstream of the 314 bp region and are homologous to each other (96, 97, 98, 99, 100). Their products show homology to the A integrase protein as well as to the integrase proteins of bacteriophages P2, 186, P22 and PI (101, 102). FimB is necessary to switch cells from phase off to phase on while FimE is necessary for the switch from phase on to phase off (96), FimE mutations also increase the number of pili expressed on the cell surface, suggesting that FimE may serve as a repressor offimA expression (103). Several host encoded proteins are also involved in type 1 pili phase variation. Upstream of the 314 bp fragment is a consensus DNA binding site for integration host factor (IHF), which is required for a number of cellular processes as well as the integration of phage A (104, 105). Cells that are defective in IHF production do not display phase variation of type 1 pili expression (101, 102). Another host function that affects phase variation is mediated by the product of the pUG locus (also known as hns; see above) (83). Mutations in this locus cause hyper-switching of type 1 expression. The pUG locus is involved in DNA supercoiling and also affects other loci normally regulated by supercoiling levels (see above) (81). Fla2ella pbase variation in Salmonella Another well studied system is that of the phase variation of S. typhimurium flagellar antigens. Salmonella can normally express two antigenic ally different flagella designated HI and H2 derived from separate genetic loci hI and h2 (106, 107, 108). Similar to the mechanism of type 1 pili phase variation, Salmonella flagellar phase variation (or antigenic variation) is mediated by a DNA inversion event (109, 110, 111). The inversion occurs upstream of the H2 gene. A 996 bp segment of DNA containing the H2 promoter can be in one of two orientations. One orientation allows for expression from the H2 promoter, the other does not. This promoter also controls the expression of the rHI gene, which is a trans acting repressor of hI expression (112, 113). Therefore, when H2 is expressed, the repressor for HI is also expressed, thereby allowing only H2 flagella to be produced. 13 Conversely, when H2 is not expressed there is no repression of HI production and flagella of this type are produced. The 996 bp DNA segment is flanked by two 26 bp sites known as hixL and hixR which share partial homology (114). A recombinational event between these two sites leads to the inversion of the 996 bp fragment. This recombinational event is controlled by the Bin recombinase, which is encoded by the hin gene located within the 996 bp invertible fragment (115, 116). The recombinational event also requires the presence of a 60 bp DNA recombinational enhancer site and two other host proteins, Fis and HU (114, 115). Fis interacts with the enhancer element and HU acts to increase the efficiency of the recombinational event, presumably by facilitating DNA bending (117, 118). All of these proteins and DNA binding sites act together to form a tertiary protein-DNA complex which mediates the breakage and rejoining of DNA at the hix sites (119). A number of other inversion systems exist that are related to the Hin mediated inversion events in Salmonella. These systems contain genes for recombinases (gin, cin and pin) which are all similar to hin. The gin, cin and pin genes encode recombinases which mediate inversion in bacteriophages Mu, PI and the e14-defective prophage in E. coli respectively (120, 121, 122). The four different recombinase genes are able to complement one another for mediation of their specific inversion events (122, 123, 124). Moraxella bovis pili phase variation Moraxella bovis is the primary cause of infectious bovine keratoconjunctivitis that can cause blindness in cattle (125, 126, 127). Both pili and hemolysin production were shown to be important for virulence, and only piliated strains were able to infect cattle (128). Phase variation between piliated and nonpiliated colonies occurs at about the rate of 1 in 10,000 cells per generation (129). The phase variation of the pilin genes in M. bovis is, like that of type 1 pili and Salmonella flagella, caused by a DNA inversion (130). The mechanism of this phase variation, however, is less well-understood than that of the other systems. It has been shown that strain Epp63 produces two types of pilin, a. and ~ (131). Inversion of a 2 kb region of DNA which contains portions of both the a and ~ pilin genes appears to be responsible for the phase variation between the two types (130). The 14 inversion seems to occur within the amino terminal portion of the genes and positions the carboxy terminal of either the a and ~ gene proximal to a promoter and the amino terminus. In this way only one pilin gene can be expressed at any given time. It is not known what other protein(s) are involved in this inversion event. Neisseria fonorrhoeae pili phase variation N.gonorrhoeae has the ability to vary both the phase of expression and the antigenicity of the pili on its surface (132, 133, 134, 135, 136). The mechanism by which the antigenic and phase variation occurs differs from that of either type 1 pili or Salmonella flagella phase variation. There are a number of silent copies of the pilin subunit gene (PU) located at a single locus (pilS) on the chromosome (137, 138, 139). These genes are not capable of expression of the subunit because they lack the amino terminal portion of the gene. In many bacteria there is a single pilin expression locus (PilE) which is genetically separate from the pilS locus (137, 138, 140, 141, 142). Antigenic variants have different pilin subunit sequences in the expression locus, but have not lost sequences from the pilS silent locus. The antigenic variation is mediated by a RecA dependent mechanism which involves a nonreciprocal exchange of genetic information between the pilS and the pilE loci (132, 139, 140, 141, 143). The silent pilin genes in the pilS locus are surrounded by DNA sequences homologous between the pilS and the pilE loci (139, 144). It is likely that these conserved regions mediate the gene conversion between the two loci. These conserved regions may also encode functional or structural properties of the pilin subunit (132, 139). The coding sequences located in the pilS locus encode the variable, highly antigenic, regions of the pilin subunit. Repetitive sequences located in the silent gene copies and in the expression locus may indicate some preference for certain coding regions (139). The conversion between the pilS and the pilE loci that leads to antigenic variation is also responsible for phase variation of pilus expression. Nonpiliated strains usually contain coding sequences at the pilE locus that contain missense or nonsense regions (132, 145). These strains can revert to the piliated state simply by the nonreciprocal recombination of a functional coding region into the pilE locus. Nonpiliated strains that 15 harbor a deletion in conserved regions of the pilE locus are, in general, nonreverting, but can revert if the strain contains mUltiple pilE loci (137, 141, 142). Some nonpiliated strains also result from mutations in the genes of the trans acting regulatory factors PilA and PilB (146). Borrelia hermsii ymp pbase ya riation Several surface proteins of Borrelia hermsii, the causative agent of relapsing fever, undergo antigenic variation of outer membrane proteins by a mechanism similar to that of N. gonorrhoeae pilin antigenic variation (147). These outer membrane proteins have been termed variable major proteins (Vmp's). Several different genes encoding these proteins are located on linear plasmids in the organism (148). These linear plasmids have covalently closed ends and exist in multiple copies which may serve to facilitate a more rapid evolution of the Vmp proteins (148, 149). Like N. gonorrhoeae pili, the genes for these proteins reside in either silent loci or in an expression locus (148). The silent copies do not appear to contain all of the information necessary for gene expression, whereas the expression locus encodes this information. Recombination between the silent and expression loci allows the organism to change the coding sequence in the expression locus and, therefore, to change the surface protein (150). Neisseria gonorrhoeae PII protein antil:enic pbase variation Another antigenic and phase variation system in N. gonorrhoeae, different mechanistically from that of the pilin genes, is that of the PII, or opacity, protein (151, 152, 153, 154). This protein appears to be important to a number of gonoccocal functions in the host including immune resistance, adherence, survival in serum and colonization (153, 155, 156). Different isolates may each produce several different antigenic varieties of the PII protein or no PII protein at all (157, 158, 159, 160). The different PII proteins all share a number of conserved regions, but have two distinct, highly antigenic, hypervariable regions. Like the gonoccocal pilus, several different genes for PII protein exist on the chromosome, but unlike the gonoccocal pilus system all of these genes are full length (159). Antigenic variation of the PI! protein may be due to a gene conversion event 16 mediated by homology between conserved regions surrounding the hypervariable regions of the genes (157, 159). There are no silent loci for PH expression in N. gonorrhoeae (159). Therefore, all of the genes for the different PH proteins are constitutively transcribed in each cell. The number and antigenic type of the PH proteins actually expressed on the cell surface is determined posttranscriptionally. Internal to the hydrophobic signal sequence of the protein are a variable number of repeats of the sequence CfCIT (159,161). The DNA coding region for the signal sequence can gain or lose copies of this repetitive sequence, probably during replication, through slipped strand mispairing of DNA (161, 162). Only those sequences that maintain a continuous open reading frame through this region can be successfully translated. The switch from PH+ to PH- and back again is therefore mediated by this frame shifting of the signal sequence coding region (159, 161). Haemophilus influenzae LPS phase variation The phase variation of Haemophilus injIuenzae lipopolysaccharide (LPS) is mediated by a mechanism similar to that of N. gonorrhoeae PH protein (163). Several studies have given evidence that LPS is involved in the pathogenicity of H. inj1uenzae (164, 165, 166). U sing monoclonal antibodies, it has been demonstrated that a number of antigenic variants of LPS exist and that the LPS undergoes phase variation between epitopes at the relatively high frequency of 10-2/cell/generation (167). A single strain is capable of both coordinate and independent phase variation of a number ofLPS types (168). A chromosomal locus, lic-l, is responsible for the control of expression of at least three different LPS structures that display a phase variation phenotype (168). The lic-llocus appears to be a single transcriptional unit encoding four proteins necessary for LPS expression. Similar to the phase variation seen in PH expression of N. gonorrhoeae, phase variation of the epitopes at the lic-llocus appears to occur through a recombinational event within tandem repeats of a 4 bp sequence (CAAT) located within the coding region of the first open reading frame of the locus (163). DNA sequence analysis has shown that approximately 30 CAA T repeats occur just downstream of several potential A TO codons of the first open reading frame. Weiser et al. were able to demonstrate that if 17 29 copies of the CAA T sequence existed there would be no expression of protein from the gene; however, 30 copies of the sequence gave a low expression and 31 copies gave a high expression. Since the repeat consists of four bases, the loss or gain of one through a recombinational event will cause a frameshift in the coding region. It is presumably this frameshifting, in relation to the several ATG codons, that mediates the phase variation of expression of the genes in the locus and, therefore, the expression of LPS variants on the cell surface. Bordetella pertussis pili phase variation Another phase variation system whose mechanism involves repetitive sequences is that of Bordetella pertussis pilus expression (169). B. pertussis is the causative agent of whooping cough. A number of Bordetella-encoded factors have been implicated in its virulence including toxins and pilus associated adhesins (170, 171). B. pertussis produces two antigenic ally distinct pili, serotype 2 and serotype 3 (172, 173, 174). The expression of B. pertussis virulence genes is regulated, in part, through the bvg locus, which encodes three proteins involved in sensory transduction (175, 176, 177). The pilus genes (jim) are also regulated by the bvg system, but are subject to a phase variation mechanism which is regulated independently of bvg control (169). The phase variation control mechanism operates at the level of the individual jim genes. A particular jim gene is switched between a high and a low level of expression. Willems et al. found that a 100 bp region upstream of thefim3 gene (serotype 3 pili) mediated this phase variation, and this region is also found in thefim2 gene (serotype 2 pili) (169). This region contains the promoter for thefim gene and has a run of C residues in it. DNA sequence analysis of piliated or nonpiliated strains indicated that insertions or deletions of 1-5 bp in the C run is responsible for the phase variation. These insertions or deletions change the spacing between the -10 box of the promoter and a conserved DNA sequence known as AB (for activator binding). It is assumed that the distance between these two elements is critical for expression of the fim genes. The exact mechanism for the insertion or deletion of bases in runs of reiterated bases is not known, but they have been shown to be hotspots for duplications (insertions) and deletions, presumably due to transient 18 misalignment during DNA replication (178). These types of mutations at runs of reiterated bases have also been shown to have an effect in the piliated to nonpiliated transition of N. gonorriweae (143). Introduction to Work Presented in Thesis As discussed above, there are a number of different mechanisms of phase variation in different organisms. These mechanisms all share the common feature of a change in the DNA structure, either a DNA rearrangement or an insertion/deletion of DNA. Previously, it had been shown that Pap pili also undergo phase variation of expression (52), but the mechanism of this phase variation was not investigated. The major focus of this thesis is to understand the regulation of Pap pili phase variation in E. coli and the mechanism by which this phase variation occurs. As the data presented in this thesis will indicate, Pap pili phase variation is affected by a number of environmental factors including temperature and carbon source. Furthermore, Pap pili do not phase vary by any of the above discussed mechanisms. No DNA rearrangements or base pair changes occur during Pap phase variation. Rather, this phase variation appears involve differential adenine methylation at two sites within the pap regulatory region. The implications and possible global effects of this mechanism will be discussed. 19 References 1. B. B. Finley, S. Falkow, Microbiol. Rev. 53, 210-230 (1989). 2. G. Reid, J. D. Sobel, Rev. Infect. Dis. 9, 470-487 (1987). 3. R. H. Rubin, N. E. Tolkoff-Rubin, R. S. Cotran, in The Kidney J. B. M. Brenner and F. C. Rector, Eds. (The W. B. Saunders Co., Philadelphia, 1986), pp. 1058- 1141. 4. E. Abraham, B. E. Brenner, R. R. Simon, Ann. Emerg. Med 12, 228-234 (1983). 5. B. Hovelius, P. Mardh, Rev. Infect. Dis. 6, 328- (1984). 6. K. L. Vosti, L. M. Goldberg, A. S. Momto, L. A. Rantz, I. Clin.Invest. 43, 2377- 2385 (1964). 7. T. A. Stamey, M. Timothy, M. Millar, G. Mihara, Calif. Med 115, 1-19 (1971). 8. J. E. Fowler, T. A. Stamey, I. Urol. 117,472-476 (1977). 9. A. P. Roberts, R. Phillips, I. Clin. Pathol. 32,492- (1979). 10. C. Hughes, J. Hacker, A. Roberts, W. Goebel, Infect. Immun. 39, 546-551 (1983). 11. C. Svanborg-Eden, et al., Ciba. Found. Symp. 80, 161-187 (1981). 12. C. Svanborg-Eden, E. C. Gotschlich, T. K. Korhonen, H. Leffler, G. Schoolnik, Prog. Allergy 33, 189-202 (1983). 13. C. Svanborg-Eden, L. A. Hanson, U. Jodal, U. Lindberg, A. S. Akerlund, Lancet 2, 490-492 (1976). 14. A. J. Schaeffer, S. K. Amundsen, L. N. Schmidt, Infect. Immun. 24, 753-759 (1979), 15. G. Kallenius, et aI., Lancet 2, 1369-1372 (1981). 16. T. K. Korhonen, H. Leffler, C. Svanborg-Eden, Infect. Immun. 32, 796-804 (1981). 17. L. Hagberg, et al., Infect. Immun. 40, 265-272 (1983). 18. M. Aronson, et al., I. Infect. Dis. 139, 329-332 (1979). 20 19. H. Leffler, C. Svanborg-Eden, Infect. Immun. 34,920-929 (1981). 20. A. J. Schaeffer, J. M. Jones, J. K. Dunn, N. Engl. 1. Med. 304, 1062 (1981). 21. R. V. Vaisanen, Infect. Immun. 46,401-407 (1984). 22. J. P. Duguid, D. C. Old, in Bacterial adherence, Receptors and recognition E. H. Beachey, Eds. (Chapman and Hall, London, 1980), pp. 185-217. 23. C. C. J. Brinton, Nature 183, 782-786 (1959). 24. 1. D. Ofek, D. Mirelman, N. Sharon, Nature 265, 623-625 (1977). 25. E. Blumenstock, K. Jann, Infect. Immun. 35, 264-269 (1982). 26. 1. E. Salit, E. C. Gotschlich, 1. Exp. Med. 146, (1977). 27. 1. E. Salit, E. C. Gotschlich,l. Exp. Med. 146, 1169-1181 (1977). 28. D. C. Old, 1. Gen. Microbiol71, 149-157 (1972). 29. B. 1. Eisenstein, Rev. Infect. Dis. 10, 341-344 (1988). 30. F. C. Minion, S. N. Abraham, E. H. Beachey, J. D. Goguen, 1. Bacteriol. 165, 1033-1036 (1986). 31. M. Norgren, et al., EMBO 1.3, 1159-1165 (1984). 32. B. E. Uhlin, etal., Curro Top. Microbiol. Immunol. 118, 163-178 (1985). 33. S. N. Abraham, D. Sun, 1. B. Dale, E. H. Beachey, Nature 336, 682-684 (1988). 34. R. Freter, G. W. Jones, Rev. Infect. Dis. 5, 647-658 (1983). 35. J. P. Duguid, M. R. Darekar, D. W. Wheater, 1. Med. Microbiol. 9, 459-473 (1976). 36. S. M. Kuriyama, F. J. Silverblatt, Infect. Immun. 51, 193-198 (1986). 37. V. Israele, A. Darabi, G. H. J. McCracken, Am. 1. Dis. Child. 141, 1230-1234 (1987). 38. I. Orskov, A. Ferencz, F. Orskov, Lancet i, 887 (1980). 21 39. T. K. Korhonen, et al., J. Bacteriol. 159, 762-766 (1984). 40. B. Nowicki, J. Vuopio-Varkila, P. Viljanen, T. K. Korhonen, P. H. Makela, Microb. Pathogen. 1, 335-247 (1986). 41. T. Schmoll, M. Ott, B. Oudega, J. Hacker, J. Bacteriol. 172, 5103-5111 (1990). 42. R. A. Labigne-Roussel, M. A. Schmidt, W. Walz, S. Falkow, J. Bacteriol. 162, 1285-1292 (1985). 43. A. Labigne-Roussell, S. Falkow, Infect. Immun. 56, 640-648 (1988). 44. B. Nowicki, et al., Infect. Immun. 58, 279-281 (1990). 45. V. Vaisanen-Rhen, Infect. Immun. 46,401-407 (1984). 46. B. Nowicki, J. P. Barrish, T. Korhonen, R. A. Hull, S. I. Hull, Infect. Immun. 55,3168-3173 (1987). 47. B. Nowicki, J. Moulds, R. Hull, S. Hull, Infect. Immun. 56,1057-1060 (1988). 48. V. Vaisanen, et al., Lancet 2, (1981). 49. S. B. Svenson, et al., Infection 11, 61-67 (1983). 50. G. Kallenius, et al., FEMS Microbiol. Lett. 7, 297-302 (1980). 51. R. Hull, S. Bieler, S. Falkow, S. Hull, Infec. Immun. 51, 693-695 (1986). 52. D. Low, 1. E. N. Robinson, Z. A. McGee, S. Falkow, Mol. Microbiol. 1, 335-346 (1987). 53. S. I. Hull, S. Bieler, R. Hull, Can. J. Microbiol. 34, 307-311 (1988). 54. K. Plos, T. Carter, S. Hull, R. Hull, C. Svanborg-Eden, 1. Infect. Dis. 161, 518- 524 (1989). 55. J. M. Tennent, F. Lindberg, S. Normark, Molec. Microbiol. 4, 747-758 (1990). 56. M. Baga, M. Norgren, S. Normark, Cell 49, 241-251 (1987). 57. S. Normark, et al., in Microbiallectins and agglutinins: Properties and biological activity D. Mirelman, Eds. (John Wiley and Sons, Inc., New York, 1985), 22 58. B. E. Uhlin, M. Norgren, M. Baga, S. Nonnark, Proc. Nat'l. Acad. Sci. USA 82, 1800-1804 (1985). 59. M. Baga, M. Goransson, S. Nonnark, B. E. Uhlin, EMBO 1.4, 3887-3893 (1985). 60. B. Lund, F. Lindberg, S. Normark, l. Bacteriol. 170, 1887-1894 (1988). 61. B. Lund, F. Lindberg, B. I. Marklund, S. Nonnark, Proc. Nat'l. Acad. Sci. USA 84, 5898-5902 (1987). 62. F. Lindberg, B. Lund, L. Johansson, S. Normark, Nature 328, 84-87 (1987). 63. F. Lindberg, B. Lund, S. Normark, Proc. Nat'l. Acad. Sci. USA 83, 1891-1895 (1986). 64. M. Norgren, M. Baga, J. M. Tennent, S. Nonnark, Mol. Microbiol. 1, 169-178 (1987). 65. F. Lindberg, J. M. Tennent, S. J. Hultgren, B. Lund, S. Nonnark, 1. Bacteriol. 171,6052-6058 (1989). 66. F. P. Lindberg, B. Lund, S. Normark, EMBO 1.3, 1167-1173 (1984). 67. S. J. Hultgren, et al., Proc. Nat'l. Acad. Sci. USA 86, 4357-4361 (1989). 68. M. Goransson, K. Forsman, P. Nilsson, B. E. Uhlin, Mol. Microbiol. 2, 1557- 1565 (1989). 69. K. Forsman, M. Goransson, B. E. Uhlin, EMBO 1. 8, 1271-1277 (1989). 70. M. Baga, M. Goransson, S. Normark, B. E. lThlin, Cell 52, 197-206 (1988). 71. M. Goransson, B. E. Uhlin, EMBO 1. 3, 2885-2888 (1984). 72. S. Adhya, S. Garges, Cell 29, 287-289 (1982). 73. B. d. Crombrugghe, S. Busby, H. Buc, Science 224, 831-838 (1984). 74. A. Ullman, A. Danchin, Adv. Cyclic Nucleotide Res. 15, 1-53 (1983). 75. B. Magasanik, F. C. Neidhardt, in Escherichia coli and Salmonella typhimuriwn cellular and molecular biology F. C. Neidhardt, et al., Eds. (American Society for Microbiology, Washington D.C., 1987), pp. 1318-1325. 23 76. M. Goransson, et a/., Nature 344, 682-685 (1990). 77. M. Goransson, K. Forsman, B. E. Uhlin, 3,123-130 (1989). 78. M. Falconi, M. T. Gualtieri, A. L. Teana, M. A. Losso, C. L. Pon, Molec. Microbiol. 2, 323-329 (1988). 79. A. Spassky, S. Rimsky, H. Garreau, H. Buc, Nucleic Acids Res. 12, 5321-5340 (1984). 80. C. S. 1. Hulton, et al., Cell 63, 631-642 (1990). 81. C. F. Higgins, et al., Cell 52, 569-584 (1988), 82. C. F. Higgins, et al., Mol. Microbiol. in press, (1990). 83. P. A. Spears, D. Schauer, P. E. Orndorff, J. Bacteriol. 168, 179-185 (1986). 84. R. Defez, M. DeFelice, Genetics 97, 11-25 (1981). 85. P. Lejeune, A. Danchin, Proc. Natl. Acad. Sci. USA 87, 360-363 (1990). 86. A. T. Maurelli, P. J. Sansonetti, Proc. Natl. Acad. Sci. USA 85, 2820-2824 ( 1988). 87. C. 1. Donnan, N. NiBhriain, C. F. Higgins, Nature 344,789-792 (1990). 88. K. A. Graeme-Cook, G. May, E. Bremer, C. F. Higgins, Mol. Microbiol 3, 1287- 1294 (1989). 89. E. C. Tramont, 1. W. Boslego, Vaccine 3, 3-10 (1985). 90. H. Karch, et al., Microb. Pathogen. 2,425-434 (1987). 91. L. M. Swaney, Y. P. Liu, C. M. To, C. C. To, K. Ippen-Ihler, J. Bacteriol. 130, 495-505 (1977). 92. L. M. Swaney, Y. P. Liu, K. Ippen-Ihler, C. C. B. Jr., J. Bacteriol. 130, 506-511 (1977). 93. B. I. Eisenstein, Science 241, 337-339 (1981). 94. C. S. Freitag, 1. M. Abraham, J. R. Clements, B. I. Eisenstein, J. Bacteriol. 162, 668-675 (1985). 24 95. J. M. Abraham, C. S. Freitag, J. R. Clements, B. I. Eisenstein, Proc. Natl. Acad. Sci. USA 82, 5724-5727 (1985). 96. P. Klemm, EMBO 1.5, 1389-1393 (1986). 97. P. E. Orndorff, P. A. Spears, D. Schauer, S. Falkow, 1. Bacteriol. 164,321-330 (1985). 98. P. E. Orndorff, S. Falkow, 1. Bacteriol. 162, 454-457 (1985). 99. P. E. Orndorff, S. Falkow, 1. Bacteriol. 159, 736-744 (1984). 100. P. Klemm, B. J. Jorgensen, I. v. Die, H. d. Ree, H. Bergmans, Mol. Gen. Genet. 199, 410-414 (1985). 101. B. I. Eisenstein, D. S. Sweet, V. Vaughn, D. 1. Freidman, Proc. Natl. Acad. Sci. USA 84, 6506-6510 (1987). 102. D. J. Dorman, C. F. Higgins, 1. Bacteriol. 169, 3840-3843 (1987). 103. P. E. Orndorff, S. Falkow, 1. Bacteriol. 160,61-66 (1984). 104. J. M. Leong, et al., 1. Bioi. Chern. 260,4468-4477 (1985). 105. M. A. Hoyt, D. M. Knight, A. Das, H. 1. Miller, H. Echols, Cell 31, 565-573 (1982). 106. B. A. D. Stocker,l. Hygiene 47, 398-413 (1949). 107. T. lino, Bacteriol. Rev. 33, 454-475 (1969). 108. J. Lederberg, T. lino, Genetics 41, 743-757 (1956). 109. J. Zieg, M. Silverman, M. Hilmen, M. Simon, Science 196, 170-172 (1977). 110. J. Zieg, M. Hilmen, M. Simon, Cell 15, 237-244 (1978). 111. J. Zieg, M. Simon, Proc. Natl. Acad. Sci. USA 77, 4196-4200 (1980). 112. M. Silverman, J. Zieg, M. Simon, 1. Bacteriol. 137,517-523 (1979). 113. T. lino, Annu. Rev. Genet. 11, 161-182 (1977). 114. R. C. Johnson, M. 1. Simon, Cell 41, 781-791 (1985). 25 115. R. C. Johnson, M. F. Bruist, M. I. Simon, Cell 46, 531-539 (1986). 116. M. Silvennan, M. Simon, Cell 19, 845-854 (1980). 117. R. C. Johnson, A. C. Glasgow, M. I. Simon, Nature 329, 462-465 (1987). 118. M. F. Bruist, A. C. Glasgow, R. C. Johnson, M. I. Simon, Genes Dev. 1,762- 772 (1987). 119. M. F. Bruist, S. J. Horvath, L. E. Hood, T. A. Steitz, M. I. Simon, Science 235, 777 -780 (1987). 120. R. H. A. Plasterk, A. Brinkman, P. v. d. Putte, Proc. Natl. Acad. Sci. USA 80, 5355 (1983). 121. P. Kamp, et al., Cold Spring Harbor Symp. Quant. BioI. 43, 1159-1167 (1979). 122. S. !ida, J. Meyer, K. Kennedy, W. Arber, EMBO J. 1, 1445-1453 (1982). 123. K. Kutsukake, T. lino, Proc. Natl. Acad. Sci. USA 77, 7338-7341 (1980). 124. P. Kamp, R. Kahmann, Mol. Gen. Genet. 174, 564-566 (1981). 125. D. E. Hughes, G. W. Pugh, J. Am. Vet. Med. Assoc. 157, 443-451 (1970). 126. J. B. Henson, L. C. Grumbles, Am. J. Vet. Res. 21,761-766 (1960). 127. C. H. Gallaghar, Aust. Vet. J. 30, 61-68 (1954). 128. K. B. Pedersen, L. O. Froholm, K. Bovre, Acta Pathol. Microbiol. Scand. Sect. B 80,911-918 (1972). 129. K. Bovre, L. O. Froholm, Acta Pathol. Microbiol. Scand. Sect. B 80,629-640 (1972). 130. C. F. Marrs, W. W. Ruehl, G. K. Schoolnik, S. Falkow, J. Bacteriol. 170, 3032- 3039 (1988). 131. C. F. Marrs, et al., J. Bacteriol. 163, 132-139 (1985). 132. J. Swanson, et al., J. Exp. Med. 165, 1344-1357 (1987). 133. J. Swanson, S. J. Kraus, E. C. Gotschlich, J. Exp. Med. 134, 886-906 (1971). 26 134. J. Swanson, O. Barera, 1. Exp. Med. 158, 1459-1472 (1983). 135. P. F. Sparling, J. G. Cannon, M. So, 1. Infect. Dis. 153, 196-201 (1986). 136. T. M. Buchanan, 1. Exp. Med. 141, 1470-1475 (1975). 137. 1. Swanson, S. Bergstrom, K. Robbins, O. Barrera, D. Corwin, Cell 47, 267-276 (1986). 138. E. Segal, P. Hagblom, H. S. Seifert, M. So, Proc. Natl. Acad. Sci. USA 83, 2177- 2181 (1986). 139. R. Haas, T. F. Meyer, Cell 44, 107-115 (1986). 140. T. F. Meyer, N. Mlawer, M. So, Cell 30, 45-52 (1982). 141. E. Segal, E. Billyard, M. So, S. Storzbach, T. F. Meyer, Cell 40, 293-300 (1985). 142. J. Swanson, S. Bergstrom, O. Barrera, K. Robbins, D. Corwin, J. Exp. Med. 162, 729-744 (1985). 143. M. Koomey, E. C. Gotschlich, K. Robbins, S. Bergstrom, 1. Swanson, Genetics 117,391-398 (1987). 144. R. Haas, H. Schwarz, T. F. Meyer, Proc. Natl. Acad. Sci. USA 84, 9079-9083 (1987). 145. S. Bergstrom, K. Robbins, J. M. Koomey, 1. Swanson, Proc. Natl. Acad. Sci. USA 83, 3890-3894 (1986). 146. M. K. Taha, M. So, H. S. Seifert, E. Billyard, C. Marchal, EMBO 1.7,4367-4378 (1988). 147. A. G. Barbour, Rev. Infect. Dis. 10, S399-S402 (1988). 148. R. H. A. Plasterk, M. I. Simon, A. G. Barbour, Nature 318, 257-263 (1985). 149. A. G. Barbour, C. F. Garon, Science 237, 409-411 (1987). 150. J. T. Meier, M. I. Simon, A. G. Barbour, Cell 41, 403-409 (1985). 151. J. Swanson, Infect. Immun. 37,359-368 (1978). 27 152. R. S. Schwalbe, P. F. Sparling, J. G. Cannon, Infect. Immun. 49, 250-252 (1985). 153. J. F. James, J. Swanson, Infect. Immun. 19, 332-340 (1978). 154. J. L. Diaz, J. E. Heckels, 1. Gen. Microbiol. 128, 585-591 (1982). 155. M. Virji, J. S. Everson, Infect. Immun. 31, 965-970 (1981). 156. D. L. Draper, J. F. James, G. F. Brooks, R. L. Sweet, Infect. Immun. 27, 882-888 (1980). 157. T. D. Connell, et al., Mol. Microbiol. 2,227-236 (1988). 158. H. S. Seifert, M. So, Microbiol. Rev. 52, 327-336 (1988). 159. A. Stern, M. Brown, P. Nickel, T. F. Meyer, Cell 47, 61-71 (1986). 160. J. Swanson, Infect. Immun. 28, 54-64 (1980). 161. G. L. Murphy, T. D. Connell, K. S. Barritt, M. Koomey, J. G. Cannon, Cell 56, 539-547 (1989). 162. R. J. Belland, S. G. Morrison, P. v. d. Ley, J. Swanson, Mol. Microbiol. 3, 777- 786 (1989). 163. J. N. Weiser, J. M. Love, E. R. Moxon, Cell 59, 657-665 (1989). 164. A. Zwahlen, L. G. Rubin, E. R. Moxon, Microbiol. Pathogen. 1, 465-473 (1986). 165. A. Kimura, E. J. Hansen, Infect. Immunol. 51, 69-79 (1986). 166. J. R. Gilsdorf, P. Ferrieri, 1. In! Dis. 153, 223-231 (1986). 167. P. A. Gulig, C. C. Patrick, L. Hermanstorfer, G. H. M. Jr., E. J. Hansen, Infect. Immunol. 55, 513-520 (1987). 168. J. N. Weiser, A. A. Lindberg, E. J. Manning, E. J. hansen, E. R. Moxon, Infect. Immunol. 57, 3045-3052 (1989). 169. R. Willems, A. Paul, H. G. 1. v. d. Heide, A. R. 1. Avest, F. R. Mooi, EMBO 1. 9, 2803-2809 (1990). 170. A. A. Weiss, E. L. Hewlett, Annu. Rev. Microbiol. 40,661-686 (1986). 28 171. F. R. Mooi, Antonie van Leeuwenhoek 54, 465-474 (1988). 172. J. M. Zhang, et al., Infect. Immun. 48, 422-427 (1985). 173. L. I. Irons, L. A. E. Ashworth, A. Robinson, Dev. BioI. Stand. 61, 153-163 (1985). 174. L. A. E. Ashworth, L. I. Irons, A. B. Dowsett, Infect. Immun. 37,1278-1281 (1982). 175. S. Stibitz, A. A. Weiss, S. Falkow, J. Bacterial. 170,2904-2913 (1988). 176. S. Knapp, J. J. Mekalanos, J. Bacterial. 170, 5059-5066 (1988). 177. B. Arico, et al., Proc. Natl. Acad. Sci. USA 86, 6671-6675 (1989). 178. G. Streisinger, J. E. Owen, Genetics 109, 633-659 (1985). 29 CHAPTER II PHASE-VARIATION OF PYELONEPHRITIS-AS S OCIA TED PILI IN ESCHERICHIA COLI: EVIDENCE FOR TRANSCRIPTIONAL REGULATION Phase-variation of pyelonephritis-associated pili in Escherichia coli: evidence for transcriptional regulation Lawrence B.Blyn. Bruce A.Braaten. Christine A.White-Ziegler. Debra H.Rolfson and David A.Low Division of Cell Biology and Immunology. Department of Pathology. University of Utah School of Medicine. Salt Lake City. UT 84132. USA CommunIcated by S.Normark The regulation of pyelonephritis-associated pili (pap) pilin gene transcription has been examined using two operons (pap-17 and pap-21) isolated from the pyelonephritogenic Escherichia coli strain C1212. DNA sequence analysis and E.coli miniceU analysis were used to map two genes (papU and papO within the pilin regulatory regions of both pap-17 and pap-21, and the protein products of these genes were identified. Pilin transcription, initiated at the papUA promoter, was monitored by constructing single copy operon fusions with lacZYA in E.coli K-12. inocula­tion of E.coli (pap'-Iac) strains onto solid M9 minimal medium containing glycerol and the Lac indicator X-gal (M9-Glycerol) yielded both Lac+ and Lac- colony phenotypes. The Lac+ ('phase on') and Lac- ('phase off') phenotypes were heritable since reinoculation of M9-Glycerol with bacteria picked from Lac+ colonies gave rise to a much higher fraction of Lac+ colonies than reinoculation of M9-Glycerol with bacteria picked from Lac - colonies. Measurement of phase transition rates for E.coli (pap], -lac) inoculated onto M9-Gly­cerol showed that the Lac - - Lac + transition frequency (1.57 x lO-~/cell/generation) was reduced 35-fold when cells were inoculated onto minimal medium containing glucose (M9-Glucose). However, the Lac+ - Lac­transition frequency obtained using M9-Glycerol (2.60 x 1O- 2/cell/generation) was 1.4-fold lower compared to results obtained with M9-Glucose. In contrast, lowering the incubation temperature of E.coli (pap 17 , -lac) cultures from 37°C to 23°C caused all cells to shift to the Lac- state. Together, our result~ strongly indicate that pap pili phase-variation is transcriptionally regulated and show that phase-variation is responsive to changes in the bacterial environment. Kev lI'ords: gene fusionlpap/phase-variationitranscriptional regulation/urinary tract infections Introduction Most Escherichia coli that cause upper urinary tract infections (pyelonephritis) contain the pyelonephritis­associated pili (pap) gene cluster (O'Hanley et al .. 1985). The pap gene cluster consists of at least nine genes. designated as papA - pap! (Normark et al .. 1983; Norgren et al.. 1984), that are involved in the synthesis and assembly of a pilus complex at the bacterial cell surface (Lund et al .. 1988). This complex consists of a pilus fiber composed of pilin monomers encoded by papA and at least three additional proteins encoded by papE. papF and papG which appear to be located at the pilus tip (Lindberg et al., 1984; Lindberg et al., 1987). The PapG protein appears to function as the adhesin that binds to specific receptors on target host epithelial cells (Lund et al.. 1987). The pyelonephritogenic E. coli strain C 1212 contains two complete pap gene clusters, each encoding antigenically distinct pilin monomers designated as pilin-17 and pilin-21 (Low et al .. 1987). Each pap gene cluster (pap-17 and pap-21 respectively) also encodes an adhesin that binds to terminal digalactoside residues (Low et al., 1984). Using immunoelectron microscopy we showed that most bacterial cells (84%) within a colony expressed pilin-21 but only about 5 % of cells expressed pilin-17. Pilin expression appeared to be an 'all or none' phenomenon; bacteria either expressed cell surface pili or expression was not detected. Based on these results we concluded that pap pilin expression was under the control of a phase-variation mechanism; phase­variation being defined here as the oscillation of a cell between alternate expression states. In this study we constructed single copy operon fusions that placed the iacZY A operon under the control of the promoter for pilin-17 and pilin-21. Results obtained using these fusions strongly indicate that pap pili phase-variation is transcriptionally regulated. In addition, our results show that this phase-variation is heritable and is responsive to changes in both the carbon source used for growth and incubation temperature. Results DNA sequence analysis of the pap pi/in regulatory region DNA sequence analysis of the pilin genes and upstream regulatory sequences of pap-21 and pap-17 was performed as described in Materials and methods. Pap-I 7 shared more than 97% sequence similarity to pap-21 (Figure I). Computer analysis of the pap DNA sequences shown in Figure I indicated that there were two open reading frames upstream from the papA (pilin) gene. These open reading frames are preceded by potential promoters and ribosome binding sites as shown in Figure I, and correspond both in sequence and position to those of papJ and papB as shown by M.Baga et al. (1985) using a similar. but not identical. pap DNA sequence. Based on the DNA sequence, pap! and papB appear to be transcribed from divergent promoters. PapA seems not to have a separate promoter region and evidence indicates that it is co-transcribed with papB from a single promoter designated as the papBA promoter (Baga et aI., 1985, 1988). There is also a possible CAP-cAMP binding site located between the papJ and papB 31 OOT'!'SSCSOGAQfC£Gt<LFWYT GCA ,ecce ACAGA "GAG 11 ATT AAGTiGTGGAAGAAC AGCTCTGCCCCGCCTGC11C1'C1'CC'M''I'CAG..v.ACCAG' A iG a: A M G R II. L P S II. Q v M G A K £ L L L L Y 't R A Q Y i1'GCCATGCCCCGTCTTMTGG,GAGCGCTGAACCATACCTGC'M"TTTCCAG'l'AATAACAGGTMTAGCGGGCCTGG1'M : f::J T V A L A E A 1 £ A ! '" G G :J H It N L F E L : £ N " rCCGTTACCGeCAGCGCCTCTGCAA1"rTCTGCCGTTTTCCCTCCATCA'1'GCCTG'1'TCAGAAAT1CCAG'1'A'1'TTCA'1''1'CT, ... '1' ... ~41 H "f 0: S '" ~ .J..:2l!.. CAT AT II T1'CACTC II -:-C,C ACTG1' MCIuVIGTTTC,1'C::;AA l' AA T II.II.I\AA TCA TGCTCTCtG'1''1' A TCAACGGAAAGG ,A :-, •........• T •. CRP bind-in? 5i~e T!"T A nCTCT ATG1'T'!'X'l' - - - - - ~ - - - T'l' A TTTG'l''l'CAATTT AGTGAA 'l'TTGC"'I"M'1 A"t"l'GCA ""1 A 1T,GI\, :::7:; -:: ). ... G.. ..C .. 401 ~tGCG1'TTTA"tTT'l'CTGeGAAMGIl.AAGTCCGTAAAAATTCA~;~!~ACGATC1TTTATGCTG~~ ~TCAA .. T.. . .. G.. . .. T .. 481 1-1~! ! -10) 1- 35) TT'T'GCCA TGATGT ,1'TT A TCTGA G'1'AC'C'CTCTTGC1' A ,1'AGTG1'T1',G TTCT AG ,TT AA TT'Tm'Tn G TGGGTT AAAIIC .11. T.. G.II'T. ATCGT;;~1'CAATA;;;~~AACA'TAM.AMCTAAATT~A'l'TGCGTGA.AGAGTA11TCCGGGCCGGAAGCATAT ... 'P~pB+'" 641 S.D '" A H H E V I S R $ G N A r L L ~ A':'CCAGGGGCCCGACAGAAGGGGGA..Vr.CA1GGCGCA'1'CATGAAGTCATCAGTCGGTCAGGMATGCGTTTTTGCTGAATII '~l I II. E: S V L LPG S M S r M H r r L L : GIS S I H S T AC GCGAGACCGT ACTGTTCCCCGGG ,eTA TGTCT GAAA TCCA TTT"TTTT ACTGA T AGGT A TT,CTTCT ATTCACA::;1' 1101 D R V I LAM " D Y t. V G G H S FI " I: V CEil: Y Q M N GACAGGGTCATTC1'GGCTATGAAGGACTATCTCG'AGGTCGGCAC-:-CCCG1'AAGGAGG1'CTCCGAC.MATACCAGATGAA NGYFSTTLGFlLIRLNALAAJlLAPYY":' TAATGGGTA1'1'TCAG1'ACAACACTOGGGAGAC':'TATACGGCTGAATGeTCT1'GC"-GCAAGGCT1'GCACC!'rAT1ATACAG <jEl D E: S S A r D ° ATGAGTCCTCCiGCATTTGACTAAA'rTATGGCAT'TCCGGAGTnC'tGGMGAT.v.AAAAAGAAGCCCTTATCAGIl.AAGCAG •••..• G ACAGG,T A l' ATCA",T II 1'1'CTGTC GAT IIAA T AACCTGC CCTGAAA- l' -,eGAGAA T A TT A 1'T1'GT A 'TTGA 1'C1AG1'T A TT AA .. A.. .G .. PapA+- : 1::' 1 AGG'tAA1CGGC1CATlTTAAAT1"GCCAGAi ATCTCTCGTGTGT1"CAGT.v.1G~~r1GTT"T1-r"~G .. A Fig. I. DNA sequence analysis of the pap-17 and pap-21 regulatory regions. The DNA sequence of the pi lin regulatory· regions of pap-17 and pap-21 was detenntned by the method of Sanger el at. (1977) and described in Materials and methods. The pap-17 DNA sequence is presented on the top line. The pap-21 DNA sequence is presented below. with dots Indicating the same nucleotide as shown on the line above. The absence of nucleoude base-pairs in one DNA sequence is shown by dashes and the one-lener amino aCid code is given above the codons of the predicted open reading frames. The PapA DNA sequence for both pap-17 and pap-21 will be presented elsewhere (Blyn. Braaten. Wals_ Low and O·Hanley. in preparation). genes. The small number of differences between the pap-17 and the pap-21 sequences were concentrated in the regulatory region located between papi and papS. Analysis of proteins encoded by pap-17 and pap-21 The proteins encoded by pap-I 7 and pap-21 were analyzed using E.coli minicells (Dougan and Kehoe. 1984). Analysis was facilitated by constructing plasmids that contained portions of pap-17 and pap-21 (Figure 2 and Materials and methods). These plasmid constructs were transformed into the E.coli minicell strain ORNI03 (Orndorff el al .. 1985). Minicells were isolated by sucrose gradient centrifugation. and eSS]methionine labeled proteins were resolved by electrophoresis on modified SDS - PAGE gels which allowed the resolution of low mol. WI proteins (Giulian el al .• 1985). Our results indicated that the pap-17 and pap-21 pilin regulatory regions shown in Figure I encode two proteins of - 10 and 12 kd respectively (Figure 3A, lanes 4 and 5; Figure 3B. lanes 2 and 3). In addition. a 16 kd protein was encoded by pap-l7 DNA sequences containing a portion of the paPI7H gene (Figure 2. plasmids pDALl7H-1O and pDAL258B and Figure 3A, lanes 3 and 4). Based on DNA sequence analysis (our unpublished data). it seems likely that L-____________ ~r_--_t!~,,,~~E paPZ1I "P118 paPd" S HH H L-------~r-~~I,~~­\ lU1]I .... " HI S HH H HI LI -------~r_--~!~,~s~SS~ ___ ' pql17I pa'b'1 pO~l261B (p~SS51) pD~L245B (P~SS'51) pDAl17B·2) (PUCS) pDAL 17B·5 (pUCS) HI H H E'I C HI ~PDAl17H.'O /MPnI P~178 paPn'olo. pe.~]H (pUCS) 100bp Fig, 2. Plasmid deletion constructs containing pap-17 and pap-21 DNA sequences. Hatched bars represent open reading frames which correspond to the gene shown below each bar I detennined by deletion mapping (see text)]. Broken hatched bars indicate interrupted reading frames. The thick black line represents the vector used in the construct (pUCS = 2.6 kb. pRS551 = 12.5 kb). The vectors used for each plasmid construct are shown in parentheses. Abbreviations used are: C, Clal: E. EcoRI: EV. EcoRV: H, Hhal: HIlI, HindllI: 5, Sphl. the 16 kd protein is encoded by an out of frame fusion of a portion of the pappH gene to lacZ. The Papl7A (pilin) protein. encoded by plasm ids pDAL258B and pDALl7H-10 [as determined by both protein and DNA sequence analysis; (Blyn el aL, manuscript in preparation»). was not visualized (Figure 3a, lanes 3 and 4). This might have been due to the instability of pi lin in the absence of the PapD protein. which appears to be involved in pilin assembly (Norgren et al,. 1987), To confirm that the 10 and 12 kd proteins visualized by SDS - PAGE analysis were encoded by the open reading frames identified aspapI andpapB (Figure l), E.coli minicell analysis using deletion subclones was performed (Figure 3A). Plasmid pDALl7B-5. which contains only the papl7! open reading frame (ORF). yielded a single protein of apparent mol. WI 10 kd when transformed into E. coli minicells. Plasmid pDALl7H-IO. containing the complete paPI7B and papl7A ORFs and partial papl71 and papl7H ORFs, yielded 12 and 16 kd proteins (discussed above) but lacked the iO kd protein after transformation into E. coli minicells, Together, these results indicated that the pap171 ORF encoded the 10 kd protein. Plasmid pDALl7B-23, containing both the pappI and paP17B ORFs. yielded 10 and 12 kd proteins in E. coli minicells. These results. together with results using plasmid pDALl7B-5, indicated that the papl7B ORF encoded the 12 kd protein. Furthermore, the mol. Wls obtained for PappI and Papl7B by DNA sequence analysis (8,6 and I\.6 kd, respectively) corresponded well with the apparent mol. Wls obtained by SDS-PAGE analysis. Analysis of E. coli minicells transformed with pDAL26IB, which contains ORFs encoding PaP:1II and PaP:1IB, showed that two proteins of mol. Wls similar to 32 A. ... ..... • 3", B. .l...¥...: .-1-=..-~- ~ . . .. - . y- ~II!!!'"'' y. .... Fig. 3. AnalysIS of protems encoded by plasmid constructs using E.culi miOicell analysis. E.coli miniceils containing the r.la,mids listed btlow were- Isolated and incubated with J OlL"{ture of [3_-S1CYSleine and eSSlmethionine (Trans·"S-laOeI. leN) as described in Mat~rials and meth,,,",. "S·labeled proteins were separated on a SDS-PAGE gel system designed for low mol. "'t proteins (Giulian el al., 1985) and visualIzed by f1uorography as described above. Panels A and B show results obtained usmg the pla,mid" lISted above each set of lanes .• +' Indicates that cAMP (3 mM) was added to mimeell preparations: • -' mdicates no addition of cAMP; Y' shows the locations of vector­encoded proteins: 'B' and 'I' show the locauons of the papB and papl prOieins respecuvely. The asterisk shows the locauon of a putative pap"H -lacZ fusion protem (>ee textl. Papl1I and Papl7B were produced (Figure 3B). The visual­ization of the papI and papB gene products was remarkable in that they had not previously been resolved from each other due to their low mol. wts (Norgren et of., 1984; Low et ai., 1987). cAMP (3 mM final concentration) was added to all of the E. coli minicell preparations because we noted that pRS551 plasmid constructs (Figure 3B and unpUblished data) did not produce easily detectable amounts of PapB in the absence of cAMP. Levels of the putative PapH fusion protein were also increased by cAMP addition (Figure 3A, pDALl7H-1Q and pDAL258B). However, as shown in Figure 3, consistent results were not obtained using pUC8 derivatives. pUC8 plasmid derivatives produced higher levels of PapI and PapB than pRS551 derivatives (Figure 3B). Because of the inconsistencies noted above. these results cannot be used to determine the role(s) of cAMP on regulation of papB and pap! gene expression. Fusion of the pap pilin promoter to the lac operon Previous results has shown that expression of pilin from the pap gene cluster was subject to a phase-variation control mechanism (Low et of., 1987), However, the question of the level at which pili regulation occurred (transcriptional versus post-transcriptional) was not addressed. To approach this problem, a fusion was made between /o.cZYA and the pilin promoter. We chose plasmid pDAL17B-12A (constructed as shown in Figure 4 and described in Materials and methods) for fusion construction because it contained the complete paP171 and papl7B DNA sequence, but lacked papl7A. The papA gene appears to lack a promoter of its own (Figure 1 and Baga et 01., 1985) and has been shown to be co-transcribed with the papB gene (Baga et al., 1988). Therefore, pilin transcripts, which initiate at the papBA promoter, should be measurable by assaying ~-galactosidase production using this operon fusion. Plasmid pDALl7B-12A was digested with restriction endonuclease HindIlI, end-filled s, '. ~e ~/". - B H· , . . ..p "'.. L 2•S. e.. .' . E , ,~~~)" JJ ~ DNase I ... Mn++ ... BamHl ~_~ A 24E rag·~ tlJSlOrt NSD~" (Dl379) puc~! Tra~ ~_ ~j SftH1 MC.IOO andlrHct D'aMtormants wtr. .ARS4S ......dlC~...,ll lOtnolJ"'~HiIi AlIdEeeRllnk"" .~(GGAATTCCG; Ir!tH1DNAIgue RHtndian client .... r. ~~1 t SKB FIg. 4. Construction of E. coli stram DL379: a single copy papp' - lac fusion lysogen. and ligated to EcoRI linkers, Follo'wing restriction digestion with EcoRI. ligation with EcoRI-digested plasmid pRS551 was performed to construct the multicopy plasmid pDAL246B (Figure 4), Plasmid pDAL246B contains a pap17B-/o.cZY A operon fusion with the paPI7B promoter in the same orientation as /o.cZ. This plasmid was trans­formed into E.coli strain MC4100 and a transformant was transfected 'With the lambda phage }"RS45 which carries homology to pRS55 I (Simons et 01., 1987), A kanamycin resistant lysogen was selected (DL379). This lysogen resulted from recombination between ARS45 and pRS551 and was shown to contain a single integrated" phage (h246) using a Ter test (unpublished data, Mousset and Thomas, 1%9), A papZ!' -/o.c operon fusion was made in a similar manner by using a deletion clone (pDAL26IB) which contained paPz1I, pap~IB and a small portion of the papZ!A gene to construct fusion lysogen DlAI6 (see Materials and methods). Escherichia coli strain DL379 was plated on minimal medium containing glycerol as a carbon source and 5-brom0-4-chloro-3-indolyl-~-D-galactopyranoside (X-gal) as an indicator of ~-galactosidase activity (M9-Glycerol), Two distinct colony phenotypes were observed; colonies were either white (Lac-) or blue (Lac+). When DL379 Lac+ colonies were replated on M9-Glycerol. - 35% of the progeny gave rise to Lac+ colonies; whereas, DL379 Lac- colonies gave rise to -0.5% Lac+ colonies [Figure 5C and 0; Table II; assuming an average colony size of 3.35 x 107 cells (25 generations)]. This indicated that pilin transcription was controlled by a heritable switch. In contrast, when strain MC4100 containing pDAL246B was examined on M9-Glycerol, all of the colonies were constitutively Lac+ and no phase-variation was observed (Figure 5A). These results are consistent with our previous results which indicated that pilin phase-variation did not occur when pap17l. pap17B and pap17A were present in multiple copies (Low et al., 1987), 33 Table I. Bacterial strains, plasmids and phages used in thIS study Strain. pla.\mid or phage E,enli r.K4100 DL379 DL416 DL430 ORNI03 DH5a Bacteriophages "RS45 ~RS45-551 >'246 >'261 Plasmids pRS551 pTZI9U pUCS pDAL238B pDAL246B pDAL257B pDAL258B pDAL26IB pDALl7H-1O pDALI7B-5 pDALl7B·12A pDALl7B-23 DcscriptionJ F-araDlJq .llladPOZYA·argFIUI69 !p,IL rhi·1 MC4100 >-246 lysogen MC4I00 h261 lysogen MC4100 NaiR Ihr·1 /e/l-6 Ihi·1 .l(argF-/acIUI69 xl'/-7 ara-13 ml/-2 ga/-6 IpsL fhuA2 miliA minB recAU .l(piiABCDFE h'pl F- endAI hsdRI7 supE44 till·1 ,ecAI g."rA% relAI .l(argF-/ae)UI6Y o80dIacLlM 15 amp'·/acZYA imm~' >'RS45 -pRS551 recombinant phage ~RS45 - pDAL!46B recombinant phage ARS45-pDAL26IB recombinant phage amp·kan-/acZYA pMBI replieon amp pMB I replicon tUnp pMB I replicon tet cam PI5A replicon With 27 kb pap2llBA DNA "'-'quence pRS551 containing a 1.6 kb {)(IP17IB DNA sequence pUC8 containing a 3,2 kb paP2,IBAH' DNA scquence pUe8 containmg a 2,8 kb pap,.IBAH' DNA sequel1<'c pRS551 containing a 2,6 kb pap"IBA' DNA sequence pUCS contaimng a 2,0 kh pap17IBAH' DNA "'quence pUCS containmg a 1.2 kb pap,,1 DNA sequence pUC8 contaming a 1.6 kb pUPL 17IB DNA ,equence pUC8 containmg a 1.7 kb paP17lB DNA scquence 'Resistance detenninants: amp, ampicillin: fum, kanamycin: leI. tetracycline: cam, chloramphenicol. DlA16. containing the pap2lBA' -lacZYA operon fusion in single copy. also gave rise to Lac'" and Lac - colonies alier inoculation of M9-Glycerol medium. However, DL416 differed from DL379 because the Lac- phenotype was 'leaky' (colonies were light blue) when cells were plated on M9-GlyceroL Furthermore. DlAl6 Lac- colonies gave rise to a much higher fraction of Lac - progeny when plated on M9·Glycerol (90%) compared to DL379 (35%, Table U). Interestingly, DL416 Lac- colomes yielded a similar fraction (0,7%) of Lac - progeny compared to DL379 (Tahle II), Calculation of phase transition rates using f.col; strains DL379 and DL416 Reference and source Casadaban (1976) thi, study this study this study Orndorff el ai, (1985) Bcthe>da Research Laboratones Simons e/ al. (1987) this study this study thIS study Simons el aL (1987) Mead ", at. (1986) Vieim and Messing (1982) Low 1'1 al. (1987) this study (Figure 21 thi, study (Figure 21 this study (Figure 2) thIS ,tudy (Figure 2) this study (Figure 21 this study (Figure 2) this sludy (Figure 4) this study (Figure 2) The re~ults shown above sugge~ted that transcription initiated at the papBA promoter was under the control of a heritable phase-variation mechanism, To further explore the nature of this phenomenon. we measured the rates at which Lac + - Lac - phase-variation occurred. In quantitating rates, a colony arising from either a Lac - or Lac - parent cell was selected and the Lac phenotype of progeny cells was scored, The phase-transition frequency was calculated using the formula (MIN)I g where M is the number of cells that underwent a phase-transition. N the total number of cells evaluated and g the total number of generations that gave rise to the coiuny (Eisenstein. 1981: see Materials and methods), Usinl! the method described above. we determined that the frequem:y of transition from Lac - - Lac - for DL379 Fig. 5, Analysis of Lac phenotypes of E. coli K -12 stnuns carrying single copy pap 1-' -/acZY A fu.. ... iomL A single colony of each of the stmins listed below was inoculated onto M9-Glycerol media as described in Materials and methods, Plates were incubated for 48 h at 37"C prior to being photographed, Lac· and Lac- colonie, were derived from parent colonies showing no set."toring. Panels: A, !>1C4100 'pDAL'46B): B, MC4100:l\RS45-55I I,">gen (transferred vector control); C. DL379 Lac-: 0, 01.379 LK:' . 34 Table II. Phase transitIon frequencIes observed for E.mil pap' -lacZYA fusion Iysogens E.coli lacZYA Lac phenory pe 1 Observed Lac· - Lac' sWItch freguencies ¢ Iv,ogen carbon source:'! Total no. No. of Lac -. Switch WeIghted of colonies no. of Lac' trequencv avemge of counted colonies (a or {3)h frequenciesl DL379 Lac - . M9·Glycerol :!398 953/1445 a = :!.45 X 10'2 2nd colony as above :!123 805/1318 a = 2.51 x 10'2 3rd colony as above 1951 5201143 \ '" = :!.89 x 10-2 a :; 2_60 x 10 - DL379 Lac -. M9·Glycerol 3098 17/3081 {3 = 2.22 X 10-4 2nd colony as above 2517 4::!513 {3 = 6.17 x 10-5 3rd colony as above 2457 11/2446 {3 = 1.74 x 10'· {3 = 1.57 X 10-4 DLAI6 Lac·. M9·Glycerol 7014 6378/636 a = 3.72 x 10-' NA" DLAI6 Lac -. M9·Glycerol %76 72/9604 {3 = 3.05 X 10-4 NA "Carbon source refers to that included in solid media used for inoculation of parent and progeny colonies. "The Lac ' to Lac' switch frequency IS designated a. and the Lac- to Lac' switch frequency" designated as {:l. 'The weighted average of the switch frequency was calculated as in Materials and methods and takes mto account the number of progeny examIned for each experiment used to calculate the avemge. dNot applicable using M9-Glycerol was 1.57 x 1O-4/cell/generation (Table II). The frequency of transition from Lac· - Lac - was calculated to be 2.60 x 1O,2/cell/generation (Table II). which is 165-fold higher than the Lac' -Lac+ rate. Thus. after 25 generations a sin~le Lac + bacterium will give rise to a colony (3.35 x 10 cells) which is comprised of mostly Lac' bacteria (65%); however. these colonies still display a Lac+ phenotype (Figure 5D). In contrast. after 25 generations a single Lac· bacterium gives rise to a colony that is comprised of only 0.4% Lac+ cells (Figure 5C). Measurement of phase transition rates for E. coli strain D LA 16 showed that the Lac + - Lac - rate was about IS-fold lower than the rate obtained using DL379. However, the Lac' - Lac'" rate was about double the rate obtained with DL379 (Table II). Effect of carbon source and temperature on phase transition rates using E.coli strain DL379 Previous results indicated that transcription of the pap pilin gene of E. coli strain J96 was under catabolite repression control (Baga et al .. 1985). To determine if the carbon source might affect pap pili phase-variation, we measured phase transition rates for DL379 inoculated onto minimal medium containing glucose and X-gal (M9-Glucose). We found that the Lac + - Lac' transition rate was 3.85 x 1O-2/cell/generation whereas the Lac'-Lac+ transition rate was found to be 4.51 x 1O-6/cell/generation (Table ill). This represents a 37 OOO-foid difference between transiton rates. As only three Lac+ colonies were observed from a total of 119000 progeny cells examined. the Lac' -Lac+ transition rate was only an approximation. To ensure that the Lac· colonies obtained on M9-Glucose were capable of phase-variation. random colonies were picked to M9-Glycerol. These colonies gave rise to both Lac+ and Lac- progeny (our unpublished data). Compar­ing the data obtained using M9-Glucose to that obtained using M9-Glycerol, the Lac + - Lac - transition rate using glucose was 1.4-fold higher than results obtained using glycerol. The Lac· - Lac + rate using M9-Glucose was about 35-fold lower than the rate obtained with M9-Glycerol (Table ill). Taken together, these data showed that the carbon source had a profound effect on the Lac· - Lac· phase transition rate but only a small effect on the Lac - - Lac' rate. Pap pilin transcription has been shown to be reduced by about 25-fold at an incubation temperature of 23°C compared to an incubation temperature of 37°C (Goransson and Uhlin, 1984). This study was performed using multicopy pap DNA sequences which. as discussed above. do not allow an analysis of pap pilin phase-variation. To determine the effects of incubation temperature on pap pilin phase switching. we inoculated strain DL379 cells. iniJiaily incubated at 37°e, onto M9-Glycerol at 23. 30 and 37°C. Lac + - Lac· phase transition rates were similar at 30 and 37°e (Table IV). To ensure that the temperature shift itself was not affecting phase transition rates, we also incubated DL379 at 300 e and incubated progeny cells at 30oe. Similar result, were obtained compared with the 37 - 300 e temperature shift experiment (Table IV). Interestingly. when DL379 cells (Lac+ or Lac-) were incubated at 37°e and then progeny were incubated at 23°e, all colonies displayed a Lac· phenotype. Previous work has suggested that /3-galactosidase is at least as active at 23°e as it is at 37°e (Goransson and Uhlin, 1984). In addition, we have isolated E.coli (papJ7' -lac) mutants that display a phase-variation phenotype at 23°e, demonstrating that the Lac+ phenotype can be expressed at low temperature (C.White-Ziegler and D.l..ow. in preparation). Therefore, our results suggest that the differences in phase transition rates observed at 23°e are due to an alteration in transcription rather than /3-galacto­sidase activity. Discussion The results presented here strongly indicate that pap pili phase-variation occurs at the transcriptional level. However, we have not ruled out the possibility that regulation of phase­variation might occur post-transcriptionally due to differential rates of mRNA degradation or differences in translational efficiency. Our results also indicate that the phase of cells (Lac + or Lac' in our study) is a heritable trait since 35 Table m. The effect of carbon source on observed phase·transition frequencies for E. coli strain DL379 Lac phenotype 1 Observed Lac - - Lac - frequencies carbon sourcea No. of colonies Lac-/Lac counted ratio!> Lac' . M9·Glycerol Table II Table Il Lac -. M9·Glycerol Table Il Table II Lac +. M9·Glucose 2078 61/2017 2nd colony as above 2327 239/2088 3rd colony as above 2176 122/2054 4th colony as above 2485 142/2343 Lac -. M9 Glucose 27086 0/27086 2nd colony as above 64172 0/64172 3rd colony as above 27656 3/27653 Transition frequency (Q or ai' Table II Table Il a = 3.82 X 10-' a = 3.73 x 10'" a = 3.94 x 10'2 a = 3.90 x 10-: NAt' NA i3 = 4.51 x 10' 0 Weighted average of f requenciesJ or = 2.60 x 10- 2 i3 = 1.57 X 10-4 a = 3.85 x 10-: NA 'Solid media containing glucose or glycerol as sole carbon source were inoculated with E.mli stram DL379. bLac+/Lac- ratio is the number of Lac· colomes divided by the number of Lac- colonies. :The Lac • - Lac - transition frequency is designated a. and the Lac - - Lac· transition frequency is designated 13. The weighted average of the sWItch frequency was calculated as in Materials and methods and takes mto account the number of progeny exammed for each experiment <Not applIcable. Table IV. The effect of temperature on observed transition frequenCies for strain DL379 Lac phenotype of Incubation temperature Observed Lac· - Lac - switch freguencies colony analyzed (OC) Pnmarya Secondary Total number of No. of Lac· ILac- Switch frequency colonies counted colonies (a or 13)" Lac + 37 37 Table II Table II a = 2.60 x 10- 2, Lac- 37 37 Table II Table II 13 = 1.57 X 10-4 Lac+ 37 30 1571 549110:2 a = 2.65 x IO-! Lac- 37 30 3634 17/3617 {3 = 1.88 X 10-' Lac + 37 23 1459 011459 NAd Lac- 37 23 1957 0/1957 NA Lac + 30 30 5196 1736/3460 a = 2.77 x 10-2 Lac- 30 30 8287 56/8231 {3 = 2.71 X 10-4 "Primary refers to the initial plate from which the colony was picked: secondary refers to the plates that the colony was transferred to for quantitation of switch frequencies. All plates were M9·Glycerol. "The Lac+ to Lac- switch frequency is designated a. and the Lac- to Lac+ switch frequency is designated as {3. cThese switch frequencies from Table II are presented as the weighted average. "Not applicable. Because there were no phase·variation events at 23°C we were unable to calculate a switch frequency. bacteria from a Lac + colony gave rise to significantly more Lac + colonies than bacteria from Lac - colonies after reinoculation of M9-Glycerol medium (Figure 5 and Table II). Phase-variation was not observed for E.col; containing the multicopy pap' -lac operon fusion plasrnids pDAL246B (Figure 5A) or pDAL261 B (our unpublished data). Transfer of pap' -lac DNA sequences to a ). prophage resulted in the appearance of the phase-switching phenotype (Figure 5C and D; Table 11). These results are consistent with our previous work showing that virutally all E.col; K-12 cells harboring multicopy plasmids containing the pap-I 7 operon expressed pilin-17. In contrast, E. coli harboring a single copy pap--17 operon displayed pap pili phase-variation (I % of cells were pilin-17 +) similar to that observed for the uropatho­genic E.coli strain CI212 (6% of cells were pilin-17+ , Low et al., 1987). Thus, normal (wild type) pap pili phase­variation is abrogated in cells containing multicopy pap DNA sequences. Pap pili phase-variation appears to occur at both the transcriptional level (this study) and pili expression level (Low et al., 1987). It has been recently shown that the papBA transcript is subject to post-transcriptional processing (Baga et al., 1988). Therefore, it is possible that the phase transition rates measured here (Tables II and ill) might differ from pili expression phase transition rates. Previously, we did not measure phase transition rates for pap pili expression due to the difficulties in analyzing individual colonies. Instead, we measured the fraction of cells within an E.coli strain CI212 colony that expressed pilin-17 (6%) and pilin-21 (84%). It is difficult to compare this pili expression data with the phase transition frequencies obtained here because the former data were obtained without knowledge of the pap pili phase ('phase on' or 'phase off) of the starting colonies. Also, the pili expression data were obtained using LB agar (Lowel al., 1987) whereas the phase transition frequencies shown here (Table II) were obtained using M9-Glycerol minimal medium (this study). The pap17IB and pap21IB DNA regulatory regions (Figure I) are very similar to each other and to the papIB regulatory sequence of E. coli strain J96 (Baga el al., 1985). 36 Interestingl y , the Lac ~ - Lac - transItion frequency for pap-I7 (DL379) is about I5-fold higher than the frequency measured for pap-2l (DLAI6), whereas the Lac- -Lac+ transition frequencies differed by less than 2-fold (Table II). What DNA sequence changes between pap-I 7 and pap-2I are the cause of this difference in transition frequencies? The PapB protein sequences were identical and there was only one amino acid difference for PapI (Figure I), However, there were 23 bp differences in the intergenic region between papI and papB, including a 9 bp insertion present in pap-21 but notpap-I7. We do not known the role(s), if any, of these base-pair and amino acid changes in the transition frequency differences observed between the pap-I7 and pap-2I operons. In addition, the pap' -wc fusions used in this study also contained -300 bp (pap-I7) and 600 bp (pap-2I) of DNA downstream of papI that we have not sequenced and could playa regulatory role in pap pili expression, Although it is possible that these unsequenced DNA regions encode protein(s), none were detected using Ecoli minicell analysis (Figure 3). Our results in Figure 3 showed that both the pap-I7 and pap-21 DNA sequences used to construct pap' -wc operon fusions encoded proteins (PapI and PapB) of mol. wts similar to those predicted from the DNA sequence (Figure 1). Previous results have indicated that PapB, and to a lesser extent Papl, are positive activators, increasing transcription from the papBA promoter (Baga et ai" 1985). However, we do not know what role(s), if any, are played by these proteins in the phase-variation process. Previously described phase-variations systems, including Salmonelw flagellar phase-variation (Silverman and Simon, 1980; Zieg and Simon, 1980) and related systems (plasterk and van de Putte, 1984; Plasterk et aI., 1983), in addition to type I pili phase­variation (Abraham et al., 1985) utilize a DNA inversion event to control transcription. We do not know if pap phase­variation also involves a DNA rearrangement, although we have not been able to detect any major DNA rearrangements between Lac+ and Lac- Ecoli strain DL379 cells (unpublished data). Previous results showed that transcription initiated at the papBA promoter was subject to catabolite repression via cAMP-CRP interaction (Baga et al., 1985). Our results showed that the Lac - - Lac + transition frequency of E coli strain DL379 inoculated onto M9-Glucose was reduced by - 35-fold compared to cells inoculated onto M9-Glycerol medium (Table III). However, the Lac'" - Lac- transition rate for strain DL379 inoculated onto M9-Glucose medium was lA-fold higher than for cells inoculated onto M9- Glycerol (Table III). Our interpretation of these results is that the carbon source used for growth, possibly via cAMP-CRP control, influences the rate of transition from a 'phase-off state to a 'phase-on' state. Once a bacterial cell is in the 'phase-on' state, carbon source has only a small effect on the rate of transition to the 'phase-off state. The end result of this phenomenon is to shift the bacterial population towards a 'phase-on' or 'phase-off state through a heritable mechanism, although it is not yet clear what role(s) this response might have in the normal physiology of E coli living in the bowel or outside of a Jiving host, In contrast to the influence of carbon source on pap pili phase switching, low temperature (23°C) appears to induce a complete transition from the 'phase-on' state to the 'phase­off state (Table IV). Previous results indicated that tran-scription from the papBA promoter of strain 196 was reduced - 25-fold at 23°C compared to 37°C (Goransson and Uhiin, 1984). These results were obtained using E coli strains containing multicopy pap DNA sequences which, as we have shown here, do not display the normal phase-variation phenotype (Figure 5A). Thus, although the results show a similar general effect of temperature on pap pilin tran­scription, different parameters are being measured by the mUlticopy and single copy pap systems. Whereas the single copy pap' -wc system allows measurement of phase­variation, the mUlticopy system provides a measurement of transcription which is an average for the whole bacterial population being measured. As shown here, this measure­ment does not accurately reflect the state of wild-type cells in which pap is in a single copy state, It seems that at least one function of the low temperature response is to tum off the production of pili by Ecoli outside of a living host where presumably the pili are not needed and may actually be detrimental. By similar reasoning, other factors that might be needed for colonization of the intestine may also be regulated by a low temperature response system and thus could be identified by a low temperature response phenotype. Materials and methods Bacterial and bactariophage strains. plasmids and media Strains. plasmids and bacteriophages are listed in Table I. LB broth, LB agar, M9 minimal broth and M9 minimal agar were prepared according to Miller (1972). When used, supplements were at the following concentrations: glucose and glycerol. 0.2% final concentration; 5-brom0-4-chlonr3-indolyl-iJ-D-gaiactoside (X-gal), 40 "g/ml final con­centration; ampicillin, 100 "g/ml; kanamycin. 25 "g/ml; and nalidixic acid, 20 "g/ml. Calcullltion of phase transition rates Lac + - Lac - and Lac - - Lac + transition rates were calculated by a modification of the method of Eisenstein (1981). Fusion strains were inoculated onto M9 agar containing the appropriate carbon source. Colonies showing a complete Lac + or Lac - phenotype (no sectors) were excised from the agar and resuspended at 4·C in M9 salts containing no carbon source. The total number of organisms was determined with the aid of a hemocytometer and appropriate dilutions were inoculated onto M9 agar containing the same carbon source as the parent colony. After - 48 h of growth, the colonies were scored for Lac phenotype. Colonies showing greater than 50% Lac + phenotype were scored as Lac + , and all others were scored as Lac - . Transition rates were calculated by the formula (MIN)/g where' MIN' is the ratio of Lac + cells to total cells or the ratio of Lac - cells to total cells, and 'g' is the number of generations of growth from a single cell to the total number of cells in the colony. The weighted average of the transition rates was calculated by the formula [(M/gl ) + (M1Ig1) + (Mn- Ign)]/(NI + N2 + ... Nn) where M. N and g are as above and n represents each individual transition rate calculation. In order to calculate the transition rates the assumption was made that Lac + colonies arose from a single Lac + parent cell and Lac - colonies arose from a single Lac­parent cell. Recombinant DNA techniques and identification of plasmld­encoded polypeptides Conditions for restriction endonuclease mapping, isolation of restriction fragments, ligation and transformation of plasmid DNA have been described previously (Low "I aI., 1987; Maniatis "I al., 1982). Plasmid deletion subclones pDAL17H-IO, pDALI7B-5. pDALI7B-12A and pDAL17B-23 were constructed using DNase I as follows. Plasmid pDAU58B DNA (2 "g) was digested with DNase I (Worthington Biochemicals) at 22·C to yield -0.5 double stranded cleavages perpiasmid circle. DNase I digestion was performed in a buffer containing 20 mM Tris-Hel pH 7.6 and 10 mM MnS04 . After addition of EDT A to a final coocentration of 25 mM to prevent further DNase I digestion, DNA samples were analyzed on Tris-acetate agarose gels (Maniatis el aI .. 1982). Full- 37 sized linear DNA fragments were cut out of the gel and concentrated using a Gene Clean kit (BioJOl. Inc.). DNA samples were digested with BamHI or Hindill. which each have a single recognition site withrn the pUC8 vector DNA sequence. DNA fragments were end-ftlled using the Klenow fragment of DNA polymerase I. concentrated with the Gene Clean kit. and incubated with T4 DNA ligase under dilute conditions to favor intramolecular joining. Ligation mixtures were added to transforrnation-competent E. coli strain DH5Q cells and inoculated onto LB agar medium containing ampicillin (100 I'g/ml). Transformants were picked at random and contained plasnuds with deletions extending into the pap sequence from either the BamHI or EcoRl restriction endonuclease recognition site of vector pUC8. Plasmid-encoded polypeptides were identified as previously described (Norrnark el al .• 1983; Low el al .. 1987) using the £.coli minicell stram ORNI03 (Orndorff el al .. 1985). The 35S_labeled pap-encoded poly­peptides were separated on a SDS - PAGE system designed for the separation of low mol. WI polypeptides (Giulian el al .. 1985). Gels were treated with En'Hance (New England Nuclear) to increase signal intensity and were soaked in a solution containing 10% polyethylene glycol (PEG 6000) in water prior to drying to prevent expansion. Construction of pap' -lacZYA operon fusions A papI1 operon fusion was constructed as shown 10 Figure 4 using plasmid vector pRS55 I (Simons el al .. 1987). The resulting pDAL246B plasmid contained a paPI' -lacZYA fusion with the lac genes under the control of the papBA promoter. A pap" operon fusion was constructed as follows. The 2.7 kb BamHI-CIaI DNA fragment from pDAL238B (Low el al .. 1987) was ligated to BamHI-C/al digested phage MI3 mpl8 DNA (Yanisch-Perron et al .. 1985) to construct phage MI3-243B. Phage M13-243B was used to generate deletions extending in from the pilin gene region using CYCLONE I as described above. One clone (MI3-L1P52) was chosen which contained paP21 I. pap"B and - 185 bp of the paP21A (pilin) DNA sequence. Phage M13-LlP52 was digested with Hindill and end-filled using the Klenow fragment of DNA polymerase I and deoxynucleotide triphosphates (Ausubel el al .. 1987). Following a JO min incubation at 70·C to inactivate the Klenow fragment of DNA Pol I. EcoRllinkers d(pCGGA­ATICCG) (New England BioLabs) and T4 DNA ligase were added. Following incubation for 16 h at 15·C. EcoRl was added for 2 hat 37·C and then loaded onto a low melting temperature (LMT) agarose gel (0.7%. FMC BioProducts). The 2.4 kb DNA fragment containing pap DNA sequences was excised and ligated to EcoRl-<ligested. calf intestinal phosphatase-treated plasmid pRS551. This ligation mixture was used to transform competent E. coli strain DH5a cells with selection on LB agar plates containing ampicillin (100 I'g/ml) and X-Gal (Silhavy el al .. 1984). Dark blue colonies harbored vector pRS55 I containing the 2.4 kb pap DNA fragment in the orientation which placed IacZY A under control of the papBA promoter. This construct was designated as pDAL261 B. Pap' -lac fusions were transferred from plasmids pDAL246B and pDAL26IB to phage).. as described previously (Simons el al .. 1987). In addition. a 'transferred vector' control was prepared using plasmid pRS55 I. Briefly. plasmids were first transformed into strain MC4100 (Casadaban. 1976) and used as host for the growth of phage ARS45 (Simons el a/ .. 1987) Phage lysate' were used to mfect a nalidixic acid derivative of strain MC4100 (DL430) and bacterial cultures were inoculated onto LB agar medium containing kanamycin (25 I'g/mi) and nalidixic acid (20 I'g/ml). Colonies arising were cross-streaked with NM I phage to verify the lysogenic stale of the bacteria. Prophage copy number was determined using a Ter test (Mousset and Thomas. 1969). DNA sequence analysis DNA sequence analysis was performed using the dideoxy termination method of Sanger el al. (1977). Deletion subclones were generated using the CYCLONE I biosystem kit (International Biotechnologies. Inc.) or by subcloning DNA restriction fragments into plasmid pTZI9U (Mead el al .. 1986). Alternatively. deletion subclones were generated by a procedure using DNase I as follows. DNA restriction fragments were cloned into the vector pUC8 and incubated in the presence of manganese with an amount of DNase I sufficient to generate about one double stranded cleavage per DNA molecule. After separation on agarose gels. linear DNA fragments were digested with BamHI. which cleaves once within the plasmid vector. After end-filling with the Klenow fragment of DNA polymerase I. linear DNA fragments were circularized by addition ofT4 DNA ligase at 15·C for 16 h. Resulting ligation products were transformed into £. coli strain DH5" (Bethesda Research Laboratories) and transformants appearing on LB agar medium containing ampicillin (100 I'g/ml) were picked. Plasmids were examined by agarose gel electrophoresis and appropriate deletion derivatives were SUbjected to DNA sequence analysis. Acknowledgements We thank Paul Orndorff and Bob Simons for suppl)lng some of the strains shown in Table I. We also thank Carl Thummel for providing a protocol devised by Jeremy Nathans for generation of deletion subclones with DNase I. This work was supported by a pre-<loctor.u training grant no. GM07464- 12 awarded to L.B. and grants no. AJ23348 and no. Al00881 to D.L. from the National Institutes of Health. References Abraham.MJ .. Freltag.c.S .. Clements.J.R. and ElSenstein.B.!' (1985) Proc. NaIl. Acad. Sci. USA, 82. 5724-5727. AusubeI.F.M .. Brent.R .. Kingston.R.E.. Moore.D.D .. Smith.J.A .. Seidman.J.G. and Struhl.K. (1987) Current Protocols in Molecular Biololl-'"" John Wiley & Sons. New York. Baga.M .. Goransson.M .. Normark.S. and Uhlin.B.E. (1985) EMBO 1 .• 4. 3887 - 3893 Baga.M .. Goransson.M .. Normark.S. and Uhlin.B.E. (1988) Cell. 52. 197-206. Casadaban.M. (1976) 1. Mol. Bioi .. 104. 541-555. Dougan.G. and Kehoe.M. (1984) In Bennett.P.M. and Grinstead.J. (eds). Melhods ill MicrobiolollY. Academic Press. New York. Vol. 17. pp. 233-258. Eisenstein.B.!' (1981) Science. 241. 337-339. GiuIian.G.G .. Shanahan.M.F .. Graham.J.M. and Moss.R.L. (1985) Fed. Proc .. 44. 686. Goransson.M. and Uhlin.B.E. (1984) EMBO 1 .. 3. 2885-2888. Lindberg.F.P .. Lund.B and Norrnark.S. (1984) EMB01.. 3.1167-1173 Lindberg.F.P .. Lund.B .. Johansson.L. and Norrnark.S. (1987) Nature. 328. 84-87. Low.D .. David.V .. Lark.D .. Schoolnik.G. and Falkow.S. (1984) Infect. Immull .. 43. 353-358. Low.D .. Robinson.Jr.E.N .. McGee.Z.A. and Falkow.S. (1987) Mol. Microbial .. I. 335-346. Lund.B .. Lindberg.B .. Marklund.I. and Norrnark.S. (1987) Proc. NaIl. Acad. Sci. USA. 84. 5898-5902. Lund.B .. Lindberg.B. and Normark.S. (1988)1. Bacterioi .. 70.1887-1894. Maniatis.T .. Fritsch.E.F. and Sambrook.J. (1982) Molecular Cloning. A lAboratory Manual. Cold Spring Harbor Laboratory Press. Cold Spring Harbor. NY. Mead.D.A .. Skorupa.E.S. and Kemper.B. (1986) Prot. Engin .. 1. 67-74. Miller.J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Cold Spring Harbor. NY. Mousset.S. and Thomas.R. (1969) Nature. 221. 242-244. Norgren.M .. Normark.S .. Lark.D .. O·Hanley.P .. Schoolnik.G .. Falkow.S .. Svanborg-Eden.C .. Baga.M. and UhIin.B.E. (1984) EMBO 1 .. 3. 1159-1165. Norgren.M .. Baga.M .. Tennent.J.M. and Normark.S. (1987) Mol. Microbiol .. I. 169-178. Norrnark.S .. Lark.D .. HuII.R .• Norgren.M .. Baga.M .. O·Hanley.P .. Schoolnik.G. and Falkow.S. (1983) Infect. Immun .. 41. 942-949. O·Hanely.P .. Low.D .• Romero.I.. Lark.D .. Vosti.K .. Falkow.S. and Schoolnik.G (1985) N. Engl. 1. Med .. 313. 414 -420. Orndorff.P.E.. Spears.P.A .. Schauer.D. and Falkow.S. (1985) 1. &eleriol., 164, 321 - 330. Plasterk.R.H,A .. Brinkman.A. and van de Pune.P. (1983) PrcX". Nail. Acad. Sci. USA. SO. 5355-5358. Plasterk.R.H.A. and van de Pune.P. (1984) Biochim. Biophys. ACla. 782. 111-119. Sanger.F .. Nick.Ien.S. and Coulson.A.R. (1977) Proc NaIl. Acad. Sci. USA. 74. 5463. Silhavy.TJ .. Berman.M.L. and Enquist.L.W. (1984) Experiments .. ilh Gene Fusions. Cold Spring Harbor Laboratory Press. Cold Spring Harbor. NY. Silverrnan.M. and Simon.M. (1980) Cell. 19.845-854. Simons.R.W .. Houman.F. and Klecker.N. (1987) Gene. 53. 85-96. Vieira.J. and Messing.J. (1982) Gene. 19. 259-268. Yanisch-Perron.c.. Vieira.J. and Messing.J. (1985) Gene. 33. 103-119. Zieg.J. and Simon.M. (1980) PrO(". NaIl. Acad. Sci. USA. 77.4196-4201. 38 CHAPTER III REGULATION OF PAP PILIN PHASE VARIATION BY A MECHANISM INVOLVING DIFFERENTIAL DAM METHYLATION STATES Regulation of pap pilin phase variation by a mechanism involving differential Dam methylation states Lawrence B.Blyn, Bruce A.Braaten and David A.Low Division of Cell Biology and Immunology. Department of Pathology. University of Utah School of MedIcine. Salt Lake City. UT 84132. USA Communicated by S. Normark Transcription of the pap pilin (papA) gene in Escherichia coli is subject to control by a heritable phase variation mechanism in which alternation between transcriptionally active (phase on) and inactive (phase 011) states occurs. Our results suggest that phase switching occurs without DNA rearrangement of pap DNA sequences, distin­guishing this system from those described for E.coli type 1 pili and Solmonellll nagellar phase variation. Analysis of the regulatory region upstream of papA in DN As isolated from phase off and phase on cell populations showed that two deoxyadenosine methylase (Dam) sites, GATClO28 and GATCU30' were present. Southern blot analysis of MboI and DpnI restriction digests of DNAs showed that the GATC1028 site was unmethylated only in DNA isolated from phase on populations. Conversely, GATCU30 sites were unmethylated in DNA isolated from phase off populations. The presence of unmethylated GATC sites in E.coli is unusual and to our knowledge has not been previously reported. These results suggest that the methylation states of GATC1028 and GATCII30 may regulate pap transcription. Consis­tent with this hypothesis, Dam methylase levels affected the regulation of pap transcription; papA transcription was absent in dilm- E.coli. Moreover, transition from the phase off to phase on state was not observed in E.coli expressing aberrantly high levels of Dam. A basic model is presented which outlines a possible mechanism by which alternation between phase off and phase on methylation states could occur. Key words: dam/DNA methylation/pap/phase variation/ transcription Introduction Many pathogenic bacteria express receptor specific pilus­adhesin complexes (Lindberg et 01., 1984; Uhlin et 01., 1985; Hanson and Brinton, 1988) which aid adherence to eukaryotic host cells (Gaastra and De Graaf, 1982). These pilus-adhesin complexes can facilitate bacterial colonization of host tissues, but may also elicit host humoral and cell­mediated immune responses (Tramont and Boslego, 1985; Karch et 01., 1987). Therefore, expression of adhesive struc­tures by these organisms could enhance or diminish their virulence depending on the environment in which the bacteria find themselves. Perhaps as a result of host immune surveillance bacteria have evolved regulatory mechanisms such as phase variation for the control of expression of pilus­adhesin complexes. One of the best characterized phase variation systems is the oscillation of flagellar phenotypes in Salmonella ophimurium (Silverman er 01., 1979a,b; Silverman and Simon. 1980). Inversion of a 995 bp DNA fragment containing the H2 flagellin promoter causes alternating expression of phase I and phase 2 flagellar antigens (Silverman er 01., 1979b). Escherichia coli type I pili expression is also subject to phase variation. although in this case antigenic variation does not occur. Instead. cells alternate between expression (phase on) and non-expression (phase off) states. This phase variation is mediated by the inversion of a 314 bp DNA fragment containing the pilin promoter (Freitag el 01., 1985; Abraham el 01 .• 1987). Previously. we found that expression of pyelonephritis associated pili (Pap) by uropathogenic E.coli was subject to phase variation; some bacterial cells within a single colony expressed Pap pili while other cells did not (Low el 01., 1987). The regulation of Pap pili was further explored by analyzing pap -lac fusion constructs, containing lacZ under the control of the pap pilin promoter, in E.co/i K-12. Inoculation of bacteria onto lactose (Lac) indicator medium resulted in the appearance of Lac+ (phase on) and Lac­( phase off) colonies. The Lac phenotype, and thus the phase state. was heritable (Slyn et 01., 1989). These results indicated that the oscillation of Pap pili expression between phase on and phase off states occurs at the transcriptional level. In this paper we present evidence suggesting that DNA rearrangements, such as inversions, do not occur within pap DNA sequences during phase variation. Analysis of the DNA regulatory region upstream from the pap pilin promoter indicated that the methylation states of two GA TC sites in this region were different between phase on and phase off cells. The GATCII30 site was unmethylated in phase off cells. whereas GATC102B site was unmethylated in phase on cells. Furthermore. deoxyadenosine methylase (Dam) levels affect the regulation of pap pilin transcription. Together, these results indicate that differential protection of the GATC102B and GATCII30 sites from Dam methylation may play an important role in pap phase variation. Results Evidence that pap phase variation does not involve pap DNA reanangement Our initial approach to defining the mechanisms involved in pap phase variation was to determine if DNA rearrangements or base pair alterations occurred during the alternation between phase on and phase off transcription states. For this analysis we used an E. coli lysogen (DL579) containing phage A266 (Table I, Figure I) integrated in the chromosome at the ott site. Phage A266 was derived from pDAL246B as described in Materials and methods. Phage 40 1-1 JOObp papBA promoICr (D'ts~9) ~ ~1--_---L~r-H1_~cal:--_B_~ .... ~ IacZ lac Y lacA Fig. 1. Diagram of the pap DNA insen wIthin phage A266. Phage A266 was constructed as described in Material> and methods. Phage A26fJ was used to lysogenize strain MC4100 thereby creating strain DL579. In this construct. the transcriptional onentatio", of the cal gene and the papBA promoter are the same. Hatched boxes represent >'RS45 phage DNA sequences. Table I. Bacterial strams. phages and plasmids used in this study. Strain. plasmid or phage Descripfiona Reference or sOllrce E.mli MC4100 GM2929 GM3819 CAG I 8456 DL373 DL379 DL430 DL557 DL579 DL663 DL739 DL742 DL775 F~ araD 139 tJ.(/aclPOZYA·ar/iF) U 169 rpsL Ihi·1 F~ OOm-13::Tn9 dcm6 ilSdR2 rl'cFl43 mcrA~ mcrB­F- OOm-16 (del: kanR) (Casadaban. 1976) M.G.Marinus. unpublished construction (Parker and Marinu •. 1988) Bacteriophages >'RS45 A246 A265 A266 PIL4 cysG ::he-3084lTnIO (tel) MC4100 pRS55 I lysogen (no pap insen) MC4100 A246 lysogen MC4100 NaiR MC4100 A265 lysogen MC4100 A266 lysogen MC4100 recA - A266 lysogen MC4100 dalll-13::Tn9 (cam") DL 739 A246 lysogen PI(CAG 18456) xDL 742 (cams .Dam -transductant) amp'-laeZYA im";l ARS45-pDAL246B recombinant phage I-.RS45-pDAL265B recombinant phage >.RS45-pDAL266B recombinant phage Virulent P I phage pBR322 containing p",-diJm pGB2 containing ladl amp-kan-lacZYA pMBI replicon Bluescribe M13+ with cal gene pRS551 containing a 1.6 kb paPI,IB DNA sequence (Singer el al .. 1989) This study (Blyn el al .. 1989) (Blyn cl al .. 1989) This study ThIS study This stud) This study This study This study (Simons el al .. 1987) (Blyn el al .. 1989) ThIS study This study L.Caro (Marinus el al .. 1984) P. Y ouderian Plasmids pTPI66 pPYI025 pRS551 pT-CAT pDAL246B pDAL265B pDAL266B pDAL282B pRS551 containing a 1.0 kb Sphl-&1mHl pap nIB DNA sequence pDAL246B containing the 783 bp &1mHI eaJ DNA fragment of pT-CAT pTZI9U WIth a 489bp Hhal pap" 'IB' DNA sequence (Simons el al .. 1987) Richard Harland (Blyn el al .. 1989) This study ThIS study Th,s study 'Antibiotic resistance determinants: amp. ampicillin: kan. kanamycin: tet. tetracycline: cam. chloramphenIcol. >.266 contains an operon fusion which places the chloram­phenicol acetyltransferase gene (cat) and the lacZYA genes under control of the papBA promoter (Figure I). Inocula­tion of strain DL579 onto M9 minimal medium containing glycerol and the Lac indicator X-Gal (M9-Glyc) resulted in the appearance of white (Lac-. phase off) colonies and blue (Lac +, phase on) colonies. Bacterial cells isolated from both Lac + and Lac - colonies contained a single >.266 phage per cell as evidenced by Southern blot analysis (data not shown) and a terminase test (see Materials and methods). To determine the fraction of phase on cells in Lac+ colonies and phase off cells in Lac - colonies, bacteria from each colony type were inoculated onto M9 Glyc medium and the number of blue and white colonies was detennined, We make the assumption that a single phase off bacterium generates a Lac - colony and a single phase on bacterium generates a Lac+ colony (Blyn el al., 1989). We found that Lac~ colonies contained 99% phase off cells, but Lac+ colonies contained only - 35 % phase on cells. This low fraction of phase on cells was the result ofa 100-fold higher on - off switch rate compared with the off - on rate (Table II). To increase the fraction of phase on cells in Lac+ colonies, we incubated E.coli strain DL579 in LB medium containing chloramphenicol (85 I4g/ml) , selecting for growth of bacteria that initiated transcription of the cal gene at the papBA promoter. We found that chloramphenicol addition increased the percentage of phase on cells in Lac + colonies to -80-90%. DNAs obtained from E.coli strain DL579 phase off cells (99% pure) and chloramphenicol-selected phase on cells (80% pure) were digested with the restriction enzymes shown in Figure 2, both singly and in combination, separated by polyacrylamide gel electrophoresis, and transferred to nylon filters by electroblotting. Using the 1613 base pair (bp) EcoRI-BamHI DNA sequence shown in Figure 2 as probe. DNA fragments of - 100 bp and larger were detected. The restriction digest patterns of phase off and phase on DNAs appeared similar (data not shown) suggesting 41 Table II. Phase transiuon frequencie, observed for Emli pap' -i<lCZY.4 fusion Iy>ogen, Ob;.erved Lac ~ - Lac - SWitch frequencie, ----- --~~ ---- E. {Uti ia,ZYA Lac phenotype! T Olal number Number of Lac + 1 Switch Weighted oj> Lysogen carbon sou ree of colonies number of Lac- frequency average of (relevant genotype) counted colonies::! (er or tl)n frequenciesc DL379 Lac +. M9-glycerol " = 2.60 X 1O-1d (MC4100 A246J DL379 Lac -. M9-glycerol tJ= J.57x 1O-4d (MC4100 ),2461 DL557 Lac - . M9-glycerol 4306 2700/ 1606 '" = 1.50 X 10-2 (MC4100 A265) 2nd ColollY as above 3335 1293/2042 a = 2.49 x 10-' 3,d Colony as above 2635 18101825 ex= 1.29 x 10-1 n = 1.77 x 10 2 DL557 Lac -. M9-glycerol 3810 5113759 11 = 5.24 x 1O~' (MC4100 A265) 2nd Colonv as above 4360 6214298 i3 = 55:' X 10-4 yd CoJon;' a\ above 3232 46/3186 d = 5.62 X 10- 4 P = 5.46 X 10-4 DL579 Lac ~. M9-glycerol 2776 947'1829 IT = 2_81 x 10-2 (MC4100 ),266) 2nd Colony as above 3988 2951/1037 ex= 1.11 x 10-2 jHl Colon)' a'i above 3451 191911532 a= 1.89 X 1O~2 a= 1.84 x 10-' DL579 Lac -. M9-glycerol 2512 412508 11 = 6.60 x 10-5 (MC4100 A2(6) 2nd Colonv a" above 3856 17/3839 i3 = 1.79 X 10-4 3'd C olon~ as ab<}\"e 3924 9/3915 13 = 9.31 x IO-s d = 1.19 X 10- 4 'u.c+fLac'- ratio is the number of Lac' colonies divided by the number of Lac- colonies. "The Lac~ -Lac - transition frequency IS designated '0·, and the Lac- -Lac· transition frequency is designated '{L "The weighted average of the switch frequency wa' calculated as described previously (slyn et al .. 1989) and takes mto account the number of progeny examined for each experiment. "From (Blyn er aI., 1989). i..266 (DL579) 1--1 HXlbp a~ !! II ~ ! t;; ~ ; ! I J oo~ SC ~ ~ ~ ! I Papl 9+ .- .. .. 7 ~ ~-- ..., - =-S-: cgE:.~~~ ~~ ;;::- ~ ~ <::.< --~::. s:: ii2 !!! ~~~ ! ! C!Dil ~ II I " II , I FzzzzzJ4 tZ2l PapB CAT +27 +---27 ~ 12 3 13 Fig, 2. Restriction map of pap DNA and outline of strategy used for PCR DNA sequencing. The locations of restriction enzyme siles relative to the EcoRI Site (at nucleotide position '0') are shown in parenthesis. The two shon arrows denote oligonucleotides # 9 and # 27 used for amplification of pap DNA. Longer arrow, show the locations of DNA sequences obtained using the designated oligonucleotide primers (see Materials and methods). that rearrangements of pap DNA sequences larger than - 100-150 bp did not occur during phase variation. Further analysis of DNAs from phase on and phase off E. coli strain DL579 populations was carried out by sequence analysis of chromosomal DNAs after amplification by the polymerase chain reaction (PCR). DNA amplification was achieved using oligonucleotide primers that flanked the 1 kb papl-B DNA sequence of strain DL579 and were in inverted orientations (Figure 2, oligonucleotides # 9 and # 27). These two primers hybridized to DNA sequences outside of the pap sequences required for phase variation: oligonucleotide # 27 hybridized within the cat gene, whereas oligonucleotide # 9 hybridized downstream of pap!. Pap DNA sequences downstream of pap! are not required for phase variation since apap subclone missing this region (strain DL577) maintains a phase variation phenotype (Table IT). Thus, any pap DNA sequences located between these these two primers should be amplified, regardless of any DNA rearrangements that may have occurred within pap during phase variation. To facilitate DNA sequence analysis, a single strand of DNA was generated by asymmetric peR using oligo­nucleotide primers # 9 and # 27 (Figure 2 and Materials and methods). Analysis of PCR products by agarose gel electro­phoresis indicated that a single DNA product was generated after amplification of DNAs obtained from both phase on and phase off E.coli. These DNAs were sequenced using Taq DNA polymerase