Role of yFACT in transcriptional initiation in Saccharomyces cerevisiae

The yeast Nhp6 protein is an architectural transcription factor in the budding yeast Saccharomyces cerevisiae. Genetic experiments suggest that Nhp6 can affect gene expression both positively and negatively, depending on the gene. In this dissertation, I have explored the functions of Nhp6 in relation to the yFACT chromatin reorganizing complex. The results show that the transcriptional regulation by Nhp6 in regulating binding of the TATA-binding protein (TBP) is mediated through the yFACT complex. A genetic screen conducted in yeast identified TBP mutations that are lethal in the absence of Nhp6, but viable in a NHP6+ strain. Further analysis of these TBP mutations showed a functional interaction among Spt3, TBP and Nhp6 in regulating essential functions in vivo, including formation of the complex of TBP and TFIIA with DNA. Using both genetic and biochemical assays, we have shown that Nhp6, histone acetylation by Gcn5, and chromatin remodeling by the Swi/Snf chromatin remodeling complex, have a role in TBP-TFIIA complex formation. We have also explored functional relationships between Nhp6 and Gcn5 with negative regulators of TBP binding such as Mot1 and the Ccr4/Not complex. We show that Mot1 and Ccr4/Not also have a positive role in formation of the TBP-TFIIA complex in vivo. Previous work suggested that posttranslational histone methylation at H3-K36 regulates transcription at the elongation step. Our results show that this histone modification also negatively regulates yFACT mediated TBP and RNA polymerase II binding at the promoter regions of some genes. The ATP-dependent chromatin remodeler Chd1 physically and genetically interacts with components of the yFACT complex. In vivo Chd1 has been implicated in negative regulation of transcription. We provide evidence that shows an opposite role of Chd1 in the yFACT mediated stimulation of TBP and RNA polymerase II binding at promoter regions. The role of components of the yFACT complex in regulating transcription at the promoter region is discussed.

THE ROLE OF yFACT IN TRANSCRIPTIONAL INITIATION IN SACCHAROMYCES CEREVISIAE by Debabrata Biswas A dissertation submitted to the faculty of The University of Utah in partial fulfillment of the requirements for the degree of Doctor of Philosophy In Experimental Pathology Department of Pathology The University of Utah December 2006 Copyright © Debabrata Biswas 2006 All Rights Reserved THE UNIVERSITY OF UTAH GRADUATE SCHOOL SUPERVISORY COMMITTEE APPROVAL of a dissertation submitted by Debabrata Biswas luis dissertation has been read by each member of the following supervisory committee and by majority vote has been found to be satisfactory. o Weis I I ~ /' Jared Rutter Warren Voth THE UNIVERSITY OF UTAH GRADUATE SCHOOL FINAL READING APPROVAL To the Graduate Council of the University ofUtah= r have read the dissertation of Debabrata Biswas in its final fonn and have found that (l) its fonnat, citations, and bibliographic style are consistent and acceptable; (2) its illustrative materials including figures, tables, and charts are in place; and (3) the final manuscript is satisfactory to the supervisory committee and is ready for submission to The Graduate School. Lf?J.- Lo 6 David Stillman Chair: Supervisory Committee Approved for the Major Department ~ .. Peter E. Jensen ChairlDean Approved for the Graduate Council David S. Chapma Dean of The Graduate School ABSTRACT The yeast Nhp6 protein is an architectural transcription factor in the budding yeast Saccharomyces cerevisiae. Genetic experiments suggest that Nhp6 can affect gene expression both positively and negatively, depending on the gene. In this dissertation, I have explored the functions of Nhp6 in relation to the yFACT chromatin reorganizing complex. The results show that the transcriptional regulation by Nhp6 in regulating binding of the TATA-binding protein (TBP) is mediated through the yFACT complex. A genetic screen conducted in yeast identified TBP mutations that are lethal in the absence of Nhp6, but viable in a NHP6+ strain. Further analysis of these TBP mutations showed a functional interaction among Spt3, TBP and Nhp6 in regulating essential functions in vivo, including formation of the complex of TBP and TFIIA with DNA. Using both genetic and biochemical assays, we have shown that Nhp6, histone acetylation by GcnS, and chromatin remodeling by the Swi/Snf chromatin remodeling complex, have a role in TBP-TFIIA complex formation. We have also explored functional relationships between Nhp6 and GcnS with negative regulators ofTBP binding such as MotI and the Ccr4/Not complex. We show that MotI and Ccr4/Not also have a positive role in formation of the TBP-TFIIA complex in vivo. Previous work suggested that posttransiational histone methylation at H3-K36 regulates transcription at the elongation step. Our results show that this histone modification also negatively regulates yFACT mediated TBP and RNA polymerase II binding at the promoter regions of some genes. The A TP-dependent chromatin remodeler Chdl physically and genetically interacts with components of the yFACT complex. In vivo Chdl has been implicated in negative regulation of transcription. We provide evidence that shows an opposite role of Chdl in the yFACT mediated stimulation of TBP and RNA polymerase II binding at promoter regions. The role of components of the yFACT complex in regulating transcription at the promoter region is discussed. v TABLE OF CONTENTS ABSTRACT ........................................................................................... iv LIST OFTABLES .................................................................................... ix ACKNOWLEDGMENTS. .. . . . . . . . . . .. . . . . . . . . .. . . . .. . . .. .. . .. . . . . .. . ............................. Xl Chapter 1. INTRODUCTION ........................................................................... 1 An overview of eukaryotic transcription .................................................. 2 Overview of transcriptional regulation by different factors in Saccharomyces cerevisiae ..................................................................................... 3 Transcriptional regulation by general transcription factors ........................... .4 Transcriptional regulation by histone modification ...................................... 8 Transcriptional regulation by histone acetylation ....................................... 8 The bromodolnain and recognition of histone acetylation Inodification ............ 12 Regulation of transcription by histone methylation ................................. 14 Histone H3 methylation at lysine-4 .................. , ................. '" ............... 15 Histone H3 nlethylation at lysine -36 ................................................... 17 Histone H3 methylation at lysine -79 ................................................... 19 The chronlodomain and recognition of histone nlethylation modification ........ 20 Dynamics of lysine methyl modification of histone tails ............................. 20 Histone monoubiquitylation and regulation of transcription .......................... 21 Transcription regulation by chromatin remodeling complexes ...................... 22 Transcriptional regulation by architectural transcription factors ..................... 27 The yFACT complex and its role in transcription in vivo ................. ............ 29 Rationale for thesis research .............................................................. 31 References ................................................................................... 34 2. TATA-BINDING PROTEIN MUTANTS THAT ARE LETHAL IN THE ABSENCE OF Nhp6 HIGH MOBILITY GROUP PROTEIN ...................... .48 Introduction ................................................................................. 49 Materials and methods ..................................................................... 50 Results ....................................................................................... 51 Discussi on ................................................................................... 56 References ................................................................................... 58 3. ROLE FOR Nhp6, Gcn5 AND THE Swi/Snf COMPLEX IN STIMULATING FORMATION OF THE TATA-BINDING PROTEIN-TFIIA-DNA COMPLEX .................................................................................. 60 Introduction ................................................................................ 61 Materials and methods ..................................................................... 62 Results ....................................................................................... 63 Discussion ................................................................................... 68 References ................................................................................... 69 4. GENETIC INTERACTIONS BETWEEN Nhp6 AND Gcn5 WITH MotI AND THE Ccr4/Not COMPLEX THAT REGULATE BINDING TATA-BINDING PROTEIN IN SACCHAROMYCES CEREVISIAE ................................. 71 Introduction ................................................................................. 72 Materials and methods ..................................................................... 73 Results ....................................................................................... 75 Discussi on ................................................................................... 80 Literature cited ............................................................................. 82 5. THE yFACT COMPLEX HAS A ROLE IN TRANSCRIPTIONAL INITIATION ................................................................................ 85 Introduction ................................................................................. 86 Materials and methods ..................................................................... 86 Results ....................................................................................... 87 Discussi on ................................................................................... 93 References ................................................................................... 94 6. OPPOSING ROLES FOR Set2 AND yFACT IN REGULATING TBP BINDING AT PROMOTERS ........................................................... 105 Abstract ..................................................................................... 106 Introduction ................................................................................ 106 Results ...................................................................................... 109 Discussion ................................................................................. 137 Materials and methods .................................................................... 142 References .................................................................................. 152 7. A NEGATIVE ROLE FOR Chdl IN REGULATING yFACT MEDIATED TBP BINDING AT PROMOTER ............................................................. 158 Abstract ..................................................................................... 159 Introduction ................................................................................ 160 Vll Materials and methods ................................................................... 163 Results ...................................................................................... 167 Discussion ................................................................................. 190 References ................................................................................. 196 8. CONCLUSIONS .......................................................................... 201 Summary ................................................................................... 202 yFACT as a global transcription regulator at prOlTIoter region ...................... 207 Future directions .......................................................................... 208 References ................................................................................. 212 viii LIST OF TABLES Table 1.1. The HAT complexes in S. cerevisiae .................... 0000 •••••• 0 •••••••• 0 ............ 10 1.2. Bromodomain containing proteins in yeast (So cerevisiae) ............................ 13 1.3. Chromodomain containing proteins in yeast (S. cerevisiae) ........... ............... 21 1.4. ISWI protein cOlnplexes in yeast (S. eerevisiae) ............. 0 .................. , •••••• 25 1.5. The members of CHD family proteins ..................................................... 26 2.1. S. cerevisiae strains used in this study .................................................... 50 2.2. Plasmids used in this study ................................................................ 51 2.3. TBP mutations lethal in the absence of Nhp6 ............................................ 54 3.1. Strains used in this study .................................................................. 62 3.2. Multicopy plasmids .......................................................................... 62 3.3. TBP mutations with synthetic phenotypes with genS or swi2 mutations ............ 63 3.4. Synthetic growth defects caused by TFIIA mutants with genS, swi2, or nhp6ah.65 4.1. Strain list .................................................... '" .............. , " .............. 73 4.2. Plasmids ................... 00 ••••••••••••• 0 ••••••••••••••••••••••••••••••••••••••••••••••••••• 74 4.3. Synthetic lethality of TBP mutants with mot] and ccr4 .......... ..................... 78 5.1. Genetic interactions between TBP and Spt16 mutants ................................. 88 5.2. Multicopy suppression of TBP spt]6 synthetic lethality ............................... 90 5.3. Strain list for yFACT and TBP study .................................................... 97 5.4. Plasmid list for yFACT and TBP study ................................................. 101 6.1. Strain list for yFACT and Set2 study .................................................... 143 6.2. Plasmid list for yFACT and Set2 study .................................................. 148 6.3. Oligonucleotide list for yFACT and Set2 study ........................................ ISO 7.1. Strains used for yFACT and Chdl study ................................................. 164 7.2. Plasmids used for yFACT and Chdl study ............................................. 168 7.3. Oligonucleotide list for yFACT and Chd1 study ...................................... 169 x ACKNOWLEDGMENTS I would like to thank my supervisor Prof. David J. Stillman for his excellent guidance and encouragement. I would also like to thank my thesis committee members for their ideas and suggestions during my graduate study. This work was carried out in the friendly and constructive environment of Stillman lab. I thank all the members of the Stillman Lab for their help and suggestions. Special thanks go to my dear wife Rinku Dutta-Biswas and my family members especially to my Ma, Baba, Dada, Boudibhai, Didi, lamaibabu, Babai, Bon, Swapan Da, Mimi, our family members at Palta and members of lathamasai's family. CHAPTER 1 INTRODUCTION 2 An overview of eukaryotic transcription Eukaryotic transcription involves three different steps: initiation, elongation and termination. Research from the last several years has identified a plethora of transcription factors that are involved in regulation of specific steps of transcription. Eukaryotic DNA is packaged into a highly compacted structure known as chromatin. Because of this compaction, the underlying DNA sequences are not accessible for binding by most DNA­binding transcription factors. Because of the nature of chromatin, the default state of most of protein coding genes is "off". However, in response to different stimuli, specific sets of genes are expressed through recruitment of gene-specific transcription factors. The process of turning on a particular gene starts with the recruitment of sequence-specific transcriptional activator proteins to the promoter region. Binding of the activator protein complex may in turn recruit several transcriptional co-activator complexes. These co­activators may change the structure of chromatin and thereby help in the recruitment of several other transcription factors, ultimately reSUlting in RNA polymerase recruitment to initiate transcription. Once RNA polymerase starts transcribing the DNA sequences from the promoter region, progression of the elongating RNA polymerase is regulated by several factors. These include: i) accessibility of the DNA sequences to the elongating RNA polymerase for transcription, ii) restoration of transcription after RNA polymerase experiences a pause during elongation, iii) co-transcriptional recruitment of RNA processing machinery, and iv) reassembly or restoration of chromatin structure after RNA polymerase passes through the chromatin. Several transcription factors have been identified that have specific roles in one or more of these events in vivo. These factors are 3 recruited sequentially in a co-transcriptional manner during the entire elongation process (Orphanides and Reinberg, 2000; Sims et aI., 2004). Elongation by RNA polymerase starts with a specific set of transcription factors at the 5' end of a transcription unit. These are exchanged with a different set of transcription factors during progression to the 3' end (Kim et aI., 2004; Pokholok et aI., 2002). However, some factors remain bound to elongating RNA polymerase throughout the ORF. The process of transcription termination starts once the elongating RNA polymerase encounters the poly-adenylation (poly-A) sequence of the transcribed region. Recruitment of the cleavage poly­adenylation factors at the poly-A site in turn recruits the transcription termination factors that ultimately cause pausing and dissociation of the elongating RNA polymerase from the coding region (Buratowski, 2005). Although several transcription factors have been identified that have specific roles during specific step of transcription, there are instances in which a factor may have roles in regulating two different steps of transcription. It is not known whether these factors generally act within two different complexes or their effect at a particular step in transcription has an indirect role in regulating other step. Overview of transcriptional regulation by different factors in Saccharomyces cerevisiae The budding yeast, Saccharomyces cerevisiae (S. cerevisiae), has been used as a great model system for studying eukaryotic transcriptional regulation. The power of yeast genetics in combination with biochemical studies has promoted understanding of various modes of regulating transcription in eukaryotes. Most the essential genes are conserved from yeast to human during evolution, and thus most findings on transcriptional 4 regulation in yeast also hold true for other higher organisn1s. In all eukaryotic organisms, the DNA sequence is wrapped around the histone octamer to form the nucleosome. Nucleosomes are the building blocks of the highly compacted structures known as chromosomes. One of the important tasks of the eukaryotic transcription machinery is to make the underlying DNA sequence available to sequence-specific DNA-binding transcription factors. The ultimate goal of all of the transcription factors involved in the transcription initiation is to recruit RNA polymerase and initiate transcription by the RNA polymerase. There are three major mechanisms by which the transcriptional elongation factors regulate transcription by the RNA polymerase: i) by changing the structure of chromatin so as to facilitate passage for RNA polymerase through the inhibitory chromatin, ii) by resuming transcription by RNA polymerase once it pauses or arrests during transcription, iii) by reasserrlbling the normal repressive chromatin structure to prevent inappropriate transcriptional initiation from TAT A elements within coding regions. The factors responsible for the transcription termination are co­transcriptionally recruited during the transcription elongation process (Problem of redundancy). Studies from the last few years have implicated a growing number of transcription factors that are involved in regulating all the steps of transcription. In this introduction, I will discuss the factors and mechanisms by which different steps of transcription are regulated, with emphasis to transcriptional regulation in S. cerevisiae. Transcriptional regulation by general transcription factors The regulation of expression of specific sets of genes starts with recruitment of transcription factors in a promoter specific manner. Recruitment of general transcription factors (GTFs) at the promoter region helps in promoter melting and DNA unwinding 5 for transcriptional initiation (Naar et aI., 2001; Reinberg et aI., 1998). These factors include TFIIA, B, D, E, F and H. Recruitment of TFIID to a TAT A sequence forms a scaffold for binding of the other GTFs. The sequence specific binding of TFIID to a TATA-box containing DNA is achieved through sequence specific binding ofTATA­binding protein (TBP), a subunit of the TFIID complex. In vitro binding experiments have shown that TBP binding is followed by binding of TFIIA and TFIIB to form the TBP-TFIIA-TFIIB ternary complex with DNA. Binding of the TFIIA and TFIIB to the TBP-DNA complex stabilizes TBP binding to the DNA. Formation of the TBP-TFIIA­TFIIB complex is one of the critical steps in transcriptional initiation in eukaryotes. DNA-binding by TBP is required for transcription by all three RNA polymerases. TBP is associated with a variety of complexes, such as SL1 (Comai et aI., 1992), TFIID and TFIIIB (Pugh, 2000). SL1 functions at RNA polymerase I promoters, the TFIID is specific for some promoters of mRNA genes transcribed by RNA polymerase II, and the TFIIIB complex targets RNA polymerase III genes. Several transcription factors have been identified that regulate transcription by regulating TBP binding. The positive regulators of TBP binding include several transcriptional coactivators containing histone acetyl transferases, chromatin remodelers, etc. (Pugh, 2000). The most studied negative regulators of the TBP binding are Mot1 (Auble et aI., 1994; Auble et aI., 1997; Darst et aI., 2003; Dasgupta et aI., 2002), NC2 (Cang et aI., 1999; Goppelt and Meisterernst, 1996; Mermelstein et aI., 1996) and the Ccr4/Not complex (Badarinarayana et aI., 2000; Oberholzer and Collart, 1999). Motl is a Snf2/Swi2-related ATPase factor that can drive dissociation of the TBP-DNA complex in vitro (Auble et aI., 1997). The negative regulation by Mot1 is attributed to the ability to 6 dissociate the TBP-DNA complex. Evidence suggests that MotI also positively regulates transcription (Dasgupta et aI., 2002; Geisberg et aI., 2002). It has been hypothesized that the ability of Mot1 to dissociate abortive TBP-DNA complexes is also responsible for MotI positively regulating transcription of some genes. The two subunits of NC2 are encoded by BUR6 and YDRl in S. cerevisiae. NC2 associates with the promoter-bound TBP, thereby preventing the recruitment of TFIIA and TFIIB to the TBP-DNA complex in vitro (Kim et aI., 1995). Studies in yeast have identified a mutation in the largest subunit of TFIIA that acts as a suppressor of the essential role for NC2, providing in vivo support for the results of the in vitro studies (Xie et aI., 2000). A crystal structure of NC2 recognizing the TBP-DNA complex has been described that shows that NC2 binding precludes recruitment of TFIIA and TFIIB to the preformed TBP-DNA complex (Kamada et aI., 2001). There are two Ccr4-Not complexes, each a large multiprotein complex of either 1.2- or 2-MDa molecular weight (Liu et aI., 1998). Five Not proteins are associated with Ccr4 to form the Ccr4/Not complex. This complex has a role in various cellular processes including mRNA deadenylation and thereby regulates IT1RNA degradation (Denis and Chen, 2003). However, evidence also suggested that the Ccr4/Not complex regulates TBP binding to DNA. For example, i) components of the Ccr4/Not complex show genetic interaction with TBP (Badarinarayana et aI., 2000), and ii) Not1 protein physically interacts with TBP and components of the TFIID complex (Deluen et aI., 2002; Huisinga and Pugh, 2004). The mechanism of negative regulation of the Ccr4/Not complex in the TBP binding is unknown. There is substantial evidence suggesting that DNA-binding by TBP can also by negatively regulated by the ability of TBP to form a homodimer (Alexander et aI., 2004; Coleman et aI., 1995; Weideman et aI., 1997). Transcription factors such as TFIIA and Brf1 can inhibit TBP homodimer formation and thereby positively regulate transcription (Alexander et aI., 2004; Weideman et aI., 1997). Promoter specific recruitment of TBP has been studied in relation to SAGA and the TFIlD complex. Genome-wide analysis shows that for 90% of yeast genes TBP binds as part of the TFIIA complex, and at the remaining 10% of yeast genes TBP binding requires the SAGA co-activator complex (Huisinga and Pugh, 2004). SAGA-dependent TBP binding occurs at promoters with canonical TAT A boxes, while TFIID binds to promoters with imperfect TAT A sequences (Basehoar et aI., 2004). Therefore the promoter specific recruitment of TBP may actually be dependent on other proteins that are associated with both the SAGA and TFIID complexes. The multiprotein con1plexes TFIID and SAGA share some common subunits, known as T AFs (TBP-associated factors). The actual roles of all these TAFs in recruiting SAGA and TFIID to specific promoters and their role in facilitating TBP binding are still unclear. Work from the last several years has shown that while GTFs are absolutely required to promote transcription, regulation of chromatin structure is also important. Chromatin regulation of transcription includes histone modifications, chromatin remodeling by the ATP-dependent chromatin remodeling complexes, assembly of multi protein complexes by architectural transcription factors and chromatin reorganization by chromatin binding factors. I will discuss the roles of these factors in brief in the subsequent sections of this introduction. 7 Transcriptional regulation by histone modification The nucleosome is a highly compacted structure composed of 147 bp of DNA and a histone octamer with two copies each of four different histone proteins: H2A, H2B, H3 and H4 (Luger et al., 1997). Each nucleosome is a highly structured complex, although the tails of histone proteins that protrude out of the nucleosome are unstructured. These histone tails are subject to post-translational modifications that play an important role in regulating eukaryotic transcription (Strahl and Allis, 2000). During the last few years the field of eukaryotic transcription has witnessed the identification of several transcription factors that regulate transcription through post translational modification of histones (Strahl and Allis, 2000). These post translational histone modifications include the acetylation of lysine residues, methylation of lysine and arginine residues, phosphorylation of serine and threonine residues, ubiquitylation of lysine residues, sumoylation of lysine residues, and the poly-ADP-ribosylation of glutamic acid residues (de la Cruz et al., 2005). Several transcription factors have also been described that recognize specific histone modifications, with this recognition leading to physical interaction. Significant progress has been made in understanding the roles played by histone acetylation, histone methylation and histone mono-ubiquitylation in regulating eukaryotic transcription as described below. Transcriptional regulation by histone acetylation The importance of histone acetylation in regulating the eukaryotic transcription has been known for a long period of time. Hyperacetylation of histones at genes is correlated with transcriptional activity (Hebbes et al., 1988). Because acetylation of lysine residues neutralizes the positive charge of this residue, initially it was assumed that a decrease in 8 9 the electrostatic interaction between DNA and the histone proteins is the major acetylation-dependent mechanism that regulates gene expression. The first histone acetyltransferase (HAT) protein identified was aSS kDa Tetrahymena protein with HAT activity (Brownell and Allis, 1995). It was subsequently shown that the sequence of this HAT protein strikingly matches the yeast Gcn5 protein (Brownell et aI., 1996). HAT enzymes form a trimeric complex with acetyl-CoA and the lysine residue, enabling the direct transfer of the acetyl group from acetyl CoA to the lysine residue (Roth et aI., 2001). A number of budding yeast proteins have been identified that show HAT activity (Table 1.1). These HAT proteins are mostly found in large complexes with other proteins. Some HAT proteins specifically modify only certain lysine residues, while others show broad specificity. Although the mechanism behind this residue specificity of HAT proteins is not clear, it is thought that the associated proteins in a HAT complex determine the specificity of the HAT proteins for their substrates. In Saccharomyces cerevisiae, the HATs are targeted to promoters by specific DNA­binding proteins. For example, the transcriptional activator Gcn4 recurits the HAT Gcn5, which is a subunit of the SAGA complex, to the promoter of the HIS3 gene (Kuo et aI., 2000; Utley et aI., 1998). This causes histone acetylation by Gcn5 primarily at histone H3 and H2B. The histone acetyltransferase Esa1, which is the catalytic component of the NuA4 (nucleosome acetyltransferase of histone H4) HAT complex, acetylates histones H4 and H2A in yeast (Allard et aI., 1999; Doyon and Cote, 2004). Although the HAT activities of most of the HATs have 110t been described in relation to specific promoters and coding regions, some HATs acetylate only within coding regions of genes. For example, Elp3, which acetylates the Lys residues of the histones H3 and H4 tails in vitro, 10 Table 1.1. The HAT complexes in S. cerevisiae HAT Organism Complex Functions in transcription Yeast SAGA, SLIK, Transcriptional activation SALSA,ADA, HAT-A2 Esal Yeast NuA4 complex Transcri pti onal acti vation SptlO Yeast SptlO/Spt2l Transcriptional activation Sas3 Yeast NuA3 complex Transcriptional activation Sas2 Yeast SAS-I complex Anti-silencing Hat 1 Yeast Hat1l2 complex Histone deposition TAFI Mammal/fl y /yeast TFIID Transcriptional initiation by RNA polymerase II Elp3 Yeast Elongator Transcription elongation Hpa2 Yeast Unknown Med5 Yeast Mediator Transcriptional initiation by RNA polymerase II has been shown to associate with the elongating form of RNA polymerase II as part of the elongator complex and to acetyl ate the coding region of genes (Winkler et aL, 2002). Genome-wide analysis shows that histone acetylation is primarily present at the 5'end of genes (Kurdistani et al., 2004; Pokholok et al., 2005). In a striking finding, it was found that acetylation of only certain lysine residues correlates with transcriptional activity of a promoter. For example, acetylation at histone H3-K18, K27 and K9 is 11 correlated with high transcriptional activity (Kurdistani et aI., 2004). In contrast, acetylation of histone H4-K8, K12, and K16 is seen at transcriptionally inactive genes (Kurdistani et aI., 2004). Based on these genome-wide analyses of histone acetylation patterns, acetylation clusters have been described for some gene groups and transcription factors that are required for specific biological functions (Kurdistani et aI., 2004).Recent work also shows that acetylation within the globular domain of histone H3 at K56 is also important in regulating transcription of some genes, and that SptlO is responsible for this modification (Xu et aI., 2005). The dynamics of histone acetylation in vivo is maintained by deacetylation of acetylated histone by histone deacetylases (HDACs). There are five HDACs in S. cerevisiae, including Rpd3, Hdal, Hosl, Hos2 and Hos3 (Kurdistani and Grunstein, 2003). All of these HDACs function in multi protein complexes. The Rpd3 HDAC complex is the best characterized histone deacetylase complex in yeast. There are two different forms of Rpd3 HDAC complexes in yeast, Rpd3 large (Rpd3(L)) and Rpd3 small (Rpd3(S)) (Kasten et aI., 1997). The Ume6 DNA-binding protein, which is part of the Rpd3(L) complex, recruits Rpd3(L) through Sin3, to a specific DNA element (URSI) in the INO] promoter (Carrozza et aI., 2005; Kadosh and Struhl, 1997; Rundlett et aI., 1998). Chromatin immunoprecipitation (ChIP) studies show that the Rpd3(L) complex is enriched at the INO] promoter where it deacetylates almost all sites of acetylation on histones H4, H3, H2A and H2B (Kadosh and Struhl, 1998; Suka et aI., 2001). The region of deacetylation is highly localized, and limited to a region of one or two nucleosomes immediately adjacent to the URSI element of the INO] promoter (Kadosh and Struhl, 1998). This repressive chromatin structure formed by deacetylation may block the 12 recruitment of other transcription factors, resulting in negative regulation of transcription. The Rpd3(S) complex has been shown to have a role during transcription elongation at the 3' end of some genes. This aspect of Rpd3(S) in regulating transcription is discussed later. The Hdal HDAC complex of yeast can be recruited to its target promoters through the Ssn6/Tup1 corepressor complex (Wu et aI., 2001) and deacetylates histones H3 and H2B. Like Rpd3 deacetylation, recruitment of the Ssn/Tup1 complex also results in local deacetylation of a region that spans one to two nucleosomes adjacent to the recruitment site (Wu et al., 2001). The Hos2 HDAC complex associates physically with coding regions of genes when they are transcribed and specifically deacetylates histones H3 and H4 in vivo (Wang et al., 2002). Hos2 has been described in regulating transcription both positively and negatively. The bromodornain and recognition of histone acetylation modification The bromodomain containing proteins recognize the acetylated histone residues, and helps in recruiting other transcription co-activators such as the nucleosome remodeling and HAT-containing complexes (de la Cruz et al., 2005). The yeast bromodomain factors and their roles in transcription are described in Table 1.2. Interaction between acetylated histones and bromodomain containing complexes is thought to stabilize the interaction of these complexes with nucleoso1l1es and promote nucleosome remodeling (Hassan et aI., 2002), histone acetylation (Syntichaki et al., 2000), and TFIID recruitment (Martinez­Campa et aI., 2004; Matangkasombut et aI., 2000). The recognition of the acetylated histone tails by the bromodomain containing factors can also promote exchange of 13 Table 1.2. Bromodomain containing proteins in yeast (S. cerevisiae) Protein acti vi ty Histone interaction Chromatin remodeling Histone acetylation Gene BDFI SWI21SNF2 RSC4 STHI GCN5 Complex Protein Molecular function SWRII Bdfl Histone exchange TFIID Transcriptional coacti vation Swi/Snf Swi2 Transcri pti onal coacti vati on RSC Rsc4 Transcriptional coactivation RSC Sthl Transcriptional coactivation SAGA Gcn5 Transcriptional coactivation histones. For example, Bdfl, a component of the SWRI complex, is able to exchange the conventional histone H2A in nucleosomes for a histone variant H2A.Z (Htzl) (Krogan et aI., 2003b; Raisner et a}., 2005; Zhang et aI., 2005a). Although acetylation of histone tails by HAT proteins and their roles in regulating transcription have been studied in great detail, acetylation of other non-histone proteins by the p300lCBP complex has also been shown to stimulate transcription in higher eukaryotes (Kimura and Horikoshi, 2004). Acetylation substrates of the mammalian p300lCBP complex include Spl, KLFI, FOXOI, MEF2C, SRY, GATA-4, HNF6, and Stat3 (Kimura and Horikoshi, 2004). Acetylation of these factors enhances transcriptional activity either by stimulating their DNA-binding activity or by promoting interaction with other transcription factors 14 Significant progress has been achieved in understanding the molecular mechanisms by which histone acetylation regulates eukaryotic transcription. However, the fundamental question of how multiple histone modifications specifically affect transcriptional processes remains unknown. A detailed analysis of both how these HAT­containing complexes are recruited to chromatin and the effects of complexes that specifically recognize acetylated histones may provide insights into the underlying mechanisms. Regulation of transcription by histone methylation Unlike the histone acetylation, which is involved mainly in transcriptional activation, histone methylation has been implicated in both the transcriptional activation and transcriptional repression. Lysines of histone H3 at 4,9, 14, 27, 36,79 and histone H4 at 20 and 59 are methylated by residue specific histone methyltransferases (Lee et al., 2005; Margueron et al., 2005). In general, lysine methylation of histone H3 at 4, 36 and 79 are associated with transcriptional activation and lysine methylation of histone H3 at 9, 27 and H4 at 20 are associated with heterochromatin formation and transcriptional repression. Histone methyl transferases (HMTs) that are specific for specific lysine residues have been characterized. Most of these histone methyl transferases contain a SET [Su(var), Enhancer of zeste, trithorax] domain structure that is responsible for catalysis and binding of cofactor S-adenosyl-L-methionine (AdoMet) (Bottomley., 2004; Cheng et al., 2005; Marmorstein, 2003; Xiao et al., 2003a). HMTs then transfer one or more methyl groups to the E-amino group of the specific lysine residues, resulting in mono-, di-, or trimethylatedlysine (Martin and Zhang, 2005; Zhang and Reinberg, 2001). Unlike acetylation, methylation of lysine residues does not change the net positive charge 15 on the nucleosome, rather it increases the bulkiness and hydrophobicity, which may disrupt the nucleosomal structure or create new sites for proteins that preferentially bind to the methylated histone proteins. How these histone modifications regulate transcription is an intense area of study. The known roles for some of these histone modifications in regulating transcription in S. cerevisiae are discussed below. Histone H3 methylation at lysine .. 4 Setl histone methyltransferase methylates histone H3 at lysine-4 (H3-K4) (Briggs et aI., 2001). This histone modification is generally associated with transcriptional activation (Bernstein et ai., 2002; Santos-Rosa et aI., 2002). By micro array analysis it has been shown that the deletion of SET] results in reduced expression of '" 80% of genes in S. cerevisiae (Boa et aI., 2003). Genome-wide analysis of the presence of different fom1s of the methylated histone H3-K4 revealed that the trimethylated form of the histone H3- K4 is predominant at the 5' end of the genes whereas the di- and monomethylated forms of histone H3-K4 is predominantly present at the coding region and 3' end of the genes, respectively (Pokholok et aI., 2005). However, the functional relationship between the presence of these modifications and transcriptional regulation is not known. In S. cerevisiae, Set1 is present as a member of a large multiprotein complex called COlVIPASS (Complex £roteins Associated with S.et1) (Miller et aI., 2001). It has been shown that Cps40 and Cps60 subunits of the COMPASS complex are required for the trimethylation of the histone H3-K4 but not for the di- and mono-methylation (Schneider et al., 2005). Although H3-K4 methylation is associated with transcriptional activation (Bernstein et aI., 2002; Noma and Grewal, 2002; Santos-Rosa et aI., 2002), some evidence suggests 16 a role in gene repression. In fact, Set1 was originally identified as a protein importantin gene silencing in S. cerevisiae (Nislow et al., 1997). Deletion of the SET] gene led to disruption of silencing of reporter genes integrated near telomeres, at the mating type loci, and at the rDNA locus (Briggs et al., 2001; Bryk et al., 2002). Therefore, it appears that Setl plays a complex role in both gene activation and repression in budding yeast and more studies will be required to understand how it participates in both positive and negative regulation of transcription. In S. cerevisiae, recruitment of Setl to genes is dependent on several events, including phosphorylation of the C-terminal domain (CTD) of RNA polymerase II (Ng et al., 2003b), the presence of the Paf1 elongation complex (Krogan et al., 2003a), and monoubiquitylation of histone H2B-K123 by the Rad6 enzyme (Ng et al., 2003a; Shahbazian et al., 2005; Wood et al., 2003b). The CTD of the RNA polymerase II consists of a long series of heptapeptiderepeats, Tyr-Ser-Pro-Thr-Ser-Pro-Ser. The phosphorylation status of the CTD correlates with the stages of RNA polymerase II in the transcription process (Ng et al., 2003b). Ser-5 phosphorylation of the CTD is important for facilitating the transition from transcription initiation to elongation and correlates with the initiation and the early phase of the transcriptional elongation process, whereas Ser-2 phosphorylation of the CTD is associated with the late phase of transcriptional elongation (Palancade and Bensaude, 2003). In S. cerevisiae, Ser-5 is phosphorylated by the TFIIH­associated Kin28 kinase, whereas Ser-2 is phosphorylated by Ctk1 kinase (Kobor and Greenblatt, 2002). The recruitment of the Setl containing COMPASS complex at the 5' end of the genes is regulated by several cooperative mechanisms. First, Setl associates with RNA polymerase II when the CTD is phosphorylated at Ser-5 but not at Ser-2 eNg et 17 al., 2003b). A kin28 mutation results in decreased recruitment of Set1 to the 5' coding region (Ng et al., 2003b). This indicates that the CTD phosphorylation of the newly initiated RNA polymerase II recruits the Set1 containing COMPASS complex, resulting in trimethylation of histone H3-K4 at the 5' end of genes. However, the relationship between the Set1 recruitment and predominant existence of the di- and monomethylated forn1 of the histone H3-K4 is still unc1ear. Second, components of the Paf1 transcription elongation complex interact with Set1 and are also required for recruitment of Set1 (Krogan et al., 2003a). Third, as discussed later, methylation of the histone H3-K4 is also dependent on monoubiquitylation of the histone H2B-K123 residue. Interestingly, the di­and tri-methylation of histone H3-K4 are dependent on monoubiquitylation of histone H2B-K123 residue, but mono-methylation does not required this monoubiquitylation (Dehe et al., 2005; Shahbazian et al., 2005). The Bur2 kinase selectively phosphorylates the CTD of RNA polymerase II and has been shown to regulate the tri-methylation by Set1 (Laribee et al., 2005). A bur2 mutation also regulates monoubiquitylation of histone H2B-K123 and recruitment of the Paf1 elongation complex, thereby regulating the tri­methylation by the Setl containing COMPASS complex. Histone H3 methylation at lysine-36 Lysine-36 residue of the histone H3 (H3-K36) is methylated by another SET domain containing protein, Set2. The K36 residue of histone H3 lies at the junction between the histone tail and core domains. Because of this unique location, methylation of this residue may directly alter the nucleosome structure and thus affect binding of different transcription factors that recognize either the modification or the altered chromatin structure. 18 Similar to histone H3-K4 methylation, histone H3-K36 methylation is also associated with active genes. Set2 preferentially binds to the Ser-2-phosphorylated form of CTD as compared with the unphosphorylated CTD of RNA polymerase II. This suggests that Set2 is recruited to the coding regions of the transcribed genes. Deletion of approximately 10 heptapeptide repeats of the RNA polymerase II CTD resulted in a significant loss of histone H3-K36 methylation globally, while having no effect on histone H3-K4 or H3- K79 methylation. Deletion of individual components of the Ctk kinase complex also results in complete loss of H3-K36 methylation. This provides strong evidence that Ser-2 phosphorylation of the RNA polymerase II CTD by the Ctk kinase complex controls H3- K36 methylation. The mechanism by which CTD phosphorylation at Ser-2 recruits Set2 to the 3' regions of genes is not known. The Pafl conlplex also plays an inlportant role in the recruitment of Set2, as was also observed for Setl. Thus, the Pafl complex and the Ser-2 phosphorylation of the RNA polymerase II CTD may work together to target Set2 and Set! to the coding regions of actively transcribed genes. In fact, genome wide analysis shows that the di- and trimethylated forms of histone H3-K36 are located predominantly present at the 3' end of the genes. However, the presence of the monomethylated histone H3-K36 in a genome wide manner has not been investigated. Similar to Set!, Set2 was also originally implicated in transcriptional repression in S. cerevisiae. Tethering of Set2 to the promoter of a reporter gene by fusing Set2 to a LexA DNA-binding domain results in repression of reporter gene expression, and this repression was partially relieved by mutations in the SET donlain. A GAIA promoter lacking its UAS element is expressed poorly, but a deletion of SET2 or a mutation at H3- K36 allows higher expression from this mutant promoter. Recent reports show a 19 functional link between histone H3-K36 methylation and the Rpd3(S) complex. These studies have shown that the Eaf3 chromodomain-containing protein in the Rpd3 (S) complex recognizes the methylated histone H3-K36 mark at the 3' end of some genes. Recruitment of this Rpd3(S) complex results in deacetylation of histones, allowing nucleosomes to return to the normal state following passage of RNA polymerase II. Reassembling the perturbed nucleosome to a pretranscribed state may be important to inhibit the usage of the cryptic TAT A sequence present in the coding sequences of some genes. One study reported dynamic changes in methylation at H3-K4 and H3-K36 at the MET16 gene (Morillon et aI., 2005). It has been proposed that the histone H3-K4 trimethylation and the H3-K36 di- and trimethylation regulate the post-initiation step of transcription, while the H3-K4 dimethylation and the H3-K79 trimethylation mark the onset of transcription elongation (Morillon et aI., 2005). Histone H3 methylation at lysine-79 Lys-79 of histone H3 (H3-K79) is methylated by DotI. DotI is a unique HMT, because it does not contain a SET domain and methylates a histone residue that is in the core of the nucleosome structure rather than a histone tail. In S. cerevisiae, histone H3- K79 dimethylation is present in the heterochromatic regions, including the rDNA, telomere, and silent mating type regions. Methylation at H3-K79 inhibits Sir2/3 binding and thereby disrupts silencing in S. cerevisiae. Histone methylation by DotI is also regulated by the Pafl complex and by histone rnonoubiquitylation by the Rad6/Brel complex. However, only the di- and tri-rnethylation at H3-K79, not the rnonomethylation, are regulated by histone monoubiquitylation at H3-K123 residue. The chromo domain and recognition of histone methylation modification 20 The protein motif that recognizes methylated lysine residues is called a chromodomain. In S. cerevisiae, several chromodomain containing transcription factors have been described (Table 1.3). Chromodomain containing proteins are involved in both transcriptional activation and transcriptional silencing (heterochromatin formation) in vivo. The HPI protein in human and Swi6, Clr3 and Clr4 proteins in fission yeast (Schizosaccharomyces pombe) are involved in formation of heterochromatin structures (Grewal and Moazed, 2003; Hiragami and Festenstein, 2005). As described earlier, the chromodomain of the Eaf3 protein in S. cerevisiae is involved in transcriptional regulation at the 3' end of the genes. The chromodomain of Esal is required for targeting the NuA4 HAT complex to the PH05 promoter, and this acetylation of H4 recruits the Ph04 activator (Nourani et aI., 2004). The chromodomain of Chdl has been shown to be important for recognizing dimethylated H3-K4 in vitro (Pray-Grant et aI., 2005). Chdl is associated with the SAGA/SLIK HAT complex, and thus K4 methylation results in binding of this coactivator complex (Pray-Grant et aI., 2005). Dynamics of lysine methyl modification of histone tails It was long believed that histone methylation was an irreversible post translational modification, with histone methylation changed only by turnover of nucleosomes. However the existence of lysine demethylases and arginine deiminases have recently been demonstrated. The only known lysine demethylase that selectively demethylates the 21 Table 1.3. Chromodomain containing proteins in yeast (S. cerevisiae) Protein activity Gene Complex Protein Molecular function Chromatin reassembly EAF3 Rpd3(S)/NuA4 Eaf3 Transcri pti onal repression Histone acetylation ESA1 NuA4 Esa1 Transcriptional coactivation Chromatin remodeling CHDI SAGA/SLIK Chd1 Transcriptional coacti vati on mono- and dimethylated form of the histone H3-K4 is LSD1 (Lysine Specific Demethylase 1) (Shi et aL, 2004; Shi et al., 2005). However, since most active genes are tri-methylated at H3-K4, it is tempting to speculate the existence of a histone demethylase specific for the trimethylated form of histone H3. No homolog of LSD1 is present in S. cerevisiae. The only known arginine deiminase described in mammals is PADI4 (£rotein Arginine Deiminase) (Cuthbert et al., 2004; Wang et al., 2004). This enzyme converts the arginine residue of histone to citrulline by a deimination reaction. The fate of this citrulline in nucleosomal structure is unknown. So far no arginine deiminase has been described in S. cerevisiae (Bannister and Kouzarides, 2005). Histone monoubiquitylation and regulation of transcription Unlike protein poiyubiquitylation that signals for protein degradation via the proteasome pathway, monoubiquitylation of a protein is a stable postranslational 22 modification. An E2 ubiquitin conjugating enzyme, Rad6 is responsible for the monoubiquitylation of histone H2B at residue K123 (Kao et aI., 2004). Deletion of RAD6 results in the elimination of the global H2B monoubiquitylation, as well as loss of dimethylation at K4 and K79 of histone H3 (Kao et aI., 2004). A rad6 mutation does not affect K36 methylation. BreI, an E3 ubiquitin ligase, associates with Rad6 and is required for targeting of Rad6 to chromatin (Wood et aI., 2003a). Deletion of BREi also results in loss of monoubiquitylated H2B and a loss of histone H3-K4 and K79 dimethylation. The components of the Pafl complex are also required for H2B K123 monoubiquitylation and thus, H3 K4 and K79 methylation as wen (Wood et aI., 2003b). Like Setl, Rad6/Brei also associates with the elongating RNA polymerase II via the Pafl complex (Xiao et aI., 2005). Transcription regulation by chromatin remodeling complexes The histone-DNA interactions in chromatin can be changed by chromatin remodeling complexes, such that the underlying DNA becomes more accessible to DNA-binding proteins. This remodeling of the nucleosome may lead to displacement of histone octamers exposing a particular DNA sequence to DNA-binding proteins. One of the hallmarks of chromatin remodeling complexes is their dependence on A TP hydrolysis for their functions (Becker and Horz, 2002). The chromatin remodeling complexes are multiprotein in nature. All the chromatin remodelers have an ATPase subunit of the Swi2/Snf2 family of ATPases. The enzymes in this family can be grouped into several subfamilies based on the sequence features outside of their ATPase domains. Direct evidence of chromatin remodeling activity has been demonstrated for some of these enzymes, including the Swi2/Snf2-related enzymes, 23 the ISWI/SNF2L-type ATPases, the CHDI family member Mi-2 and the IN080 complex (Cairns, 2005; Wang, 2003). Biochemical characterization of the SWI/SNF chromatin remodeling complex has identified 11 different subunits (Vignali et aI., 2000). The motor of this complex is the nucleosome remodeling ATPase Swi2/Snf2. The functions of many of the other subunits in this complex are less well understood. This complex has been shown to increase the accessibility of the nucleosomal DNA in an ATP-dependent manner. The proteins present in the SWIISNF complex were originally discovered and characterized as transcriptional activators, which fits nicely with the observation that they remodel the chromatin to enable transcription. However, genome-wide analyses showed some unexpected results. Only a small fraction of the yeast genes require the SWIISNF complex for their activation, and the SWIISNF complex also seems to be involved in repression of almost the same number of genes (Holstege et aI., 1998; Sudarsanam et aI., 2000). Another chromatin remodeling cOll1plex called RSC (Remodels Structure of Chromatin) has been studied in S. cerevisiae. The RSC complex subunits have strong homology with the Swi/Snf complex subunits (Mohrmann and Verrijzer, 2005). Two proteins, Arp7 and Arp9, are common to Swi/Snf and RSC. In contrast to all currently known genes that encode the protein subunits of the SWIISNF cOll1plex, most of the genes coding for subunits of the RSC complex are essential in nature. RSC is much more abundant than SWI/SNF. So far, evidence suggests that RSC is involved in cell cycle progression, repair of double strand breaks, association of cohesin with centromeres and chromosome arms, and regulation of expression of genes encoding ribosomal proteins, cell wall proteins, and sporulation specific genes. The IS\VI chromatin remodeling 24 complexes are characterized by presence of two SANT -like domains in the C-terminal regions of the enzymes. The in vivo functions of the ISWI complexes include transcriptional activation and repression, chromatin assembly, nucleosome spacing or sliding and maintenance of higher order chromatin structure (Mellor and Morillon, 2004). The compositions of the ISWI complexes in yeast are described in Table 1.4. In yeast, the Isw2 complex is recruited by the general transcription repressor Ume6. This recruitment leads to repression of a variety of genes (Goldmark et al., 2000). Whole genome expression analysis suggests that the Iswl complex primarily plays a role in transcriptional repression in association with the Sin3/Rpd3 HDAC (Fazzio et al., 2001). Some studies suggest a role for the Isw 1 complex in both the transcription elongation and termination processes. The Isw 1 complex has been proposed to sequentially regulate each stage of transcription by coordinating the events occurring at the 5' and 3' end during a transcription cycle, and by controlling the amount of RNA polymerase II entering into a productive elongation step (Morillon et al., 2003). The functions of the two different forms of ISW1 complexes, Iswla and Iswlb, in regulating transcription have been examined in this study. The Isw la complex acts as a repressor and prevents transcriptional initiation whereas the Iswlb complex controls the transcriptional elongation by coordinating CTD phosphorylation, RNA 3' end formation, and release of the RNA polymerase II during termination. The ability of the ISWI complexes to regulate transcription has been shown to be dependent on histone methylation at H3-K4 and the Iswl protein has been shown to recognize histone methylation at H3-K4 in vitro (Santos­Rosa et al., 2003). In vivo, Isw1 displaces TBP in a promoter specific manner in association with Cbfl (Moreau et al., 2003). 25 Table 1.4. ISWI protein complexes in yeast (S. cerevisiae) Complex Subunits In vivo functions Isw1a Isw 1 and Ioc3 Transcription repression Isw1b Isw1, Ioc2 and Ioc4 Transcription elongation and termination Isw2 Isw2 and Itc1 Transcription repression and nucleosome sliding Isw2/yCHRAC Isw2, !tc1, Dpb4 and Telomere position effect and D1s1 heterochromatin structure Chron1atin remodeling by ATPases of the CHD type are characterized by the presence of a pair of chromodomains (Woodage et aI., 1997). Several members of the CHD family of proteins have been described and these are listed in Table 1.5. The most studied CHD family protein in S. cerevisiae is Chd1. Initial observations implicated Chd1 as a negative regulator of transcription (Woodage et aI., 1997). The uracil analog, 6- azauracil (6-AU) causes an imbalance in the pools of ribonucleotide tri-phosphate (Exinger and Lacroute, 1992). Strains defective in transcriptional elongation are sensitive to grow on 6-AU containing media. Deletion of CHDl results in increased resistance to growth on media containing 6-AU than wild type. This observation suggests that Chd1 may have a negative role in transcriptional elongation in vivo. The synthetic lethal interaction between chdlA. and iswlA. isw2A. indicates a role of Chd1 in chromatin remodeling in vivo (Tsukiyama et al., 1999). An in vitro biochemical study showed that Chd1 has an ATP-dependent chromatin remodeling activity which is different from that of Swi/Snf (Tran et al., 2000). Several genetic interactions have been docun1ented Table 1.5. The merrlbers of CHD family proteins Complex Catalytic ATPase subunit (organism) Biochemical function 26 In vivo function Chdl Chdl (S. cerevisiae) Disruption of nucleosome, Transcription recognition of methylated elongation, formation H3-K4 tail peptide of repressive chromatin structure HRPI HRPI (S. pombe) DNA-stimulated ATPase Chromosome activity separation Mi2 Chd4 (Drosophila) ATPase activity stimulated Methylation induced by nucleosome gene silencing Mi2 Chd4 but also Chd3 ATPase activity stimulated Involved in T-cell (Mouse) by nucleosome development NuRD!NURD Chd3 and! or Chd4 ATPase activity stimulated Methylation induced (human) by mononucleosome gene silencing, heterochromatin, DNA repair CHDI Chdl A TP-dependent chromatin Associated with (Drosophila/Mouse) assembly active transcription 27 between chdl and other transcriptional elongation factors (Simic et aI., 2003 ~ Zhang et aI., 2005b). Physical interactions between Chdl and transcription elongation factors (e.g., components of the yFACT complex, the Spt4-Spt5 complex, and the Rtfl component of the Pafl complex) indicates a role for Chd 1 in regulating transcriptional elongation (Krogan et aI., 2002; Lindstrom et aI., 2003; Simic et aI., 2003). Chromatin isolated from a chdlil strain of S. cerevisiae is hypersensitive to digestion by micrococcal nuclease. This signifies that Chdl has a role in producing a repressive chromatin structure in vivo (Robinson and Schultz, 2003). Recently, a physical association between Chd1 and the SAGA/SLIK co-activator complex has been reported (Pray-Grant et aI., 2005). Association of Chd1 with the SAGA/SLIK complex has been proposed to be important for histone acetylation that is dependent on histone H3-K4 methylation. However, another study failed to detect binding of Chd1 to methylated K4 (Sims et aI., 2005). Transcriptional regulation by architectural transcription factors The architectural transcription factors are group of proteins that bend linear DNA or bind preferentially to bent or distorted DNA in vitro, and have a role in vivo in the assembly of the multi protein complexes. These factors are relatively abundant in nature (about 1 molecule per 10-15 nucleosomes on average). Like histones, they bind to DNA without sequence specificity and were initially regarded as probable chromatin structural components. High nlobility group (HMG) proteins are the best studied architectural transcription factors in vertebrates. There are two groups of HMG proteins in vertebrates, HMGA and HMGB. HMGAs are directly involved in the transcriptional control of specific genes. They are key regulators of enhanceosome formation with the help of several other transcription factors (Bianchi and Agresti, 2005). 28 There are several mechanisms by which the HMGBs promote transcription of several genes. The HMGBs interact directly with nucleosomes and thereby may loosen the wrapped DNA in the nucleosome structure enhancing the accessibility of DNA sequences to the chromatin-remodeling complexes as well as to the other transcription factors. The interactions between HMGBs with TBP and other general transcription factors may also regulate expression of several genes in vivo (Bianchi and Agresti, 2005). In S. cerevisiae, Nhp6a and Nhp6b are two architectural transcription factors of the HMGB family. Nhp6a and Nhp6b have 87% sequence identity (Kolodrubetz and Burgum, 1990), and are redundant in nature. Deletion of one of the copies of NHP6 genes does not cause any phenotype, However, deletion of both copies of NHP6 results in temperature sensitivity, and sensitivity to grow on media containing 6-AU (Formosa et aI., 2001b; Kruppa et aI., 2001; Yu et aI., 2000). The temperature sensitive phenotype of the nhp6a nhp6b (nhp6ab) double mutants arises from a defect in transcription of the SNR6 gene (coding for U6 small nuclear RNA) by RNA polymerase III (Kruppa et aI., 2001), Nhp6 proteins directly facilitate the binding of TFIIIC and TBP to the SNR6 promoter. Overexpression of Brf1, a subunit of the RNA polymerase III-specific general transcription factor TFIIIB, and an activating mutation in TFIIIC, were each found to restore SNR6 transcription and to suppress the nhp6ab growth defect (Kruppa et aI., 2001). Nhp6 also interacts with the RSC chromatin remodeling complex (Szerlong et aI., 2003), and with the Ssn6/Tup 1 complex (Fragiadakis et aI., 2004). Nhp6 also acts as a fidelity factor for transcriptional initiation by RNA polymerase III (Kassavetis and Steiner,2006b). 29 Nhp6 proteins also facilitate or repress the transcription of many RNA polymerase II­dependent genes by various mechanisms. Studies from our laboratory have shown that Nhp6 stin1ulates preinitiation complex formation both in vitro and in vivo. Nhp6 also combines with Spt16-Pob3 heterodimers in yeast to form the yFACT complex that binds to nucleosome in vitro (Formosa et aI., 2001b). The nucleosomes with bound Nhp6 or the Spt16-Pob3-Nhp6 complex have an altered electrophoretic mobility and a distinct pattern of enhanced sensitivity to digestion by DNase 1. The yF ACT complex and its role in transcription in vivo The mammalian FACT complex was first identified as a factor that assisted RNA polymerase II transcription through a chromatin template in an in vitro transcription assay (Orphanides et aI., 1998). The mammalian FACT complex is a heterodimer comprising the HMG-box containing protein SSRP1 and p140/hSpt16, a human homologue of the yeast Spt16 protein. The genetic and biochen1ical evidence suggest that the FACT complex is not just an elongation specific transcription factor, rather it is a general chromatin specific factor. For example, the Xenopus laevis homologue of the mammalian FACT complex termed DUF (DNA unwinding factor) was purified as an activity fron1 oocyte extracts that is required for DNA replication (Okuhara et aI., 1999). Also Pob3, the small subunit of the yeast FACT (yFACT) complex, was originally identified through its ability to bind to DNA polymerase u, which is involved in the initiation of DNA replication. Genetic studies demonstrated that mutations in SPT16 and POB3 genes show phenotypes that are relevant to both replication and transcription. The 30 yeast homologue of SSRPI, Pob3, lacks an HMG domain. Nhp6 protein serves the DNA binding function of the yeast Spt16-Pob3 complex. It is interesting to note that multiple Nhp6 molecules are required for yFACT recruitment to chromatin in vitro. Thus it is possible that Nhp6 acts as a loading factor for the Sptl6-Pob3 complex onto nucleosomes, and that Nhp6 is not a stable subunit of yFACT. Nucleosome reorganization by yFACT is proposed to occur in two steps: first, by binding the Nhp6 proteins to nucleosomes and second, by targeting the Spt16-Pob3 complex to the nucleosome. Several observations suggest a role for the yFACT complex in regUlating the elongation step of transcription. Chromatin immunoprecipitation (ChIP) studies performed in yeast and Drosophila and immunostaining of Drosophila polytene chromosomes demonstrate that FACT subunits are present at actively transcribed genes, along with other transcription elongation factors such as SptS and Spt6. High-resolution ChIP analyses show that the Spt6 and FACT complex are recruited to the Drosophila HSP genes upon transcriptional induction and travel across the genes with elongating RNA polymerase II. ChIP experiments in yeast show that yF ACT also travels with elongating RNA polymerase II upon transcriptional induction. In addition to genetics, ChIP, and immunolocalization analyses, proteomic studies suggest a connection between FACT and transcription elongation. Subunits of the yFACT complex interact physically with transcription elongation factors, such as the Spt4-SptS complex, Spt6, Chdl and the Pafl complex. However several lines of evidence suggest that the FACT complex may also have a role in transcriptional initiation. The SPT16 gene was initially identified as a factor which shows the Spf phenotype upon over-expression or mutation. The Spf 31 phenotype results from aberrant TAT A site utilization at the promoter region. The Drosophila FACT complex helps in GAGA factor recruitment at the promoter region of HOX genes (Shimojima et aI., 2003). So, it is possible that the yFACT complex have a role in both transcriptional initiation and elongation steps. Rationale for thesis research This thesis research has been focused on studying the roles played by the yFACT complex in regulating transcriptional initiation. One of the critical steps of eukaryotic transcriptional initiation is formation of the TBP-TFIIA-TFIIB complex with DNA. Initially we began studying the role of the Nhp6 protein in regulating the TBP-TFIIA­TFIIB complex formation. Our initial observations suggested that several transcription factors that change the structure of chromatin also have a role in regulating HO transcription (McBride et aI., 1997). These factors are encoded by the genes SWI2, and NHP6A and NHP6B. SWI2 encodes the catalytic subunit of the Swi/Snf chromatin remodeling factor. We have shown that Nhp6 and GcnS activate transcription in parallel pathways (Yu et aI., 2000). The yeast strains with deletion of either NHP6 genes or GeN5 are defective in HO expression. This defect in HO expression can be partially suppressed by overexpression of TBP (Yu et aI., 2003), suggesting that Nhp6 and histone acetylation by GcnS promote TBP binding at the HO promoter. There were a number of unanswered questions regarding the roles played by Nhp6. These questions were 1. What are the mechanisms of action of Nhp6, GcnS and the Swi/Snf chromatin remodeling complex, all of which have been shown to positively regulate HO expression in vivo? 32 2. How does Nhp6 regulate TBP binding in the context of chromatin? Earlier it was shown that a TAT A site that is embedded into a nucleosonle is refractory to TBP binding. Nhp6 may have a role in TBP binding as a part of the yFACT complex that reorganizes the nucleosome structure after binding. 3. What is the correlation between histone methylation and yFACT activity in regulating transcription? Our earlier genetic evidence suggested a positive correlation between the histone acetylation and the yFACT activity. We were therefore interested in examining the functional correlation between the histone methylation and the yFACT activity. Chapter 2 in this thesis describes a genetic screen for TBP mutants that are synthetically lethal with the absence of Nhp6 proteins. This chapter also shows that SNR6 is the limiting component in an nhp6ab strain. Over-expression of SNR6 from a multicopy plasmid suppresses several synthetic lethalities between TBP mutations and nhp6ab. Chapter 3 demonstrates that Nhp6 and two other transcriptional co-activators, Gcn5 in the SAGA complex and the Swi/Snf chromatin remodeling complex, work in the same pathway to promote formation of the TBP-TFIIA-DNA complex in vivo. In Chapter 4, we have explored the genetic relationship between Nhp6 and Gcn5 with MotI and the Ccr4/Not complex that were earlier shown to have negative roles in TBP binding. Our study suggested that in addition to having negative roles with TBP, MotI and the Ccr4/Not complex also have a positive role in regulating TBP binding at some promoters in vivo. In Chapter 5, using biochemical and genetic analysis, we show that yFACT has a role in formation of the TBP-TFIIA complex both in vivo and in vitro. In Chapter 6, the functional relationship between the histone methylation and the yFACT complex has 33 been described. We focused mainly on the functional relationship between the yFACT complex and the histone methylation at H3-K36 by Set2. Although regulation of transcription by histone methylation at H3-K4 has been studied for a long time, the role played by histone methylation at H3-K36 is poorly known. In Chapter 7, I have explored the functional relationship between yFACT and another ATP-dependent chromatin remodeler Chdl, in regulating transcriptional initiation. Chapter 8 summarizes all of these results on how the yFACT complex regulates transcriptional initiation in S. cerevisiae. References Alexander, D.E., Kaczorowski, D.J., Jackson-Fisher, A.J., Lowery, D.M., Zanton, S.J. and Pugh, B.P. (2004) Inhibition of TAT A binding protein dimerization by RNA polymerase III transcription initiation factor Brfl. J BioI Chem, 279,32401-32406. 34 Allard, S., Utley, R.T., Savard, l, Clarke, A., Grant, P., Brandl, C.l, Pillus, L., Workman, lL. and Cote, J. (1999) NuA4, an essential transcription adaptor/histone H4 acetyltransferase complex containing Esa1 p and the ATM-related cofactor Tra1 p. Embo Journal, 18,5108-5119. Auble, D.T., Hansen, K.E., Mueller, C.G., Lane, W.S., Thorner, J. and Hahn, S. (1994) MotI, a global repressor of RNA polymerase II transcription, inhibits TBP binding to DNA by an ATP-dependent mechanism. Genes Dev, 8,1920-1934. Auble, D.T., Wang, D., Post, K.W. and Hahn, S. (1997) Molecular analysis of the SNF2/SWI2 protein family member MOT1, an ATP-driven enzyme that dissociates TATA-binding protein from DNA. Mol Cell BioI, 17,4842-4851. Badarinarayana, V., Chiang, Y.C. and Denis, C.L. (2000) Functional interaction of CCR4-NOT proteins with T ATAA-binding protein (TBP) and its associated factors in yeast. Genetics, 155, 1045-1054. Bannister, A.J. and Kouzarides, T. (2005) Reversing histone methylation. Nature, 436, 1103-1106. Bannister, A.l, Schneider, R., Myers, F.A., Thorne, A.W., Crane-Robinson, C. and Kouzarides, T. (2005) Spatial distribution of di- and tri-methyllysine 36 of histone H3 at active genes. J BioI Chem, 280, 17732-17736. Basehoar, A.D., Zanton, S.l and Pugh, B.P. (2004) Identification and distinct regulation of yeast TAT A box-containing genes. Cell, 116, 699-709. Becker, P.B. and Horz, W. (2002) ATP-dependent nuc1eosome remodeling. Annu Rev Biochem, 71, 247-273. Bernstein, B.E., Humphrey, E.L., Erlich, R.L., Schneider, R., Bouman, P., Liu, J.S., Kouzarides, T. and Schreiber, S.L. (2002) Methylation of histone H3 Lys 4 in coding regions of active genes. Proc Natl Acad Sci USA, 99, 8695-8700. Bianchi, M.E. and Agresti, A. (2005) HMG proteins: dynamic players in gene regulation and differentiation. Curr Opin Genet Dev, 15,496-506. Boa, S., Coert, C. and Patterton, H.G. (2003) Saccharomyces cerevisiae SetI p is a methyltransferase specific for lysine 4 of histone H3 and is required for efficient gene expression. Yeast, 20, 827-835. Bottomley, M.J. (2004) Structures of protein domains that create or recognize histone modifications. EMBO Rep,S, 464-469. 35 Brewster, N.K., Johnston, G.C. and Singer, R.A. (2001) A bipartite yeast SSRP1 analog comprised of Pob3 and Nhp6 proteins modulates transcription. Mol Cell Bioi, 21, 3491- 3502. Briggs, S.D., Bryk, M., Strahl, B.D., Cheung, W.L., Davie, lK., Dent, S.Y., Winston, and Allis, C.D. (2001) Histone H3 lysine 4 methylation is mediated by Setl and required for cell growth and rDNA silencing in Saccharomyces cerevisiae. Genes Dev, 15, 3286- 3295. Brownell, lE. and Allis, C.D. (1995) An activity gel assay detects a single, catalytically active histone acetyltransferase subunit in Tetrahymena macronuclei. Proc Natl Acad Sci USA, 92,6364-6368. Brownell, J.E., Zhou, l, Ranalli, T., Kobayashi, R., Edmondson, D.G., Roth, S.Y. and Allis, C.D. (1996) Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p linking histone acetylation to gene activation. Cell, 84, 843-851. Bryk, M., Briggs, S.D., Strahl, B.D., Curcio, M.l, Allis, C.D. and Winston, F. (2002) Evidence that Set1, a factor required for methylation of histone H3, regulates rDNA silencing in S. cerevisiae by a Sir2-independent mechanism. Curr Biol, 12, 165-170. Buratowski, S. (2005) Connections between mRNA 3' end processing and transcription termination. Curr Opin Cell BioI, 17,257-261. Cairns, B.R. (2005) Chromatin remodeling complexes: strength in diversity, precision through specialization. Curr Opin Genet Dev, 15,185-190. Cang, Y., Auble, D.T. and Prelich, G. (1999) A new regulatory domain on the TATA­binding protein. Embo Journal, 18,6662-6671. Carrozza, MJ., Florens, L., Swanson, S.K., Shia, WJ., Anderson, S., Yates, l, Washburn, M.P. and Workman, J.L. (2005a) Stable incorporation of sequence specific repressors Ash1 and Ume6 into the Rpd3L complex. Biochim Biophys Acta, 1731,77-87; discussion 75-76. Carrozza, M.J., Li, B., Plorens, L., Suganuma, T., Swanson, S.K., Lee, K.K., Shia, WJ., Anderson, S., Yates, J., Washburn, M.P. and Workman, J.L. (2005b) Histone H3 methylation by Set2 directs deacetylation of coding regions by Rpd3S to suppress spurious intragenic transcription. Cell, 123,581-592. Cheng, X., Collins, R.E. and Zhang, X. (2005) Structural and sequence motifs of protein (histone) methylation enzymes. Annu Rev Biophys Biomol Strucf, 34, 267-294. 36 Coleman, R.A., Taggart, A.K., Benjamin, L.R. and Pugh, B.P. (1995) Dimerization of the TATA binding protein. J Bioi Chern, 270,13842-13849. Comai, L., Tanese, N. and Tjian, R. (1992) The TATA-binding protein and associated factors are integral components of the ~"IA polymerase I transcription factor, SL1. Cell, 68,965-976. Costa, P.l and Arndt, K.M. (2000) Synthetic lethal interactions suggest a role for the Saccharomyces cerevisiae Rtf1 protein in transcription elongation. Genetics, 156, 535- 547. Cuthbert, G.L., Daujat, S., Snowden, A.W., Erdjument-Bromage, H., Hagiwara, T., Yamada, M., Schneider, R., Gregory, P.D., Tempst, P., Bannister, A.J. and Kouzarides, T. (2004) Histone deinlination antagonizes arginine methylation. Cell, 118,545-553. Darst, R.P., Dasgupta, A., Zhu, C., Hsu, J.Y., Vroom, A., Muldrow, T. and Auble, D.T. (2003) MotI regulates the DNA binding activity of free TATA-binding protein in an ATP-dependent manner. J Bioi Chern, 278, 13216-13226. Dasgupta, A., Darst, R.P., Martin, K.l, Afshari, C.A. and Auble, D.T. (2002) MotI activates and represses transcription by direct, ATPase-dependent mechanisms. Proc Natl Acad Sci USA, 99, 2666-2671. de la Cruz, X., Lois, S., Sanchez-Molina, S. and Martinez-Balbas, M.A. (2005) Do protein motifs read the histone code? Bioessays, 27, 164-175. Dehe, P.M., Pamblanco, M., Luciano, P., Lebrun, R., Moinier, D., Sendra, R., Verreault, A., Tordera, V. and Geli, V. (2005) Histone H3 lysine 4 mono-methylation does not require ubiquitination of histone H2B. J Mol Bioi, 353, 477-484. Deluen, C., James, N., Maillet, L., Molinete, M., Theiler, G., Lemaire, M., Paquet, N. and CoIl art, M.A. (2002) The Ccr4-not complex and yTAFl (yTaf(II)130p/yTaf(II)145p) show physical and functional interactions. Mol Cell Bioi, 22, 6735-6749. Denis, C.L. and Chen, l (2003) The CCR4-NOT complex plays diverse roles in mRNA metabolism. Prog Nucleic Acid Res Mol Bioi, 73,221-250. Doyon, Y. and Cote, J. (2004) The highly conserved and multifunctional NuA4 HAT complex. Curr Opin Genet Dev, 14, 147-154. Exinger, and Lacroute, F. (1992). 6-Azauracil inhibition of GTP biosynthesis in Saccharomyces cerevisiae. Curr Genet 22, 9-11. Fazzio, T.G., Kooperberg, C., Goldmark, 1.P., Neal, C., Basom, R., Delrow, 1. and Tsukiyama, T. (2001) Widespread collaboration of Isw2 and Sin3-Rpd3 chromatin remodeling complexes in transcriptional repression. Mol Cell Bioi, 21, 6450-6460. 37 Feng, Q., Wang, H., Ng, H.H., Erdjument-Bromage, H., Tempst, P., Struhl, K. and Zhang, Y. (2002) Methylation of H3-lysine 79 is mediated by a new family of HMTases without a SET domain. Curr Bioi, 12, 1052-1058. Formosa, T., Eriksson, P., Wittmeyer, l., Ginn, 1., Yu, Y. and Stillnlan, D.l. (2001) Sptl6-Pob3 and the HMG protein Nhp6 combine to form the nucleosome-binding factor SPN. Embo Journal, 20, 3506-3517. Formosa, T., Ruone, S., Adams, M.D., Olsen, A.E., Eriksson, P., Yu, Y., Rhoades, A.R., Kaufman, P.D. and Stillman, D.1. (2002) Defects in SPT16 or POB3 (yFACT) in Saccharomyces cerevisiae cause dependence on the Hir/Hpc pathway: polymerase passage may degrade chromatin structure. Genetics, 162, 1557-1571. Fragiadakis, G.S., Tzamarias, D. and Alexandraki, D. (2004) Nhp6 facilitates Aftl binding and Ssn6 recruitment, both essential for FRE2 transcriptional activation. Embo Journal, 23, 333-342. Geisberg, 1.V., Moqtaderi, Z., Kuras, L. and Struhl, K. (2002) Motl associates with transcriptionally active promoters and inhibits association of NC2 in Saccharomyces cerevisiae. !vIol Cell Bioi, 22, 8122-8134. Goldmark, J.P., Fazzio, T.G., Estep, P. W., Church, G.M. and Tsukiyama, T. (2000) The Isw2 chromatin remodeling complex represses early meiotic genes upon recruitment by Ume6p. Cell, 103, 423-433. Goppelt, A. and Meisterernst, M. (1996) Characterization of the basal inhibitor of class II transcription NC2 from Saccharomyces cerevisiae. Nucleic Acids Res, 24, 4450-4455. Grewal, S.l. and Moazed, D. (2003) Heterochromatin and epigenetic control of gene expression. Science, 301,798-802. Hassan, A.H., Prochasson, P., Neely, K.E., Galasinski, S.C., Chandy, M., Carrozza, M.1. and Workman, l.L. (2002) Function and selectivity of bromodomains in anchoring chromatin-modifying complexes to promoter nucleosomes. Cell, 111, 369-379. Havas, K., Whitehouse, 1. and Owen-Hughes, T. (2001) ATP-dependent chromatin renlodeling activities. Cell Mol Life Sci, 58, 673-682. Hebbes, T.R., Thorne, A.W. and Crane-Robinson, C. (1988) A direct link between core histone acetylation and transcriptionally active chromatin. Embo Journal, 7, 1395-1402. Hiragami, K. and Festenstein, R. (2005) Heterochromatin protein 1: a pervasive controlling influence. Cell Mol Life Sci, 62, 2711-2726. 38 Holstege, F.C., Jennings, E.G., Wyrick, J.J., Lee, T.L, Hengartner, C.J., Green, M.R., Golub, T.R., Lander, E.S. and Young, R.A. (1998) Dissecting the regulatory circuitry of a eukaryotic genome. Cell, 95,717-728. Huisinga, K.L. and Pugh, B.F. (2004) A genome-wide housekeeping role for TFIID and a highly regulated stress-related role for SAGA in Saccharomyces cerevisiae. Mol Cell, 13, 573-585. Joshi, A.A. and Struhl, K. (2005) Eaf3 Chromodomain Interaction with Methylated H3- K36 Links Histone Deacetylation to Pol II Elongation. Mol Cell, 20, 971-978. Kadosh, D. and Struhl, K. (1997) Repression by Ume6 involves recruitment of a complex containing Sin3 corepressor and Rpd3 histone deacetylase to target promoters. Cell, 89, 365-371. Kadosh, D. and Struhl, K. (1998) Targeted recruitment of the Sin3-Rpd3 histone deacetylase complex generates a highly localized domain of repressed chromatin in vivo. Mol Cell Biol, 18,5121-5127. Kamada, K., Shu, F., Chen, H., Malik, S., Stelzer, G., Roeder, R.G., Meisterernst, M. and Burley, S.K. (2001) Crystal structure of negative cofactor 2 recognizing the TBP-DNA transcription complex. Cell, 106,71-81. Kao, C.F., Hillyer, C., Tsukuda, T., Henry, K., Berger, S. and Osley, M.A. (2004) Rad6 plays a role in transcriptional activation through ubiquitylation of histone H2B. Genes Dev, 18, 184-195. Kassavetis, G.A. and Steiner, D.F. (2006) Nhp6 Is a Transcriptional Initiation Fidelity Factor for RNA Polymerase III Transcription in Vitro and in Vivo. J Biol Chern, 281, 7445-7451. Kasten, M.M., Dorland, S. and Stillman, D.J. (1997) A large protein complex containing the yeast Sin3p and Rpd3p transcriptional regulators. Mol Cell Biol, 17,4852-4858. Keogh, M.C., Kurdistani, S.K., Morris, S.A., Ahn, S.H., Podolny, V., Collins, S.R., Schuldiner, M., Chin, K., Punna, T., Thompson, N.J., Boone, C., Emili, A., Weissman, 1.S., Hughes, T.R., Strahl, B.D., Grunstein, M., Greenblatt, J.F., Buratowski, S. and Krogan, N.J. (2005) Cotranscriptional set2 methylation of histone H3 lysine 36 recruits a repressive Rpd3 complex. Cell, 123, 593-605. Kim, M., Ahn, S.H., Krogan, N.J., Greenblatt, J.F. and Buratowski, S. (2004) Transitions in RNA polymerase II elongation complexes at the 3' ends of genes. Ernbo Journal, 23, 354-364. Kim, T.K., Zhao, Y., Ge, H., Bernstein, R. and Roeder, R.G. (1995) TATA-binding protein residues implicated in a functional interplay between negative cofactor NC2 (Drl) and general factors TFIIA and TFIIB. J Biol Chem, 270, 10976-10981. Kimura, A. and Horikoshi, M. (2004) Partition of distinct chromosomal regions: negotiable border and fixed border. Genes Cells, 9, 499-508. 39 Kimura, A., Matsubara, K. and Horikoshi, M. (2005) A decade of histone acetylation: marking eukaryotic chromoson1es with specific codes. J Biochem (Tokyo), 138,647-662. Kobor, M.S. and Greenblatt, l (2002) Regulation of transcription elongation by phosphorylation. Biochim Biophys Acta, 1577,261-275. Kolodrubetz, D. and Burgum, A. (1990) Duplicated NHP6 genes of Saccharomyces cerevisiae encode proteins homologous to bovine high mobility group protein 1. J Biol Chem, 265, 3234-3239. Krogan, N.l, Dover, l, Wood, A., Schneider, I, Heidt, I, Boateng, M.A., Dean, K., Ryan, O.W., Golshani, A., Johnston, M., Greenblatt, IF. and Shilatifard, A. (2003a) The Pafl complex is required for histone H3 methylation by COMPASS and Dotlp: linking transcriptional elongation to histone methylation. Mol Cell, 11, 721-729. Krogan, N.l, Keogh, M.C., Datta, N., Sawa, C., Ryan, O.W., Ding, H., Haw, R.A., Pootoolal, 1, Tong, A., Canadien, V., Richards, D.P., Wu, X., Emili, A., Hughes, T.R., Buratowski, S. and Greenblatt, IF. (2003b) A Snf2 family ATPase complex required for recruitment of the histone H2A variant Htz1. Mol Cell, 12, 1565-1576. Krogan, N.l, Kim, M., Ahn, S.H., Zhong, G., Kobor, M.S., Cagney, G., Emili, A., Shilatifard, A., Buratowski, S. and Greenblatt, J.F. (2002) RNA polymerase II elongation factors of Saccharomyces cerevisiae: a targeted proteomics approach. Mol Cell Biol, 22, 6979-6992. Krogan, N.l, Kim, M., Tong, A., Golshani, A., Cagney, G., Canadien, V., Richards, D.P., Beattie, B.K., Emili, A., Boone, C., Shilatifard, A., Buratowski, S. and Greenblatt, J. (2003c) Methylation of histone H3 by Set2 in Saccharomyces cerevisiae is linked to transcriptional elongation by RNA polymerase II. Mol Cell Biol, 23, 4207-4218. Kruppa, M., Moir, R.D., Kolodrubetz, D. and Willis, I.M. (2001) Nhp6, an HMG 1 protein, functions in SNR6 transcription by RNA polymerase III in S. cerevisiae. Mol Cell, 7, 309-318. Kuo, M.H., vom Baur, Struhl, K. and Allis, C.D. (2000) Gcn4 activator targets Gcn5 histone acetyltransferase to specific promoters independently of transcription. Mol Cell, 6, 1309-1320. 40 Kurdistani, S.K. and Grunstein, M. (2003) Histone acetylation and deacetylation in yeast. Nat Rev Mol Cell Bioi, 4, 276-284. Kurdistani, S.K., Tavazoie, S. and Grunstein, M. (2004) Mapping global histone acetylation patterns to gene expression. Cell, 117,721-733. Landry, J., Sutton, A., Hesman, T., Min, J., Xu, R.M., Johnston, M. and Sternglanz, R. (2003) Set2-catalyzed methylation of histone H3 represses basal expression of GAL4 in Saccharomyces cerevisiae. Mol Cell Bioi, 23, 5972-5978. Laribee, R.N., Krogan, N.l, Xiao, T., Shibata, Y., Hughes, T.R., Greenblatt, 1.F. and Strahl, B.D. (2005) BUR kinase selectively regulates H3 K4 trimethylation and H2B ubiquitylation through recruitment of the PAF elongation complex. Curr Bioi, 15, 1487- 1493. Lee, D.Y., Teyssier, C., Strahl, B.D. and Stallcup, M.R. (2005) Role of protein methylation in regulation of transcription. Endocr Rev, 26,147-170. Li, B., Howe, L., Anderson, S., Yates, lR., 3rd and Workman, lL. (2003) The Set2 histone methyltransferase functions through the phosphorylated carboxyl-terminal domain of RNA polymerase II. J Bioi Chem, 278, 8897-8903. Lindstrom, D.L., Squazzo, S.L., Muster, N., Burckin, T.A., Wachter, K.C., Emigh, C.A., McCleery, lA., Yates, J.R., 3rd and Hartzog, G.A. (2003) Dual roles for Spt5 in pre­mRNA processing and transcription elongation revealed by identification of Spt5- associated proteins. Mol Cell Bioi, 23, 1368-1378. Liu, H.Y., Badarinarayana, V., Audino, D.C., Rappsilber, J., Mann, M. and Denis, C.L. (1998) The NOT proteins are part of the CCR4 transcriptional complex and affect gene expression both positively and negatively. Embo Journal, 17, 1096-1106. Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.P. and Richmond, T.J. (1997) Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature, 389,251- 260. Margueron, R., Trojer, P. and Reinberg, D. (2005) The key to development: interpreting the histone code? Curr Opin Genet Dev, 15, 163-176. Marmorstein, R. (2003) Structure of SET domain proteins: a new twist on histone methylation. Trends Biochem Sci, 28, 59-62. Martin, C. and Zhang, Y. (2005) The diverse functions of histone lysine methylation. Nat Rev Mol Cell Bioi, 6, 838-849. NIartinez-Campa, C., Politis, P., Moreau, lL., Kent, N., Goodall, 1., Mellor, 1. and Goding, C.R. (2004) Precise nucleosome positioning and the TAT A box dictate 41 requirements for the histone H4 tail and the bromodomain factor Bdf1. Mol Cell, 15, 69- 81. Mason, P.B. and Struhl, K. (2003) The FACT complex travels with elongating RNA polymerase II and is important for the fidelity of transcriptional initiation in vivo. Mol Cell Biol, 23, 8323-8333. Matangkasombut, 0., Buratowski, R.M., Swilling, N.W. and Buratowski, S. (2000) Bromodomain factor 1 corresponds to a missing piece of yeast TFIID. Genes Dev, 14, 951-962. McBride, H.J., Brazas, R.M., Yu, Y., Nasmyth, K. and Stillman, D.J. (1997) Long-range interactions at the HO promoter. Mol Cell Biol, 17, 2669-2678. Mellor, J. and Morillon, A. (2004) ISWI complexes in Saccharomyces cerevisiae. Biochim Biophys Acta, 1677, 100-112. Mermelstein, F., Yeung, K., Cao, J., Inostroza, J.A., Erdjument-Bromage, H., Eagelson, K., Landsman, D., Levitt, P., Tempst, P. and Reinberg, D. (1996) Requirement of a corepressor for Dr1-mediated repression of transcription. Genes Dev, 10, 1033-1048. Miller, T., Krogan, N.J., Dover, J., Erdjument-Bromage, H., Tempst, P., Johnston, M., Greenblatt, J.F. and Shilatifard, A. (2001) COMPASS: a complex of proteins associated with a trithorax-related SET domain protein. Proc Natl Acad Sci USA, 98, 12902-12907. Mohrmann, L. and Verrijzer, C.P. (2005) Composition and functional specificity of SWI2/SNF2 class chromatin remodeling complexes. Biochim Biophys Acta, 1681, 59-73. Moreau, J.L., Lee, M., Mahachi, N., Vary, J., Mellor, J., Tsukiyama, T. and Goding, C.R. (2003) Regulated displacement of TBP from the PH08 promoter in vivo requires Cbf1 and the Isw1 chromatin remodeling complex. Mol Cell, 11, 1609-1620. Morillon, A., Karabetsou, N., Nair, A. and Mellor, J. (2005) Dynamic lysine methylation on histone H3 defines the regulatory phase of gene transcription. Mol Cell, 18, 723-734. Morillon, A., Karabetsou, N., O'Sullivan, J., Kent, N., Proudfoot, N. and Mellor, J. (2003) Isw1 chromatin remodeling ATPase coordinates transcription elongation and termination by RNA polymerase II. Cell, 115,425-435. Naar, A.M., Lemon, B.D. and Tjian, R. (2001) Transcriptional coactivator complexes. Annu Rev Biochem, 70, 475-501. Ng, H.H., Dole, S. and Struhl, K. (2003a) The Rtf1 component of the Paf1 transcriptional elongation complex is required for ubiquitination of histone H2B. J Biol Chem, 278, 33625-33628. Ng, H.H., Feng, Q., Wang, H., Erdjument-Bromage, H., Tempst, P., Zhang, Y. and Struhl, K. (2002) Lysine methylation within the globular domain of histone H3 by Dotl is important for telomeric silencing and Sir protein association. Genes Dev, 16, 1518- 1527. Ng, H.H., Robert, F., Young, R.A. and Struhl, K. (2003b) Targeted recruitment of Setl histone methylase by elongating Pol II provides a localized mark and memory of recent transcriptional activity. Mol Cell, 11, 709-719. Nislow, C., Ray, E. and PilIus, L. (1997) SET1, a yeast member of the trithorax family, functions in transcriptional silencing and diverse cellular processes. Mol BioI Cell, 8, 2421-2436. 42 Noma, K. and Grewal, S.l. (2002) Histone H3 lysine 4 methylation is mediated by Set! and promotes maintenance of active chromatin states in fission yeast. Proc Natl Acad Sci USA, 99 Suppl4, 16438-16445. Nourani, A., Utley, R.T., Allard, S. and Cote, J. (2004) Recruitment of the NuA4 complex poises the PH05 promoter for chromatin remodeling and activation. Ernbo Journal, 23,2597-2607. Oberholzer, U. and Collart, M.A. (1999) In vitro transcription of a TATA-Iess promoter: negative regulation by the Notl protein. BioI Chern, 380, 1365-1370. Okuhara, K., Ohta, K., Seo, H., Shioda, M., Yamada, T., Tanaka, Y., Dohmae, N., Seyama, Y., Shibata, T. and Murofushi, H. (1999) A DNA unwinding factor involved in DNA replication in cell-free extracts of Xenopus eggs. Curr BioI, 9,341-350. Orphanides, G., LeRoy, G., Chang, C.H., Luse, D.S. and Reinberg, D. (1998) FACT, a factor that facilitates transcript elongation through nucleosomes. Cell, 92, 105-116. Orphanides, G. and Reinberg, D. (2000) RNA polymerase II elongation through chromatin. Nature, 407, 471-475. Orphanides, G., Wu, W.H., Lane, W.S., Hampsey, M. and Reinberg, D. (1999) The chromatin-specific transcription elongation factor FACT comprises human SPT16 and SSRP1 proteins. Nature, 400, 284-288. Palancade, B. and Bensaude, O. (2003) Investigating RNA polymerase II carboxyl­terminal domain (CTD) phosphorylation. Eur J Biochem, 270, 3859-3870. Pokholok, D.K., Hannett, N.M. and Young, R.A. (2002) Exchange of RNA polymerase II initiation and elongation factors during gene expression in vivo. Mol Cell, 9, 799-809. Pokholok, D.K., Harbison, C.T., Levine, S., Cole, M., Hannett, N.IvI., Lee, T.L, Bell, G.W., Walker, K., Rolfe, P.A., Herbolsheimer, E., Zeitlinger, J., Lewitter, F., Gifford, D.K. and Young, R.A. (2005) Genome-wide map of nuc1eosome acetylation and methylation in yeast. Cell, 122, 517-527. Pray-Grant, M.G., Daniel, J.A., Schieltz, D., Yates, lR., 3rd and Grant, P.A. (2005) Chd1 chromodomain links histone H3 methylation with SAGA- and SLIK-dependent acetylation. Nature, 433, 434-438. Pugh, B.F. (2000) Control of gene expression through regulation of the TATA-binding protein. Gene, 255, 1-14. 43 Raisner, R.M., Hartley, P.D., Meneghini, M.D., Bao, M.Z., Liu, C.L., Schreiber, S.L., Rando, O.l and Madhani, H.D. (2005) Histone variant H2A.Z marks the 5' ends of both active and inactive genes in euchromatin. Cell, 123, 233-248. Rao, B., Shibata, Y., Strahl, B.D. and Lieb, J.D. (2005) Dimethylation of histone H3 at lysine 36 demarcates regulatory and nonregulatory chromatin genome-wide. Mol Cell Biol, 25, 9447-9459. Reinberg, D., Orphanides, G., Ebright, R., Akoulitchev, S., Carcamo, J., Cho, H., Cortes, P., Drapkin, R., Flores, 0., Ha, 1., Inostroza, lA., Kim, S., Kim, T.K., Kumar, P., Lagrange, T., LeRoy, G., Lu, H., Ma, D.M., Maldonado, E., Merino, A., Mermelstein, F., Olave, 1., Sheldon, M., Shiekhattar, R., Zawel, L. and et al. (1998) The RNA polymerase II general transcription factors: past, present, and future. Cold Spring Harh Syrnp Quant Biol, 63, 83-103. Robinson, K.M. and Schultz, M.C. (2003) Replication-independent assembly of nucleosome arrays in a novel yeast chromatin reconstitution system involves anti silencing factor Asf1p and chromodomain protein Chd1p. Mol Cell Biot, 23, 7937- 7946. Roth, S.Y., Denu, lM. and Allis, C.D. (2001) Histone acetyltransferases. Annu Rev Biochern, 70, 81 120. Rundlett, S.E., Carmen, A.A., Suka, N., Turner, B.M. and Grunstein, M. (1998) Transcriptional repression by UME6 involves deacetylation of lysine 5 of histone H4 by RPD3. Nature, 392, 831-835. Ruone, S., Rhoades, A.R. and Formosa, T. (2003) Multiple Nhp6 molecules are required to recruit Spt16-Pob3 to form yFACT complexes and to reorganize nucleosomes. J Biol Chern, 278, 45288-45295. Santos-Rosa, H., Schneider, R., Bannister, A.J., Sherriff, J., Bernstein, B.E., Emre, N.C., Schreiber, S.L., Mellor, J. and Kouzarides, T. (2002) Active genes are tri-methylated at K4 of histone H3. Nature, 419, 407-41 L 44 Santos-Rosa, H., Schneider, R., Bernstein, B.E., Karabetsou, N., Morillon, A., Weise, C., Schreiber, S.L., Mellor, I and Kouzarides, T. (2003) Methylation of histone H3 K4 mediates association of the Isw1p ATPase with chron1atin. Mol Cell, 12,1325-1332. Saunders, A., Werner, I, Andrulis, E.D., Nakayama, T., Hirose, S., Reinberg, D. and Lis, IT. (2003) Tracking FACT and the RNA polymerase II elongation complex through chromatin in vivo. Science, 301, 1094-1096. Schlesinger, M.B. and Formosa, T. (2000) POB3 is required for both transcription and replication in the yeast Saccharomyces cerevisiae. Genetics, 155, 1593-1606. Schneider, I, Wood, A., Lee, l.S., Schuster, R., Dueker, l., Maguire, C., Swanson, S.K., Florens, L., Washburn, M.P. and Shilatifard, A. (2005) Molecular regulation of histone H3 trimethylation by COMPASS and the regulation of gene expression. Mol Cell, 19, 849-856. Shahbazian, M.D., Zhang, K. and Grunstein, M. (2005) Histone H2B ubiquitylation controls processive methylation but not monomethylation by Dot1 and Setl. Mol Cell, 19, 271-277. Shi, Y., Lan, F., Matson, C., Mulligan, P., Whetstine, l.R., Cole, P.A. and Casero, R.A. (2004) Histone demethylation mediated by the nuclear amine oxidase homolog LSDl. Cell, 119,941-953. Shi, Y.l., Matson, C., Lan, F., Iwase, S., Baba, T. and Shi, Y. (2005) Regulation of LSD1 histone demethylase activity by its associated factors. Mol Cell, 19, 857-864. Simic, R., Lindstrom, D.L., Tran, H.G., Roinick, K.L., Costa, P.J., lohnson, A.D., Hartzog, G.A. and Arndt, K.M. (2003) Chromatin remodeling protein Chd1 interacts with transcription elongation factors and localizes to transcribed genes. Embo Journal, 22, 1846-1856. Sims, R.J., 3rd, Belotserkovskaya, R. and Reinberg, D. (2004) Elongation by RNA polymerase II: the short and long of it. Genes Dev, 18,2437-2468. Sims, R.J., 3rd, Chen, C.F., Santos-Rosa, H., Kouzarides, T., Patel, S.S. and Reinberg, D. (2005) Human but not yeast CHD1 binds directly and selectively to histone H3 methylated at lysine 4 via its tandem chron10don1ains. J Biol Chern, 280, 41789-41792. Strahl, B.D. and Allis, C.D. (2000) The language of covalent histone modifications. Nature, 403, 41-45. Strahl, B.D., Grant, P.A., Briggs, S.D., Sun, Z.W., Bone, l.R., Caldwell, IA., Mollah, S., Cook, R.G., Shabanowitz, l., Hunt, D.F. and Allis, C.D. (2002) Set2 is a nucleosomal histone H3-selective methyltransferase that mediates transcriptional repression. Mol Cell Biol, 22, 1298-1306. 45 Sudarsanam, P., lyer, V.R., Brown, P.O. and Winston, F. (2000) Whole-genome expression analysis of snf/swi mutants of Saccharomyces cerevisiae. Proc Natl Acad Sci USA, 97, 3364-3369. Suka, N., Suka, Y., Carmen, A.A., Wu, 1. and Grunstein, M. (2001) Highly specific antibodies determine histone acetylation site usage in yeast heterochromatin and euchromatin. Mol Cell, 8, 473-479. Sun, Z.W. and Allis, C.D. (2002) Ubiquitination of histone H2B regulates H3 methylation and gene silencing in yeast. Nature, 418, 104-108. Syntichaki, P., Topalidou, 1. and Thireos, G. (2000) The Gcn5 bromodomain co-ordinates nucleosome remodelling. Nature, 404, 414-417. Szerlong, H., Saha, A. and Cairns,B.R. (2003) The nuclear actin-related proteins Arp7 and Arp9: a dimeric module that cooperates with architectural proteins for chromatin remodeling. Embo Journal, 22, 3175-3187. Tran, H.G., Steger, D.J., lyer, V.R. and Johnson, A.D. (2000) The chromo donlain protein chdlp from budding yeast is an ATP-dependent chromatin-modifying factor. Embo Journal, 19, 2323-2331. Tsukiyama, T., Palmer, J., Landel, C.C., Shiloach, J. and Wu, C. (1999) Characterization of the imitation switch subfamily of ATP-dependent chromatin-remodeling factors in Saccharomyces cerevisiae. Genes Dev, 13,686-697. Utley, R.T., Ikeda, K., Grant, P.A., Cote, J., Steger, DJ., Eberharter, A., John, S. and Workman, J.L. (1998) Transcriptional activators direct histone acetyltransferase complexes to nucleosomes. Nature, 394, 498-502. van Leeuwen, F., Gafken, P.R. and Gottschling, D.E. (2002) Dotlp modulates silencing in yeast by methylation of the nucleosome core. Cell, 109,745-756. Vignali, M., Hassan, A.H., Neely, K.E. and Workman, J.L. (2000) ATP-dependent chromatin-remodeling complexes. Mol Cell Biol, 20, 1899-1910. Wang, A., Kurdistani, S.K. and Grunstein, M. (2002) Requirement of Hos2 histone deacetylase for gene activity in yeast. Science, 298, 1412-1414. Wang, W. (2003) The SWI/SNF family of ATP-dependent chromatin remodelers: similar mechanisms for diverse functions. Curr Top Microbiol Imnzunol, 274, 143-169. Wang, Y., Wysocka, J., Sayegh, J., Lee, Y.H., Perlin, J.R., Leonelli, L., Sonbuchner, L.S., McDonald, C.H., Cook, R.G., Dou, Y., Roeder, R.G., Clarke, S., Stallcup, M.R., Allis, C.D. and Coonrod, S.A. (2004) Human PAD4 regulates histone arginine methylation levels via demethylimination. Science, 306, 279-283. Weideman, C.A., Netter, R.C., Benjamin, L.R., McAllister, J.l, Schmiedekamp, L.A., Coleman, R.A. and Pugh, B.F. (1997) Dynamic interplay ofTHIA, TBP and TAT A DNA. J Mol Biol, 271, 61-75. Winkler, G.S., Krist juhan, A., Erdjument-Bromage, H., Tempst, P. and Svejstrup, lQ. (2002) Elongator is a histone H3 and H4 acetyltransferase important for normal histone acetylation levels in vivo. Proc Natl Acad Sci USA, 99, 3517-3522. 46 Wittmeyer, l, Joss, L. and Formosa, T. (1999) Spt16 and Pob3 of Saccharomyces cerevisiae form an essential, abundant heterodimer that is nuclear, chromatin-associated, and copurifies with DNA polymerase alpha. Biochemistry, 38, 8961-8971. Wood, A., Krogan, N.J., Dover, l, Schneider, l, Heidt, J., Boateng, M.A., Dean, K., Golshani, A., Zhang, Y., Greenblatt, IF., Johnston, M. and Shilatifard, A. (2003a) BreI, an E3 ubiquitin ligase required for recruitment and substrate selection of Rad6 at a promoter. Mol Cell, 11, 267-274. Wood, A., Schneider, l, Dover, J., Johnston, M. and Shilatifard, A. (2003b) The Paf1 complex is essential for histone monoubiquitination by the Rad6-Bre 1 complex, which signals for histone methylation by COMPASS and Dot1p. J Biol Chern, 278,34739- 34742. Woodage, T., Basrai, M.A., Baxevanis, A.D., Hieter, P. and Collins, F.S. (1997) Characterization of the CHD family of proteins. Proc Natl Acad Sci USA, 94, 11472- 11477. Wu, l, Suka, N., Carlson, M. and Grunstein, M. (2001) TUP1 utilizes histone H3/H2B­specific HDA 1 deacetylase to repress gene activity in yeast. Mol Cell, 7, 117-126. Xiao, B., Wilson, lR. and Gamblin, S.J. (2003a) SET domains and histone methylation. Curr Opin Struct Biol, 13, 699-705. Xiao, T., Hall, H., Kizer, K.O., Shibata, Y., Hall, M.C., Borchers, C.H. and Strahl, B.D. (2003b) Phosphorylation of RNA polymerase II CTD regulates H3 methylation in yeast. Genes Dev, 17,654-663. Xiao, T., Kao, C.F., Krogan, N.J., Sun, Z.W., Greenblatt, J.F., Osley, M.A. and Strahl, B.D. (2005) Histone H2B ubiquitylation is associated with elongating RNA polymerase II. Mol Cell BioI, 25, 637-651. Xie, l, Collart, M., Lemaire, M., Stelzer, G. and Meisterernst, M. (2000) A single point mutation in TFIIA suppresses NC2 requirement in vivo. Embo Journal, 19, 672-682. Xu, F., Zhang, K. and Grunstein, M. (2005) Acetylation in histone H3 globular domain regulates gene expression in yeast. Cell, 121, 375-385. 47 Yu, Y., Eriksson, P., Bhoite, L.T. and Stillman, D.J. (2003) Regulation ofTATA-binding protein binding by the SAGA complex and the Nhp6 high-mobility group protein. Mol Cell Biol, 23,1910-1921. Yu, Y., Eriksson, P. and Stillman, D.l. (2000) Architectural transcription factors and the SAGA complex function in parallel pathways to activate transcription. Mol Cell Biol, 20, 2350-2357. Zhang, H., Roberts, D.N. and Cairns, B.R. (2005a) Genome-wide dynamics of Htz1, a histone H2A variant that poises repressed/basal promoters for activation through histone loss. Cell, 123, 219-231. Zhang, L., Schroeder, S., Fong, N. and Bentley, D.L. (2005b) Altered nucleosome occupancy and histone H3K4 methylation in response to 'transcriptional stress'. Embo Journal, 24, 2379-2390. Zhang, Y. and Reinberg, D. (2001) Transcription regulation by histone methylation: interplay between different covalent modifications of the core histone tails. Genes Dev, 15, 2343-2360. CHAPTER 2 TATA-BINDING PROTEIN MUTANTS THAT ARE LETHAL IN THE ABSENCE OF Nhp6 HIGH MOBILITY GROUP PROTEIN Reprinted with permission from Peter Eriksson, Debabrata Biswas, Yaxin Yu, James M. Stewart, David Stillman © 2004 American Society for Microbiology l\1olecular and Cellular Biology 2004 lul;24(14):6419-29. 49 MOLECUUR AND CELLULAR BIOLOGY, july 2(J04, p. 6419-6429 0270-7306f(J4/$08JIO+O DOl: 10.1128IMCB.24.14.6419-6429.2(J04 Copyright © 2004, A.merican Society for Microbiology. All Rights Reserved. Vol. 24, No. 14 TATA-Binding Protein Mutants That Are Lethal in the Absence of the Nhp6 High-Mobility-Group Protein Peter Eriksson,t Debabrata Biswas, Yaxin Yu, James M. Stewart, and David 1. Stillman* Department of Pathology, University of Utah Health Sciences CelUer, Salt Lake City, Utah 84132 Received 26 November 2003IReturned for modification 9 January 2004/Accepted 20 April 2004 The Saccharomyces cerevisiae Nhp6 protein is related to the high-mobility-group B family of architectural DNA-binding proteins that bind DNA nonspecifically but bend DNA sharply. Nhp6 is involved in transcrip­tional activation by both RNA polymerase II (Pol ll) and Pol lll. Our previous genetic studies have implicated Nhp6 in facilitating TATA-binding protein (TBP) binding to some Pol II promoters in vivo, and we have used a novel genetic screen to isolate 32 new mutations in TBP that are viable in wild-type cells but lethal in the absence of Nhp6. The TBP mutations that are lethal in the absence of Nhp6 cluster in three regions: on the upper surface ofTBP that may have a regulatory role, near residues that contact Spt3, or near residues known to contact either TFllA or Bm (in TFllIB). The latter set of mutations suggests that Nhp6 becomes essential when a TBP mutant compromises its ability to interact with either TRIA or 8m. Importantly, the synthetic lethality for some of the TBP mutations is suppressed by a multicopy plasmid with SNR6 or by an spt3 mutation. It has been previously shown that nhp6ab mutants are defective in expressing SNR6, a Pol Ill· transcribed gene encoding the U6 splicing RNA. Chromatin immunoprecipitation experiments show that TBP binding to SNR6 is reduced in an nhp6ab mutant. Nhp6 interacts with Spt16/Pob3, the yeast equivalent of the FACT elongation complex, consistent with nhp6ab cells being extremely sensitive to 6-azauracil (6-AU). However, this 6·AU sensitivity can be suppressed by multicopy SNR6 or BRFI. Additionally, strains with SNR6 promoter mutations are sensitive to 6-AU, suggesting that decreased SNR6 RNA levels contribute to 6-AU sensitivity. These results challenge the widely held belief that 6-AU sensitivity results from a defect in transcriptional elongation. The TAT A-binding protein (TBP) is required for all eukary· otic transcription, whether the genes are transcribed by RNA polymerase I (Pol I), Pol II, or Pol 1lI (28). TBP binding to promoters of genes transcribed by Pol II correlates with tran­scriptional activity; therefore, regulation of TBP binding may be the critical event in determining transcriptional activation (36, 40). Full-length TBP binds DNA slowly in a multistep process (29, 69), and crystallographic studies demonstrate that TBP bends DNA sharply upon binding (46, 47). Transcrip­tional activation by Pol II requires the assembly of a complex of general transcription factors at a promoter (18, 27). It is believed that transcriptional coactivators function by stimulat­ing DNA binding by TBP and facilitating formation of a com­plex between TBP and the general transcription factors TFIlA and TFIIB. The Spt3 factor can regulate TBP binding to promoters. Spt3, which is part of the SAGA histone acetyltransfera'le complex (63), physically interacts with TBP and plays an im­portant role in transcriptional start site selection for RNA Pol II (19). Spt3 can act as a positive or negative transcriptional regulator, depending on the promoter (5, 17, 67). Although Spt3 acts to promote TBP binding at the GALl promoter (17), we have shown that Spt3 inhibits TBP binding to HO (67). • Corresponding author. Mailing address: Department of Pathology. University of Utah. 30 North 19()O East, Salt Lake Cit}', UT 84132- 2501. Phone: [phone]. Fax: [phone]]7. E-mail: [e-mail]. t Present address: National Institutes of Health. Bethesda, MD 20892. 6419 Genetic interactions have been seen between SPT3 and other regulators of TBP binding (4, 13, 43). The Saccharomyces cerevisiae Nhp6 protein is similar to the high-mobility-group B class of architectural DNA-binding pro­teins (1). Nhp6 is an abundant protein (50), and it has multiple roles in transcription, including transcriptional initiation and elongation by Pol II and promoting transcription by Pol III. For its role in elongation, Nhp6 interacts genetically and bio­chemically with Spt16!Pob3 (10, 22), the yeast equivalent of FACT that promotes elongation through chromatin templates (49). Nhp6 is required for Spt16/Pob3 to bind to nucleosomes (22,54). Nhp6 is encoded by two genes, NHP6A and NHP6B, that are functionally redundant, as only the nhp6ab double mutants show any observable phenotype. nhp6ab mutants are unable to grow at 37°C, but this growth defect can be suppressed by a multicopy plasmid with either SNR6 or BRF} (35). SNR6 en­codes the U6 RNA required for mRNA splicing, and it is suggested that a deficiency in SNR6 RNA contributes to the temperature-sensitive groYlth defect seen in nhp6ab mutants. Brfl is the limiting component in TFIlIB, a factor required for Pol III transcription (56); therefore, BRF} overexpression could increase SNR6 expression and facilitate groYlth of the IIhp6ab mutant at 37°C. Overexpression of TBP also sup­presses the temperature-sensitive growth defect of an nhp6ab mutant (67). In addition to it<; well-documented role in Pol II transcription, TBP is also a component of the RNA Pol III factor TFIIIB and is re4uired for Pol 1Il transcription (33). Thus, TBP overexpression could suppress the nlzp6ab groYlth defect by affecting either Pol II or Pol III transcription. Data 6420 ERIKSSON ET AL. from Paull et al. (50) suggest that Nhp6 stimulates transcrip­tion by promoting formation of preinitiation complexes. Our genetic studies suggest that Nhp6 and the GcnS histone acetyl transferase function ir. parallel to activate expression of the yeast HO gene (67, 68). Agcn5 nhp6a nhp6b triple mutant is extremely sick, but this growth defect can be suppressed by mutations in SIN4, SPTJ, or SPT8. The data suggested that TBP was the critical target, a<; overexpression of TBP sup­presses the temperature-sensitive growth defect of nhp6ab mu­tants and partially restores HO expression in the absence of either Nhp6 or GenS. In this study, we continue the genetic analysis examining the relationship between Nhp6 and TBP. We performed a novel synthetic lethal screen to identify strains with TBP mutations that are unable to grow in the absence of Nhp6. We also find that a multicopy plasmid with SNR6 can suppress some of the TBP Ilhp6ab synthetic lethalities. Our results suggest that Nhp6 and TBP work together to facilitate transcriptional activation by both Pol II and Pol III. MATERIALS AND METHODS Strains and media. All S. cerevisioe strains used are listed in Table I and are isogenic in the W303 background (65). Standard genetic methods were used for strain construction (53,59). W303 strains with disruptions ingen5, nlrp6lJ, nhp6b, and swi2 have been described previously (67, 68). The TBP-Myc·tagged allele (51) was provided by Rick Young and crossed to generate the strains used here. Cells were grown in yeast eXlract-peptone-dextrose (YEPD) medium (59) at 30"C, except where the use of other temperatures is noted, or where synthetic complete medium with 2% glucose supplemented with adenine, uracil, and amino acids, as appropriate. but lacking essential components was used to select for plasmids. Medium containing 5-fluoroorotic acid (5·FOA) was prepared as described previously (8). Plasmids. All plasmids used arc listed in Table 2, except for thc TBP mutant plasmids, which were all YCp·TRPl pJasmids. A 1.2·kb XhoI-Pstl fragment with SNR6 from pRS314-SNR6. provided by Dave Brow, was cloned into pRS425 and pRS422, constructing M4479 and M4488, respectively. A 3.8-kb BamHI frag· ment with ADE3 from plasmid pTF96, provided by Tim Fomlosa, was cloned into BarnHI·cleaved plasmid pDE28-6 (19), generating M4373. Screen for TBP JDulants. Strain DY7244 was transformed with II library of mutagenizcd TBP genes on YCp-TRPl pla.~mids (2), generously provided by Karen Arndt, and we screened for solid rcd (nonsectoring) colonies that could not losc the wild·type TBP gene (the YCp·URA3-ADEJ-SPT15 plal>mid). The solid red colonies were plated onto fresh plates to verify the nonsectoring phe· notype, and growth on medium containing FOA confirmed the inability of these strains to lose the YCp-ADEJ-URA3·TBP plasmid. The majority of these non· sectoring colonies contamed Icthal TBP mutations. and these mutations were eliminated by mating thc strain to strain DY7472. Plasmids which produced a nOllsectoring and 5-FOA·sensitive phenotype in the NHP61nhp6IJb diploid were discarded, while pla.~mids with a sectored. 5-FOA·resistant phenotype were reo tained. Plasmids were purified after passage through £,tcherjclzj(J coli, retrans· formed into nhp(>a/} and NHP6' strains to vcrify the phenotypes. and then sequenced. ChIP. Chromatin immunoprecipitation (ChIP) was performcd as dcscribed previously (7) using either 9E11 monoclonal antibody to the Myc epitope or polyclonal anti-TBP serum provided by Lauric Stargcll. Multiplex PCR was pcrformed with oligonucleotides specific 10 the HO and PGKl promotcr and the TRAI open reading frame, and products were visualized on ethidium bromide· stained 2.6% MetaPhor agaro~e (BioWhinaker) gels. Quantitative ChIP was performed by real·time PCR with a LightCycier (Roche) and primers specific 10 SNR6 or TRAI. The amounts of specific target DNA regions amplified in im· munoprecipitated samples were determined with LightCycler software (version 3.5; Roche) by comparing the PCR logarithmic amplification threshold (crossing point) values far ChiP DNAs versus a standard dilution series of input samples prior to IP. Each PCR was performed in triplicate, and the normalized mean and standard deviation of the f'<ltio of SNR6 to TRAI values was calculated according to equation 7 of van Kempen and vall Vliet (66) to determine the relative enrichment of the specific target versus the nontargct control. Results of at least two independent ChIP reactions are reponed here. Thc sequences of the PCR primers arc as follows: ior SNR6, CTGGCATGAACAGTGGTAAA and GGG so MOL CEU,. BIOL TABLE 1. S. cerevisitLe strains used in this Strain Relevant genotype DY150 ................................... MA Ta ode2 callI his3 leu2 trpl ura3 DY15L. ................................. MA Tex ade2 callI his3 leu2 trpl uro3 ·DY2381 ................................. MATa. IIhp6a::URA3 nhp6b::HIS3 ade2 callI his3 leu2 trpl ura3 DY3398 ................................. MATa ade2 canl his3leu2 trpl DY6439 ................................. MA Ta. nhp6a::URA3 I1hp6b::ADE2 ade2 conI his3 lell2 trpI Ilra3 DY7242 ................................. MATa sptI5::LEU2 + SPTI5(YCp- URA3-ADE3) ade2 add canl his3 leu2 trpl ura3 DY7244 ................................. MATex nhp6a::KaIlMX nhp6b::HIS3 sptl5::LEU2 + SPTI5(YCp-URA3- ADE3) ade2 add canl his3 leu2 lys2 trpl ura3 DY7472 ................................. MATa sptI5::LEU2 + SPTI5(YCp· URA3-ADE3) ade2 Clml his3 leu2 trpI ura3 DY7474 ................................. MATa spt3::ADE2 sptI5::LEU2 + SPTI5(YCp·URA3-ADE3) ade2 canl his3 leu2 trpl ura3 DY7588 ................................. MATa nhp6a::URA3 nhp6b::ADE2 ade2 callI his3 leu2 lys2 trpI ura3 DY7723 .................................. MATa nhp6a::KaIlMX nhp6b::HIS3 spt3::ADE2 sprI5::LEU2 + SPTI5(YCp-URA3-ADE3) ade2 conI his3 leu2 trpl ura3 DY8162 ................................. MATa Ilhp6a::KanMX nhp6b::HIS3 sptI5::ADE2 + SPT15(YCp·URA3- ADE3) ade2 add conI his3 lel/2 lys2 trpI ura3 DY8356 ................................. MATa nhp6a::KanMX nhp6b::HIS3 sptI5::LEU2 + SPTI5(yCp-URA3. ADE3) ode2 cani his3 leu2 ~vs2 lrpl ura3 DY8360 .................................. MATa SPTI5-MYC(18)::TRPI nhp6a::KanMX Ilhp6b::HIS3 ade2 canl llis3 Jeu2 trpl ura3 DY8408 ................................. MA Ta SPTI5-MYC(18)::TRPI ade2 canI his3 leu2 lys2 crpl ura3 DY8409 ................................. MATa. SPTI5-MYC(18)::TRPI ade2 canI his3 leu2 tip] ura3 DY8855 .................................. MATa IIhp6a::IVmMX IIhp6b::ADE2 spt3::TRPI ade2 conI his3 leu2 trpl DY8858 ................................. MATa. snro::LEU2 + SNR6-wild type(YCp·TRPI) ade2 callI his3leu2 lys2 me!2 trpi DY8859 ................................. MATo. sllro::LEU2 + SNR6-t:.42(YCp· TRPl) ade2 canl lzis3leu2 lys2 mct2 (rpl DY8860 .................................. MATo. .mro::LEU2 + SNR6-T14A(YCp- TRPI) adc2 call] his3leu2 {vs2 met2 [rpl DY886l... ............................... MATa .mro::LEU2 + SNR6-T5- ftip(YCp·TRPI) adc2 Clml his3leu2 fys2 met2 trpI DY8980 ................................. MATa spt3::TRPI ade2 canI his3leu2 /ys2 met]5 GAACTGCTGATCATCTC; for TR41, CfGAGTATGCACfATGGGAA and CTTGATCTCCTTITCTGCTT; and for PGKI, CCAGAGCAAAGTTCGT TCGA and GCTTGTCCTTCAAGTCCAAA. Other methods. For the SNR6 Northern blot, RNA was separated on an 8'1< polyacrylamide gel containing 8 M urea, transferred to a Biodync B nylon membrane (Pall). and probed with laheled oligonucleotides specific for SNR6 (CCTT ATGCAGGGGAACTGCTGA TCl and SNR128 (CCGAGAGT ACT AA CGA TGGGTTCGT AAGCGTACTCq RNAs. The Nonhcrn blots werc quan· titated using ImageQuant software and a Molecular Dynamics Phosphorlmager. The Hi Uthium mcthod (31) was used for yeast transformations. For dilution VOL. 24. 2004 TABLE 2. Plasmid., used in this study" Plasmid Description Reference or source pRS422 YEp-ADE2 vector 9 pRS423 YEp-HIS3 vector 60 pRS425 YEp-LEW vector 60 pRS314 YCp-TRPl vector 60 YEplac195 YEp-URA3 vector 25 pRS426-SNR6 SNR6 in YEp-URA3 Dave Brow plasmid M4479 SNR6 in YEp-LEW This work plasmid M4488 SNR6 in YEp-ADE2 This work plasmid pRS4231B70 BRFl in YEp-HlS3 56 plasmid pDE28-6 TBP (SPT15) in YCp- 19 URA3 plasmid pTM8 TBP (SPTJ 5) in YCp- 34 TRPI plasmid M4373 TBP (SPTJ5) in YCp- This work URA3-ADE3 plasmid pSH346 TFlLA (TOAl and TOA2) Steve Hahn in YEp-LEW plasmid • All plasmids used in this study except for the TBP mutant plasmids which were all YCp-TRPI. plating assays, cells were grown to saturation in either rich or selective medium (depending on the plasmid) and washed with water, and then aliquots of diluted samples (lO-fold dilutions) were plated on appropriate medium. RESULTS Reduced TBP binding to the SNR6 promoter in nhp6ab mu­tant cells. To investigate whether Nhp6 affects TBP binding to promoters in vivo, we performed ChIP assays to compare TBP binding in NHP6 and nhp6ab cells. We used PCR to examine the amount of DNA from a number of promoters transcribed by Pol 11, including HO, HIS3, TRP3. URAl, ELP3, STE3, ADH2, METl4, MFA2, SER3, VID28, VPS38, andXRS2. How­ever, none of these promoters showed a strong ditl"erence in TBP binding when immunoprecipitated material from wild­type and nhp6ab cells were compared (data not shown). It is possible that the nhp6ab mutation affects TBP binding but only modestly or that TBP binding to other Pol II promoters that we have not tested is affected. We next examined TBP binding to the SNR6 promoter in the nhp6ab mutant Reduced expression of SNR6, transcribed by RNA Pol III, in an nhp6ab mutant is at least partially responsible for the 37"C growth defect, as a multicopy plasmid with SNR6 can at least partially suppress this gro\\1.h defect (35, 42). We constructed isogenic strains with a TBP-Myc­tagged allele, either NHP6 or nhp6ab, and performed ChIP experiments. The experiment was done in duplicate, using cells grown at 30°C. Real-time PCR was used to quantitate the amount of SNR6 DNA in the immunoprecipitated chromatin. As shown in Fig. 1 A, TBP-Myc shows strong binding to SNR6, compared to the untagged control strains. Importantly, binding of TBP-Myc to SNR6 was significantly reduced in the Ilhp6ab mutant. The TBP-Myc-tagged nhp6ab strain shows a marked growth defect, and we have previously reported synthetic lethality be- 51 TBP MUTANTS LETHAL IN nhp6ab MUTANT 6421 .r---..... --------------..... --..... ----~ A.'&. <:' 4? .9, B. wild type nhp6ab 1 2 3 4 5 6 7 8 9 10 11 PGK1 TRA1 SNRB PGK1 TRA1 SNRB FIG. 1. TBP binding to SNR6 is reduced in nhp6ab mutant. (A) ChIP was performed with untagged strains. TBP-Myc-tagged NHP6 strains, and TBP-Myc-tagged nhp6ab strains. Real-time peR quantitation of TBP-Myc binding to the SNR6 gene shows reduced binding in the nhp6ab mutant. The units are arbitral)' units after normalization to a TRAl internal control. Strains DY150, DY151. DY8408, DY8409, DY8360, and DY8361 were used. (B) After an aliquot of NHP6 and nhp6ab strains grown at 30·C were harvested, the remaining cells were shifted to 37°C for 60 min and then harvested. Chromatin samples were prepared and immunoprecipitated with poly­clonal anti-TBP antibody. Serial twofold dilutions were used to assess binding of native TBP to PGKl (positive control), TRAl (negative control), and SNR6 by multiplex PCR. Lanes 1 to 3, input controls; lanes 4 to 6. ChIP from 30°C samples; lane 7, mock IP from 30°C sample; lanes 8 to ] 0, ChIP from 37°C samples; lane 11, mock IP from 37°C sample. Strains DY151 and DY2381 were used. tween nhp6ab and hemagglutinin-tagged TBP alleles (67). Therefore, we wanted to confirm that TBP binding to SNR6 is reduced in the nhp6ab mutant, but using a polyclonal TBP antibody instead of an epitope-tagged strain. lIhp6ab mutants do not grow at 37°C, and Kruppa et a!. (35) showed that shifting an nhp6ab strain to 37°C results in reduced SNR6 RNA levels. Thus, we grew wild-type and nhp6ab cells at 30°C and then shifted them to 37°C for 60 min. More than 85% of nhp6ab cells relain viability after 60 min at 37°C. Samples were taken for ChIP analysis both before and after the temperature shift. In addition to testing for TBP binding to SNR6, TBP binding to the PGKl promoter and TRAl open reading frame were assessed as positive and negative controls, respectively. The ChIP material was analyzed by multiplex PCR, with prod­ucts separated on gels. The results show clearly that the occu­pancy of the SNR6 TAT A element by TBP is Nhp6 dependent (Fig. IB). Quaniitalion of the SNR6 ChIP signal, normalized 10 the PGKJ control, shows TBP binding to SNR6 of 3 to 5.5 binding units (arbitrary units) of that in wild-type cells, while TBP binding to SNR6 is reduced in the nhp6ab mutant to 6422 ERIKSSON ET AL. BromPlete 6-azauracll nhp6ab YEp-HIS3 vector YEp-BRF1 YEp-LE:U2 vector YEp-SNR6 YEp-TBP NHP6 SNR6(wild type) SNR6-A42 SNR6(T14A) SNR6(T5-flip) FIG. 2. Multicopy BRF1 or SNR6 suppresses the 6-AU sensitivity of Illzp6ab mutants. (A) Dilutions of strain DY6439 transformed with the indicated plasmid were plated on plates containing complete me­dium or medium containing 6-AU (25 fLglml) and incubated at 30'C for 2 days (complete medium) or 6 days (medium containing 6-AU). Plasmids pRS423 (YEp-H1S3 vector), pRS423/B70 (YEp-BRFJ), pRS425 (YEp-LEU2 vector), M4479 (YEp·SNR6), and M4480 (YEp­TBP) were used. (B) Dilutions of strains DY8858 (SNR6 wild type), DY8859 (SNR6-M2), DY8860 (SNR6-TJ4A). and DY886J (SNR6- T5-fiip). were plated on plates containing complete medium or me­dium containing 6-AU (75 fLglml) and incubated at 30'C for 2 days (complete medium) or 6 days (medium containing 6-AU). about 1 binding unit, the SNR6/PGKI ratio seen in the input DNA. We conclude that TBP binding to SNR6 is ledured in an nhp6ab mutant. Multicopy SNR6 and BRFI suppress the 6-AU sensitivity of nlzpoob mutants. The uracil analog 6-azauracil (6-AU) inhibits transcriptional elongation by causing imbalances in the pools of ribonucleotide triphosphates (20, 57). and some believe that mutants sensitive to 6-AU are defective in elongation. An nhp6ab mutant is very sensitive to 6-AU (l0, 22). and a COIl­centration of 25 fLg of 6-AU per ml is sufficient to effectively inhibit growth (Fig. 2A). We wanted to know whether specific genes on multicopy plasmids will suppress this G-AU sensitiv­ity. Nhp6 is required for efficient transcription of the SNR6 gene by RNA Pol III (35. 42. 44). SNR6, the gene for U6 RNA, and BRF1. encoding a Pol III transcription factor, act as multicopy suppressors of the temperature-sensitive phenotype of nhp6ab mutants (35). A multicopy plasmid with TBP also suppresses the temperature-sensitive growth defect of an nhp6ab mutant (67). We determined whether SNR6, BRFI, or TBP, when present on a multicopy plasmid. could suppress 6-AU sensitiv­ity of the nhp6ab mutant (Fig. 2). The results show strong suppression from either overexpression of the BRFl Pol III factor or increased copies of the SNR6 structural gene. This is a surprising result, suggesting that decreased SNR6 expression contributes to the 6-AU sensitivity. Interestingly, overexpres­sion of TBP does not suppress the 6-AU sensitivity. It is pos;;ible that reduced SNR6 RNA levels contribute to the sensitivity to 6-AU, as the steady-state levels of SNR6 RNA are lower in an nhp6ab mutant than in wild-type cells (42). To test this idea, we constructed strains with mutations in the SNR6 promoter that reduce expression, and these mutations result in a 6-AU-sensitive phenotype (Fig. 2B). Interestingly, 52 MoL. CELL. BIOL all three of these SNR6 promoter mutations are lethal in the absence of Nhp6 (44). It is possible that the decrease in SNR6 RNA affects mRNA splicing, and this results in 6-AU sensi­tivity (see Discussion). Nonetheless, these experiments clearly show that sensitivity to 6-AU can result from a mutation in a gene not having a direct role in transcriptional elongation. Screen for TBP mutations that are lethal in the absence of Nhp6. Cells containing TBP with a hemagglutinin epitope tag. whether the tag is at the N or C terminus, are viable and healthy, but the tagged versions ofTBP are lethal in an Ilhp6ab mutant (67). Similarly, TBP(K138T Y139A), TBP(G174E), and TBP(F237D) mutants are viable in an NHP6+ strain but lethal in an nhp6ab mutant (67). We wondered what other types of TBP mutations would not be tolerated in the absence of Nhp6, and we have taken two approaches. First, we set up a screen to look for TBP point mutations that are specifically lethal in an nhp6ab strain. Second, we tested a variety of TBP mutations that had been characterized in other labs. We used a red and white sectoring assay (6) to identify specific TBP mutations. We constructed an ade2 ade3 sptI5::LEU2 strain containing a YCp plasmid with three genes, the wild-type TBP gene and two nutritional markers, URA3 and ADE3. The SPTI5 gene, which encodes TBP, is essential for viability. so this strain cannot lose the YCp-ADE3-URA3- SPTI 5 plasmid, and the strains are red in color and sensitive to 5-FOA. This strain was transformed with a PCR-mutagenized TBP Iihrary on a YCp-TRPl vector (2), and we screened for solid red (nonsectoring) colonies (Fig. 3). The majority of lhes~ nonsectoring colonies contain lethal TBP mutations, and these mutants were eliminated by mating to an NHP6+ strain and testing the resulting NHP6+ /nhp6ab diploids for sectoring and 5-FOA sensitivity. Finally, all of the candidate TRPJ plas­mids with TBP mutations that were synthetic lethal with nhp6ab were purified and retransformed into nhp6ab sptI5 and NHP6+ sp/I5 strains to verify that the mutations are specifi­cally lethal with Ilhp6ab. We screened 8,500 colonies transformed with mutagenized TBP plasmids and recovered 32 TBP mutations that are lethal in the absence of Nhp6 (Fig. 4). These mutants were se­quenced, and all but five had a single amino acid substitution (Table 3). We also screened 33 TBP mutants previously char­acterized by other investigators and identified 11 additional TBP mutations that are lethal in the absence of TBP (Table 3; examples in Fig. 5A). As described below in the Discussion. these mutations cluster in three regions, near where TBP in­teracts with TFIIA (clusters 1, 2. and 3). where TBP interacts with Spt3 (clusters 5), and on the upper surface where the TBP core may interact with TBP-associated factors or the N-termi­nal region ofTBP (cluster 4 [Fig. 4]). The TBP mutations that are tolerated in the IIhp6ab mutant are interesting. and they include substitutions that eliminate interaction with TFilB (EI86L. E186 M, E188A, and L189A [38; S. Buratowski. un­publIshed data)) or TFJlA (K133L and K133UKI38L [11 D. substitutions that cause defective DNA binding (V71A, S118L. F148H, N159D, N159L. and V161A [2, 38, 61]), substitutions that cause defective transcriptional activation (V71 A, S118L, F148H, T1S3!, N159D. N159L. VI6lA and E236P [2, 37)), and substitutions that are lethal in the presence of a Taf1 truncation (SI18L, N159D, N159L. V161A. and E336P [34]). I nterestingly, two of this group of TBP point mutations that VOL. 24. 2004 r/ ~ ToBf'ISPT15J "'I I ~ ADE3 RAS i :~~e SDtlS":LEU2 \...-. i"ZZZZZZJ- ./ ... Trans.1O,< m wiU1 mUllIn! Tel> lIIltary ~ Saeen 101' non-sedoring CXliOllleS ... N_ngPhe_ l.IlY, • SoFOA Sensitive Male to NHP6<-I$plI5al1ll2atle3. YCr>-ADE:>-URA$.Spns r nhp6/1ll ~ .""2 a~ TeP TeP mUlanl ! Nifiiii; $pt15t. -;;t;i ~ (~ r-"\ i 4DE3URAS~) ~---------------------------------- StrainS with TBP null mt.alOn on TRPI pjaSmld cannot Ioso YC!> ADE3-URA3-SPT/5Ilaomid A.. . Non.sectoring F'nanotype 'Gil' • 5-FOA SeTl$it,,,,, StraIns wilh TBP mUlatJOO specIfiCally !elhal in nJJp5ab oan lOse YC.,.ADE3- IJRA3-SPT15Il1asmIC @:==::ype FlG. 3. Screen for TBP mutants specifically lethal in an nhp6ab mutant. Strain DY7244 (MATa nhp6a nhp6b spl15 ade2 add Ulu3 with a YCp·URA3·ADE3·SPI15 plasmid) was transformed with a YCp· TRPl library of TBP mutants. Nonsectoring colonies were identified. and then mated to strain DY7244 (MATa NHP6A NHP6B spti5 ade2 add ura3 with a YCp·URA3·ADE3·SPT15 plasmid), and the resulting diploids were tested for sectoring and 5·FOA growth phenotypes. Diploid strains giving sectoring and 5·FOA·resistant phenot:pes can· tain a TBP plasmid specifically lethal in an Ilhp6ab mutant. are tolerated in the absence of Nhp6 affect interac