Glycosaminoglycans and their binding proteins: biochemical studies and development of potential wound healing biomaterials

Glycosaminoglycans (GAGS), including hyaluronic acid (HA), heparin, heparan sulfate (HS), chondroitin sulfate (CS), dermatan sulfate (DS), and keratan sulfate (KS) are natural polysaccharides widely distributed in the extracellular matrix (ECM), cell surface, and the basement membrane. GAGs bind numerous proteins, which integrate them into many essential biological pathways. Therefore, studying GAGs and their binding proteins is important for the application of GAGs in biotechnology, pharmaceutical, and medical fields. This dissertation mainly discusses HA and heparin, with some biochemical studies with their binding proteins and potential applications to develop wound-healing biomaterials. An HA binding protein, RHAMM (receptor of HA-mediated motility), was engineered to generate a recombinant protein (HB3) with excellent heparin affinity and specificity. Therapeutically relevant heparin (both unfractionated and low molecular weight) can be measured using HB3 protein in a competition assay modified from an enzyme-linked immunosorbent assay (ELISA). This heparin assay has advantages in high consistency and low cost over current methods of activated partial thromboplastin time (APTT) and anti-Xa assays. Another important HA binding protein, SPACRCAN (sialoproteoglycan associated with cones and rods) in retinal areas, was found to bind with heparin and CS. The binding domain was identified to be RHAMM-like BX<sub>7

GLYCOSAMINOGL YCANS AND THEIR BINDING PROTEINS: BIOCHEMICAL STUDIES AND DEVELOPMENT OF POTENTIAL WOUND HEALING BIOMATERIALS by Shenshen Cai A dissertation submitted to the faculty of The University of Utah in partial fulfillment of the requirement for the degree of Doctor of Philosophy Department of Medicinal Chemistry The University of Utah December 2005 Copyright © Shenshen Cai 2005 All Rights Reserved THE UNIVERSITY OF UTAH GRADUATE SCHOOL SUPERVISORY COMMITTEE APPROVAL of a dissertation submitted by Shenshen Cai This dissertation has been read by each member of the following supervisory committee and by majority vote has been found to be satisfactory. Thomas E. Cheatham ~~cS/tW~ James N. H;rtOn .:..~ r(~ L ~{",£ L Frank A. Fitzpatrick THE UNIVERSITY OF UTAH GRADUATE SCHOOL FINAL READING APPROVAL To the Graduate Council of the University of Utah: I have read the dissertation of Shenshen Cai in its final form and have found that (1) its format, citations, and bibliographic style are consistent and acceptable; (2) its illustrative materials including figures, tables, and charts are in place; and (3) the final manuscript is satisfactory to the supervisory committee and is rea:o;:~n to The ~ad~te_SC---+fht_· -+--b~[~---- Date Glenn D. Prestwich"'"' Chair: Supervisory Committee Approved for the Major Department ChairlDean Approved for the Graduate Council --~ . David S. Chapman Dean of The Graduate School ABSTRACT Glycosaminoglycans (GAGs), including hyaluronic acid (HA), heparin, heparan sulfate (HS), chondroitin sulfate (CS), dermatan sulfate (DS), and keratan sulfate (KS) are natural polysaccharides widely distributed in the extracellular matrix (ECM), cell surface, and the basement membrane. GAGs bind numerous proteins, which integrate them into many essential biological pathways. Therefore, studying GAGs and their binding proteins is important for the application of GAGs in biotechnology, pharmaceutical, and medical fields. This dissertation mainly discusses HA and heparin, with some biochemical studies with their binding proteins and potential applications to develop wound-healing biomaterials. An HA binding protein, RHAMM (receptor of HA-mediated motility), was engineered to generate a recombinant protein (HB3) with excellent heparin affinity and specificity. Therapeutically relevant heparin (both unfractionated and low molecular weight) can be measured using HB3 protein in a competition assay modified from an enzyme-linked immunosorbent assay (ELISA). This heparin assay has advantages in high consistency and low cost over current methods of activated partial thromboplastin time (APTT) and anti-Xa assays. Another important HA binding protein, SPACRCAN (sialoproteoglycan associated with cones and rods) in retinal areas, was found to bind with heparin and CS. The binding domain was identified to be RHAMM-like BX7B motifs (where B is a basic amino acid residue and X is any non acidic amino acid residue). Cross-reactivity of SP ACRCAN with other GAGs suggests the involvement of SP ACRACN in ECM networks to help maintain the structure of interphotoreceptor matrix (IPM). Many growth factors (such as basic fibroblast growth factor, bFGF) bind heparin to execute their bioactivities. Thus, thiol-modified heparin was covalently crosslinked into GAG hydrogels (composed of thiol-modfied HA or CS crosslinked by poly (ethylene glycol) diacrylate (pEGDA» to control bFGF release. Release of bFGF could be extended to 4 weeks with only 1 % heparin (w/w to all GAGs) included, and bioactivity of bFGF was well maintained, as demonstrated by promoted neovascularization in Balb/c mice and improved wound healing in diabetic mice. Therefore, GAG-based biomaterials can be potentially developed into synthetic ECM (sECM) with additional necessary factors (such as laminin, which is also discussed in this dissertation) included to better mimic natural ECM for applications in tissue engineering. v T ABLE OF CONTENTS ABSTRACT ....................................................................................................................... iv LIST OF ABBREVIATIONS ........................................................................................... viii ACKNOWLEDGEMENTS .............................................................................................. xv Chapter 1. INTRODUCTION ................................................................................................... 1 1.1 Overview ........................................................................................................ 2 1.2 Glycosaminoglycans (GAGs): structures and functions .................................. 3 1.3 Biosynthesis, purification and degradation of GAGs ...................................... 9 1.4 GAG binding proteins .................................................................................... 16 1.5 Size analysis and quantification of GAGs ..................................................... 23 1.6 Chemical modifications of GAGs .................................................................. 26 1.7 GAG crosslinking .......................................................................................... 32 1.8 Medical applications of GAGs ....................................................................... 34 1.9 Summary ........................................................................................................ 38 1.10 References ...................................................................................................... 39 2. RHAMM BINDS HYALURONAN AND HEPARIN: A SELECTIVE PROTEIN SENSOR IN A COMPETITIVE ENZYME-LINKED IMMUNOSORBENT ASSAY FOR HEPARIN DETECTION ................................................................ 60 2.1 Introduction .................................................................................................... 61 2.2 Experimental procedures ............................................................................... 65 2.3 Results ............................................................................................................ 74 2.4 Discussion .................................................................................................... 1 09 2.5 Conclusion ................................................................................................... 115 2.6 References .................................................................................................... 116 3. SPACRCAN BINDS HY ALURONAN AND OTHER GL YCOSAMINOGL YCANS: MOLECULAR AND BIOCHEMICAL STUDIES ............................................................................................................. 125 3.1 Introduction .................................................................................................. 126 3.2 Experimental procedures ............................................................................. 128 3.3 Results .......................................................................................................... 135 3.4 Discussion .................................................................................................... 160 3.5 Conclusion ................................................................................................... 166 3.6 References .................................................................................................... 167 4. GROWTH FACTORS BIND TO HEPARIN: SYNTHESIS OF HEPARIN­SUPPLEMENTED GL YCOSAMINOGL YCAN HYDROGELS FOR GROWTH FACTOR CONTROLLED RELEASE ............................................ 172 4.1 Introduction .................................................................................................. 173 4.2 Experimental procedures ............................................................................. 175 4.3 Results .......................................................................................................... 183 4.4 Discussion .................................................................................................... 202 4.5 Conclusion ................................................................................................... 207 4.6 References .................................................................................................... 209 5. BINDING OF HEPARIN TO HUMAN BASIC FIBROBLAST GROWTH FACTOR (bFGF): CONTROLLED DELIVERY OF bFGF FROM HEPARIN-SUPPLEMENTED GLYCOSAMINOGLYCAN HYDROGELS ENHANCES ANGIOGENESIS AND WOUND HEALING ............................. 216 5 .1 Introduction .................................................................................................. 21 7 5.2 Experimental procedures ............................................................................. 220 5.3 Results .......................................................................................................... 233 5.4 Discussion .................................................................................................... 261 5.5 Conclusion ................................................................................................... 267 5.6 References .................................................................................................... 269 6. LAMININ: CANDIDATE TO BUILD HYALURONAN AND GELATIN HYDROGELS AS SYNTHETIC EXTRACELLULAR MATRIX ................... .274 6.1 Introduction .................................................................................................. 275 6.2 Experimental procedures ............................................................................ .278 6.3 Results .......................................................................................................... 280 6.4 Discussion .................................................................................................... 284 6.5 Conclusion ................................................................................................... 286 6.6 References .................................................................................................... 288 7. CONCLUSION .................................................................................................... 291 7.1 Summary ...................................................................................................... 292 7.2 Prospective work .......................................................................................... 295 7.3 References .................................................................................................... 299 VB 3-D ABC ACP ACT AD aFGF ALPHA ANOVA APTT ATIII BCAMD bFGF BNP BSA CCRGD CE CRO CNBr CPC LIST OF ABBREVIATIONS three-dimensional avidin-biotin complex autocrosslinked polysaccharides activated coagulation time Alzheimer's diseases acidic fibroblast growth factor amplified luminescent proximity homogeneous assay anal ysis of variance activated pariial thromboplastin time antithrombin III benign concentric annular macular dystrophy basic fibroblast growth factor brain natriuretic peptide bovine serum albumin cys-cys-arg -gl y-asp capillary electrophoresis Chinese hamster ovary cyanogen bromide cetylpyridinium chloride CS chondroitin sulfate CS-ABCase chondrotinase ABC CSPO chondroitin sulfate proteogl ycan CV coefficient of variance DAB diamino benzidine DE,DEAE diethy laminoethyl DMEM Dulbecco's modified Eagle's medium DMF dimethylformamide DMSO dimethylsulfoxide DPBS Dulbecco's phosphate-buffered saline DS dermatan sulfate DTNB 5,5' -dithiobis (2-nitrobenzoic acid) DTP 3,3' -dithiolbis (propanoic hydrazide) DTT dithiothreitol ECM extracellular matrix EDC, EDeI l-ethyI-3-[3-(dimethylamino)propyl] carbodiimide EOF epidermal growth factor EDTA ethylenediamine tetraacetic acid ERS Engelbreth-Rolm-Swarm ELF elastin-like peptide EUSA enzyme-linked immunosorbent assay EVAc ethylene-vinyl acetate FAK focal adhesion kinase ix FITC-HSA FYVE GAG GalNAc GlcA GlcNAc GlcNH2 GPC GSH GST Gtn H&E HA HABD HABM HAS RAse HB HBEGF hbFGF HEMA HGF HMT fluorescein isothiocyanate-human serum albumin domain contained in proteins Fablp, YOTB, Vaclp, and EEAl glycosaminoglycan N -Acetyl D-galactosamine D-glucuronic acid N-Acetyl D-glucosamine D-glucosamine gel permeation chromatography glutathione glutathione S-transferase gelatin hematoxylin and eosin hyaluronan, hyaluronic acid hyaluronan binding domain hyaluronan binding motif hyaluronan synthase hyaluronidase helical binding heparin binding epidermal growth factor human basic fibroblast growth factor 2-hydroxylethyl methacrylamide heptocyte growth factor heparin management test x HMWHA HOBt HP HPLC HPMA HRP HS HSPG HSV IdoA IGF lHABP IHe IL IPM IPTG IRBP KS LB LMWH LMWHA LR LYVE high molecular weight hyaluronan hydroxylbenzotriazole heparin high performance liquid chromatography 2-hydroxylpropyl methacrylamide horseradish peroxidase heparan sulfate heparan sulfate proteoglycan herpes simplex virus L-iduronic acid insulin-like growth factor intracellular hyaluronan binding protein immunohistochemistry interleukin interphotoreceptor matrix isopropyl (3-D-thiolgalactoside interphotoreceptor retinoid-binding protein keratan sulfate Luria-Broth low molecular weight heparin low molecular weight hyaluronan laminin receptor lymph vessel-specific receptor xi mAb MAPK MK MMC MS MTS MIT NGF NHS NI NMR NTSB ORF pAb PAG PAGE PAS PBS PDGF PEG PEGDA PET monoclonal antibody mitogen-activated protein kinase midkine mitomycin C mass spectronletry [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxynlethoxypheny1)-2-(4- sulfophenyl)-2H-tetrazolium, inner salt methylthiazoletetrazolium nerve growth factor N-hydroxyl succinimide neovascularization index nuclear magnetic resonance 2-nitro-5-thiosulfobenzoate open reading frame polyclonal antibody poly (aldehyde guluronate) polyacrylamide gel electrphoresis periodic acid Schiff phosphate buffered saline platelet-derived growth factor poly (ethylene glycol) poly (ethylene glycol) diacrylate polyelectrolyte theory xii PF4 PGA PGCL pHEMA PI3K PIA PIA2 PLG PLGA PLL PLSD PMSF PNIPAAm PPO PrPc PYA RGD RHAMM RPE RPMI RT SIN SA platelet factor 4 poly (glycolic acid) pol y (gl ycolide-co-caprolactone ) poly (2-hydroxyethyl methacrylate (or methacrylamide» phosphatidylinositol 3-kinase poly (lactic acid) phospholipase A2 poly (lactic-co-glycolide) poly (lactic-eo-glycolic acid) poly (L-Iysine) protected least significant difference phenylmethylsulfonyl fluoride poly (N-isopropylacrylamide) poly (propylene glycol) prion protein poly (vinyl alcohol) (PV A) arg-gly-asp receptor of hyaluronan-mediated motility retinal pigment epithelium Roswell Park Memorial Institute room temperature signal/noise streptavidin xiii SDS sECM SLP Spacr Spacrcan sodium dodecyl sulfate synthetic extracellular matrix secretory leukocyte protease sialoprotein associated with cones and rods (mouse isoform) sialoproteoglycan associated with cones and rods (mouse isoform) SP ACR sialoprotein associated with cones and rods (human isoform) SPACRCAN sialoproteoglycan associated with cones and rods (human isoform) SR STE t-PA TBS TGF TMB TRS TRU TSAb TSG UDP UFH VEGF swelling ratio salt-Tris-EDT A tissue plasminogen activator Tris buffered saline transforming growth factor 3,3' ,5,5' -tetramethyl benzidine Tissue retrieval solution turbidity reducing unit thyroid-stimulating antibodies tumor necrosis factor uridine diphosphate unfractionated heparin vascular endothelial growth factor xiv ACKNOWlEDGMENTS I would like to thank my advisor Professor Glenn D. Prestwich, who has provided for me the opportunity to work with highly interesting projects. I have learned so much from him on how to explore interdisciplinary scientific areas. His support and encouragement have been invaluable for my academic career. I would also like to thank Professors Chris M. Ireland, Thomas E. Cheatham, James N. Herron, and Frank Fitzpatrick, who have served as my committee members. I appreciate their valuable advice. I am grateful to Dr. Jodi Beattie, Dr. Qiuyun Chen, Dr. Xiaozheng Shu, and Dr. Yanchun Liu, who helped me greatly on my research. I thank Dr. Jerry Hinshaw, Jennifer Walsh, Dr. Yong Xu, Dr. Honglu Zhang, Dr. Joanna Gajewiak, Tyler Rose, Dr. Hee­kyong Lee, Jiang Sha in the lab, Dr. Dae-Yeon Suh, Dr. Kelly R. Kirker, Dr. Randy Booth, Dr. Xiao-Hui Liu in the previous group, and Dr. Li Feng, Dr. Paul Nelson, Dr. Lee Crosby at Echelon Biosciences Inc. They have been helpful with instrumentation and discussion. I also appreciate the rest of Prestwich's lab who have provided an excellent research environment for my Ph.D. studies. I extend special acknowledgment to Marie Dippolito, who has been indispensable to our well-functioning group. I would like to acknowledge the National Institute of Health and Center of Therapeutic Biomaterials, a member of the Utah Centers of Excellence Program, for generous funding to my research. I also appreciate all the collaborators who have shared essential work for my research. I would like to sincerely thank my parents, Zhengfa Cai and Yongli Zhao, who have given me unselfish support and love. I also would like to show my gratitude to my girlfriend Huifen Gao, who has accompanied me and encouraged me. I wish them all health and happiness forever. xvi CHAPTER 1 INTRODUCTION 2 1.1 Overview Glycosaminoglycans (GAGs) are a series of polysaccharides primarily distributed in extracellular matrix (ECM), basement membrane, and stroma (1). It is generally considered that, in mammals, GAGs include hyluaronan (HA), chondroitin 4-sulfate (CS A), CS B (or dermatan sulfate, DS), chondroitin 6-sulfate (CS C), keratan sulfate (KS), heparin, and heparan sulfate (HS). There are also nonmammalian GAGs in microbial systems such as dextran sulfate, which is found in marine algae (2). Although GAGs were first observed in the extracellular environment, recent research has disclosed the intracellular distribution of GAGs. Although the intracellular functions of GAGs are still controversial (3), extracellular GAGs primarily play important roles in cell signaling transduction and cell-cell interaction via binding with other biomacromolecules on the extracellular matrix or cell surfaces. A myriad of proteins interact with GAGs. Some proteins bind GAGs to form complexes of proteoglycans, where GAGs and proteins serve as backbones and side groups respectively (4). Proteoglycans and many other proteins that bind GAGs coexecute their biological functions on cellular activities within the extracellular space. Because of the extensive studies on GAG structures and functions, many applications involving GAGs have also been described. GAGs have been chemically modified into desired molecular sizes and reactive groups while still keeping their biological activities, in order to increase their functionalities in medical and engineering applications (5,6). Herein HA and heparin will be focused on as they are the GAG molecules primarily studied in this dissertation. 1.2 Glycosaminoglycans (GAGs): structures and functions GAGs are natural, linear polysaccharides composed of repetitive disaccharide units. The commonly seen GAGs include HA, CS (including CS A, CS C and DS), heparinIHS, and KS in mammals. They are all composed of disaccharide units linked with alternative uronic acid (D-glucuronic acid (GlcA) or L-iduronic acid (ldoA)) or galactose, and the amino sugars (N-Acetyl D-galactosamine (GalNAc), N-Acetyl D­glucosamine (GlcNAc), or D-glucosamine (GlcNH2)) (Table 1.1 and Figure 1.1). It should be noted that the structures of all GAGs vary in different tissues. Figure 1.1 only shows the typical structures they present. 3 GAGs are macromolecules with molecular weight varying from a few kilo­daltons to millions of daltons. Low molecular weight heparin (L WMH) separated from fractions of heparin extraction from porcine intestinal mucosa can have a molecular size as low as 5 kDa (7), whereas HA directly obtained from human umbilical proteoglycan complex in ECM has up to 1.5 MDa molecular weight (8). Generally, natural GAGs have molecular sizes as follows: low molecular weight heparin: 5-7 kDa; unfractionated heparin (UFH): 10-20 kDa; heparan sulfate (HS): 10-70 kDa (9); HA: 1-10 MDa depending on the tissure source (10, 11); CS (A-C): 10-50 kDa (12), and KS: 4-20 kDa (13, 14). 1.2.1 HA structure and function HA comprises about 1-10% of cartilage GAGs but also exists in other tissues such as skin (15), eyes (15), kidney (16), spleen (probably as a product of the lymphoid circulation (16)), urine (17), serum (18, 19), and intracellular nuclei (20). The structure of 4 Table 1.1. Structural comparison of glycosaminoglycans GAG Uronic acid Amino Linkage Sulfation sugar HA D-GlcA D-GlcNAc f3-1,3; f3-1,4 NONE CSA D-GlcA D-GaINAc f3-1,3; f3-1,4 GalNAc 4' -OH esc D-GlcA D-GaINAc f3-1,3; f3-1;4 GalNAc 6' -OH CS B (DS) L-IdoA D-GaINAc a-l,3; a-l,4 GalNAc 4'-OH Heparin/HS L-IdoA D-GlcNH2 a-l,4; a-l,4 IdoA 2'-OH; GlcNH2 2'~NH2, 3'-OH, 6'-OH KS Galactose D-GlcNAc ~-1,4; ~-1,3 GlcNAc 6'-OH 5 COOH OH NHCOCH3 HA COOH OH NHCOCH3 CSA COOH 0-- OH NHCOCH3 CSC Figure 1.1. Structure of GAGs (HA, CS A, CS C, CS B, beparin/HS and KS) 6 0-- NHCOCH3 OH CS B (DS) 0-- heparin/HS "'0-----. OH NHCOCHa KS Figure 1.1. (Continued) 7 HA is simple and unique among all GAGs: The disaccharide units in HA (D-GlcA and D-GlcNAc) are homogenous without variability. In addition, HA is the only known unsulfated GAG. In articular cartilage, HA can interact with aggrecan or other HA binding proteins to form large proteoglycans (4). HA is one of the most abundant GAGs in ECM and acts as cell stromal scaffold for cell growth and differentiation, as well as to regulate embryogenesis, morphogenesis, and hematopoiesis through various cytokines (21), and as a stimulator of chondrocyte migration in synovial joint fluid (22). In addition, increased HA levels are related to tissue damage and inflammation (18, 23-25), as well as cancerous tissue stroma and tumor cell cytosol. This increase is probably attributed to the abnormal expression of HA binding ligands and has been extensively studied recently to help diagnose cancer development (17, 19, 23, 26-32). Besides this, a large number of HA functions are executed through its binding with proteins and ligands (see Section 1.4.1). 1.2.2 Heparin/HS structure and function Heparin and HS have the same structure, composed of repeating IdoA and GlcNH2 or GlcNAc. The structure of heparin and HS is heterogenous due to a) the possibility of both IdoA and GlcA in the uronic acid structure and b) the different sulfation degrees on heparin/HS saccharide chains. In HS, the IdoA content is 30-50% whereas in heparin, IdoA can compose more than 70% of the uronic acid. Sulfation of heparin/HS normally occurs on three hydroxyl or amine groups: IdoA 2!-OH, GlcNH22'­NH2, 3'-OH, and 6' -OH. In HS the sulfation on the GlcNH2 is about 0.8-1.8 sulfate/hexamine and in heparin this can be 1.8-2.4 sulfate/hexamine (9). Such variability indicates the extensive heterogeneity of heparin/HS and as a result, it is difficult to distinguish heparin and HS completely. Heparin is widely known for its anticoagulant activity via binding antithrombin 8 III in plasma to prevent thrombosis (33). It is one of the oldest approved drugs in the world, with potential anticancer function that is currently being actively studied (34-36). Both heparin and HS have strong affinity for many cytokines including growth factors, ECM adhesive proteins, lipid metabolic enzymes, and serine protease inhibitors (37) to regulate their biological activities. In vivo HS is present in the form of heparan sulfate proteoglycan (HSPG) which binds with growth factors and other proteins on cell surfaces, thereby facilitating their bindin~ with corresponding receptors for further intracellular signal transduction (38-40) (see heparin binding proteins in Section 1.4.2 for more information). 1.2.3 Structures and functions of other GAGs CS (A-C) comprises more than 80% of GAGs in cartilage. It consists of repeating disaccharide units of OlcA and GaINAc. The sulfatioll degree also varies, but to a lesser extent than heparin/HS. The three forms of CS (A, B, and C) are found in different proportions in different cartilages. CS A is a strong indicator of periodontal diseases with elevated levels in chronic periodontitis sites (41). CS chains are attached to core proteins (such as aggrecan, versican, etc.) to compose CS-proteoglycans (CSPO) in cartilages and present the physicochemical properties (4). Recently, a CSPO-named appican has been linked to Alzheimer's diseases (AD). It is produced by C6 glioma cells and mediates neuronal cell adhesion and migration (42). KS is mainly present in articular cartilage, contributing 5-20% of the total GAG content (43). KS can also form proteoglycans in trachea and cornea cartilages (44). 9 Almost every GAG can bind with multiple core proteins to forming proteoglycans. Table 1.2 summarizes some GAG-based proteoglycans and their distributions in vivo. 1.3. Biosynthesis, purification and degradation of GAGs 1.3.1 Biosynthesis of GAGs The biosynthesis of GAGs is performed by action of specific enzymes. Basically, except for HA, all GAGs are synthesized on core proteins that have been presynthesized in the endoplasmic recticulum. Biosynthesis of non-HA GAGs is initiated at the serine residues on the core proteins transported to the Golgi apparatus (45-47). Following the addition of a linkage region (that varies between GAGs) to the serine residues, monosaccharide or disaccharide units of GAGs are attached to this linkage region to elongate the GAG chains by the action of specific enzymes (46, 48). N­acetylgalactosaminyl- transferase and glururonyl-transferase are involved in the biosynthesis of CS and DS (49), and glycosyl transferases EXT1 and EXT2 are involved in heparin/HS biosynthesis (50). During the elongation, the linear GAG copolymer chains are sequentially modified by de acetylation and sulfation via N-deacetylases, epimerases, or N (O)-sulfotransferases (46, 47). The final completion of GAG biosynthesis with desired lengths is likely controlled by these modifications (51,52). However, there is still some controversy concerning how GAG biosynthesis is precisely regulated. The biosynthesis of HA is markedly different from that of other GAGs. HA biosynthesis occurs in the plasma membrane instead of the Golgi apparatus (53, 54), and Table 1.2. GAGs and their corresponding proteoglycans GAG Proteoglycan HA aggrecan, versican CS AlC aggrecan, versican, decorin, biglycan, syndecan, glypican, cerebroglycan CS B decorin, biglycan, fibromodulin (DS) Heparin SergI ycin HS prlecan, syndecan, cerebroglycan, glypican KS fibromodulin, lumican Distribution ECM ECM, cell surface Collagen associated stroma Intracellular granules Basement membrane, cell surface ECM, collagen associated stroma 10 11 the core protein is not required to initiate the process. In addition, because of the lack of sulfation in HA polymer chains, there are no sulfotransferases involved. The glycosyl transferase involved in constructing HA polysaccharide chains is HA synthase (HAS) (55). HAS binds uridine diphosphate (UDP)-monosaccharides, which include UDP-GlcA and UDP-GlcNAc, and then transfers the monosaccharides to the extending HA polymer chain (55). Because the HAS is located in the plasma membrane, it may also play an important role in transporting polymerized HA through the cell membrane to the extracellular space (56). The biosynthesis of HA is known to be activated by many growth factors such as epidermal growth factor (EGF), platelet-derived growth factor (PDGF), transforming growth factor P (TGF-~), insulin-like growth factor (IGF-I), and cytokines such as interleukin-1 (IL-1) (57, 58). The mechanism of their actions is still being studied. Three classes of HAS (HAS1, HAS2, and HAS3), differing in protein structure and enzymatic mechanism, have been reported (56, 59). HAS1 has the least activity and is thought to maintain a low but necessary level of HA in vivo. HAS2 is the most widely expressed enzyme, which probably synthesizes large amount of HA for tissue growth and structural construction. Both HAS1 and HAS2 are able to extend HA polymer chains up to 1 million Daltons. In contrast, HAS3 is the most active protein in HA synthases, but it only synthesize up to 105 Dalton HA, which primarily contributes to the low molecular weight HA production (54, 56). More detailed differences between the HAS family nlerrlbers continue to be discussed, such as the difference in UDP-sugar usage as donor or receptor between HAS1 and HAS2 (59). It should also be noted that biosynthesis of HA is not affected by most of the chemicals that affect the synthesis of the other GAGs, which strongly indicates that HA biosynthesis is separated from the general GAG synthesis. 1.3.2 Isolation and purification of GAGs 12 Normally GAGs can be isolated from metastatic cancerous tissues (60, 61), body fluids (62), mucousa (63), plasma (64, 65), or platelets (66) where they are abundant. GAG-containing proteoglycans are first extracted from these tissues followed by removal of core proteins to obtain the GAGs. Proteoglycans can be extracted by mechanic methods such as homogenization to break and remove the tissue chunks (60) or by enzymatic methods using papain (61). Ethylenediamine tetra acetic acid (EDTA) is usually added to the extracting solutions in order to break the chelation between proteoglycans and metal ions. To remove core proteins, alkaline borohydride (NaBH4) treatment in harsh conditions (NaOH solution, 45°C and a few days of incubation) has been widely used (61, 63). GAGs released from core proteins by alkaline borohydride cleavage can be separated by electrophoresis (61,64-66), liquid chromatography, gel filtration chromatography, or ion exchange chromatography (61, 64, 66), based on their different molecular sizes and anionic charges at neutral pH. Separated and pooled individual GAG can be further characterized (see Section 1.5) and purified by dialysis or ethanol precipitation. 13 1.3.3. Degradation of GAGs Polymer chains of GAGs can be degraded into smaller oligosaccharides by cleaving the glycosidic bonds via chemical or enzymatic hydrolysis. Under normal conditions, GAGs undergo hydrolysis quite slowly, but this process is dramatically accelerated with acid catalysis. By controlling the time for hydrolysis, controlled lengths of hydrolyzed GAGs may be obtained (8, 67). Another important GAG degradation process is enzymolysis. So far a variety of enzymes responsible for in vivo digestion of GAGs have been discovered. A majority of these enzymes are derived from microbes, which are believed to utilize these depolymerases to digest host connective tissues and ECM for their invasion during infection (68-70). HA is degraded by the enzyme hyaluronidase (HAse). Several HAse groups have been identified with different structures and enzymatic mechanisms. Hyaluronidases fronl animal testes (bovine, sheep, etc.) cleave (3-N-acetyl-hexosamine (1-+4) glycosidic bonds, resulting in even-numbered oligosacchardies (71). In contrast, when acting on the same 1-+4 glycosidic bonds, hyaluronidases from bacteria such as Streptomyces (also called HA lyases) catalyze an elimination reaction, forming unsaturated disaccharides (68, 72) (Figure 1.2). Another RAse group from leeches is specific for the glucuronic linkage in RA (73). Several studies have focused on the microbial RAses. Three main RAses from bacteria are comnlercially available. RAse from Streptomyces hyalurolyticus is the most specific RAse yet known. It only degrades RA and not other GAGs including CS, KS, and heparin/HS (74). RAses from Streptococcus dysgalactiase and peptococcus show weak but real activity in CS degradation (75), whereas RAse from Arthrobacter COOH COOH OH NHCOCH3 OH COOH OH OH NHCOCH3 Figure 1.2. HA degradation by HAses from bacteria and Streptomyces, resulting in unsaturated disaccharides as the degradation product by an elimination reaction. 14 15 aurescens has significantly increased enzymatic activity towards CS, while still maintaining the same HAase activity as in Streptomyces hyalurolyticus (76). Jedrzejas et al. have extensively studied HAses from Streptococcus pneumoniae and Streptococcus agalactiase, reporting results on structures, mechanisms, and kinetics of these enzymes (72, 77-82). Heparin/HS lyase (or heparinase) is an enzyme that degrades heparin and HS. The most widely studied and used heparinases are isolated from bacterium Flavobacterium heparinum (83-85). The enzymes are very specific, acting only on heparin and HS. Three kinds of heparinases (heparinase I, 43 kDa; heparinase II, 84 kDa; and heparinase III, 71 kDa) have been purified and characterized from Flavobacterium heparinum (84). These enzymes are products of different but closely related genes in the organism. They all act at the GlcNH2 (1-i104) glycosidic bonds (-IdoA) to form even-numbered oligosaccharides, with only slightly different activities and stabilities (83). A complex of CS lyases (or chondroitinase) fronl bacteria have also been studied. Commercially available CS lyases include chondroitinase ABC (acts on all CSs), chondroitinase AC (acts on CS A and CS C), chondroitinase B (acts on CS B), and chondroitinase C (acts on CS C) (86, 87). There are also keratanases to cleave KS that have been utilized to remove trace impurities of KS when purifying other GAGs (88). Degradation of GAGs is an important process in producing low molecular weight GAGs both in vitro and in vivo. In vitro, degradation can be used to make controlled lengths of GAGs for constructing biomaterials with desired physicochemical properties. In vivo, degradation of GAGs is of special value for a series of biological activities such as GAG metabolism (through endocytosis and degradation in lysosomes (54, 89-91) in lymph nodes (92), kidney, spleen (93), liver (92, 94), knee joint (95) and other tissues). 16 The biological functions of low molecular weight GAGs (short oligosaccharides) are different than high molecular weight GAGs (96). For instance, low molecular weight HA (LMWHA, 4-25 disaccharide units) can stimulate endothelial cell (BC) proliferation and migration whereas native high molecular weight HA (HMWHA) inhibits these processes (96-98). In another example, overexpression of HA synthases (99) with corresponding elevated level of HMWHA is associated with tumor growth (17, 27-32). In contrast, degraded LMWHA or HA oligomers can inhibit tumor growth markedly and provide an attractive cancer therapeutic candidate (100, 101). Similar processes are thought to be applicable for low molecular weight heparin or small heparin-similar oligosachharides in solution as a potential tumor inhibitor to interfere with the signaling involving large HSPG molecules on the cell surface (34-36). Such counteracting phenomena are considered to be the result of low molecular weight GAGs competing with high molecular weight GAGs to replace high affinity, multivalent interactions with reduced affinity and lower-valent interactions with cell surface receptors (102). This is consistent with research showing that low molecular weight GAGs have reduced affinity with their binding proteins and ligands (7, 103-105). 1.4 GAG binding proteins A myriad of proteins in vivo interact with GAGs. These proteins are universally distributed in ECM, cell surface, intracellular cytoplasm, and serum to forming complexes with GAGs. GAG binding proteins act as bridges to connect GAGs and their 17 mediated molecules downstream in cell signaling pathways, which is essential for GAGs to perform their diversified biological functions. Because GAGs are negatively charged under physiological conditions with their polysulfation and carboxyl groups, their binding proteins, rich in basic amino acid residues, share the common feature of positively charged domains to bind GAGs electrostatically. 1.4.1 HA binding proteins HA binding proteins, also called hyaladherins, can be divided into two basic families: Link module superfamily and Non-Link module superfamily (4, 106). Link module is a common HA-binding domain found in a series of HA binding proteins. Link module consists of approximately 100 amino acid (aa) residues with four cysteines that compose two disulfide bonds in the form of Cysl-Cys4 and Cys2-Cys3 (107). Link module family is classified into three subgroups based on the molecular size of the domain required for HA binding: 1) TSG (tumor necrosis factor stimulated gene) type, including TSG-6, with a 90-aa Link module as the HA-binding domain (4, 106); 2) CD44-type, including CD44 and L YVE-1 (lymph vessel-specific receptor for hyaluronan), with 160 aa HA binding domains composed of Link module and both N­and C- terminal extensions required for correct protein folding (108-110); 3) Link protein-type, including Link protein, aggrecan, versican, neurocan, and brevican, with 200 aa HA binding domains composed of two Link modules in tandem, both of which are involved in binding (111, 112). The Non-Link module superfamily of HA binding proteins does not contain a Link module. RHAMM (receptor ofHA-mediated motility), SPACR (sialoprotein 18 associated with cones and rods) and its proteoglycan form, sialoproteoglycan associated with cones and rods (SPACRCAN), CD38, CDC37, and lHABP4 (intracellular HA binding protein 4) all belong to this category (4, 106). Although the HA binding domains of Non-Link module superfamily, and even within the Link module superfamily have major differences, the molecular basis for binding to HA are the interactions of basic amino acids (Lys, Arg, or His) with the carboxylic acid groups of HA (113). In CD44, two arginines (Arg41 and Arg78) are the critical residues for HA binding (108, 114). For RHAMM, two BX7B (two basic amino acids flanking seven nonacidic amino acids) motifs are believed to contribute to the HA affinity (115, 116). BX7B-like binding motifs are also present in SPACR or SPACRCAN (15, 117, 118), CD38 (119), CDC37 (120), and IHABP4 (121). HA binding proteins play an important role in diversifying HA functions. Besides the formation of proteoglycans with HA in connective tissues for cell attachment, HA binding proteins can participate in HA regulation on cell surfaces and transduce the regulatory signal to intracellular signaling pathways. CD44 and RHAMM are the two most extensively studied HA receptors mediating HA signaling. CD44 is coupled with at least two tyrosine kinases, p185HER2 and c-Src, which can be activated by HA binding (122, 123). This binding controls downstream cellular activities involving focal adhesion kinase (F AK) association with phosphatidylinositol 3-kinase (PI3K) followed by mitogen-activated protein kinase (MAPK) activation (124). This results in cytoskeleton rearrangement and cell transformation through the RhoA (a GTPase) pathway (125). Binding of HA to cell surface RHAMM activates Src kinases (126) F AK kinases (127), Erk kinases (127) and protein kinase C (128), which signals a kinase cascade to mediate 19 cytoskeleton assembly or disassembly (129). In addition, CD44 and L YVE-1 have been found to facilitate HA catabolism in vivo by attracting HA for uptake, internalization, and endocytosis (54, 130). Another application of HA binding proteins in vitro is HA detection and quantification (25, 103, 131). The affinity of HA binding proteins to HA, such as CD44 with HA, is thought to be regulated by multiple cytokines including oncostatin M and transforming growth factor ~1 (TGF-~1) (132). Because of the intimate correlation of the ECM, cell surface HA and HA binding proteins with cell signaling, HA binding proteins have been used as biomarkers to monitor cancer development. As described in Section 1.2.1, cancerous or actuated inflammatory cells in peripheral tissue or serum show upregulated expression of HA and HA binding proteins, which provides a method to help diagnose tumorigenesis. This has been widely used as a powerful tool for diagnosis of many types of cancers (17, 19, 23, 27-32, 133-136) and inflammatory diseases (i8, 24, 25). 1.4.2 Heparin/HS binding proteins As described for HA, there are also numerous heparin/HS binding proteins distributed widely in vivo. Multisulfated groups in heparin/HS make the interactions between heparin/HS and their binding proteins predominantly electrostatic. Binding of heparin/HS requires at least a pentasaccharide sequence containing three D-glucosamines sandwiched by two uronic acid residues (137). In addition, adequate sulfated groups in this minimal binding unit are critical for the binding, probably because of their contribution to the electrostatic affinity. It should also be noted that the structural unit required for binding with proteins varies. For instance, in binding to fibroblast growth factor (FGF) 1 and 2, oligosaccharides with six or eight monosaccharide units are adequate (105). However, at least 14 monosaccharides are required for heparin/HS to bind FGF-8b and to activate Erk phosphorylation resulting in cell proliferation (138). Generally the binding affinity of heparin oligosaccharides to protein increases as the length of the oligosaccarides increases (139, 140). 20 Heparin/HS binding donlains feature abundant basic amino acids. It has been suggested that a TXXBXXTBXXXTBB (T indicates a turn) motif serves as a common binding site for FGF-l and 2 and TGF-f3 (46, 141). This suggests that interactions between heparin/HS and their binding proteins may not necessarily be based on ionic forces. For instance, secretory leukocyte protease (SLP) inhibitor (14?) and brain natriuretic peptide (BNP) (143) bind heparin mainly through hydrogen bonding (via hydroxyls on heparin) with ionic interactions only making a small energetic contribution (6%) (143, 144). Table 1.3 sunlmarizes common heparin binding proteins (37). Growth factors are probably the most important heparin/HS binding proteins due to their role in cell signaling to regulate cell growth, differentiation, and apoptosis. It has been reported that many oncogenesis events are related to misregulation by growth factors. For example, breast cancer is associated with an increased level of epidermal growth factor (EGF), and blocking EGF binding to its receptor has been used as an anticancer therapy (145). Vascular endothelial growth factor (VEGF) can stimulate tumor angiogenesis through its irregular expression, thereby providing the opportunity to develop VEGF -targeted antiangiogenic therapies. Because EGF and VEGF binding to their receptors for cell Table 1.3. Heparin/HS binding proteins Heparin binding growth factors Adhesive matrix proteins FGF-1 (aFGF), FGF-2 (bFGF), FGF-3, FGF-4, FGF-S, FGF-6, FGF-7, FGF-8, FGF-9, HGF (hepatocyte growth factor), HBEGF (heparin binding epidermal growth factor), VEGF (Vascular endothelial growth factor), midkine Fibronectin, Vitronectin, Laminin, Collagens, Thrombospondin etc. Enzymes Involved Lipoprotein Lipase, Hepatic Lipase, Phospholipase, in Lipid Apolipoprotein B, Apolipoprotein E etc. Metabolism Serine protease inhibitors Other proteins Antithrombin III, Heparin Co-factor II, Protease Nexins etc. Superoxide Dimustase, Elastase, Platelet Factor 4, N-CAM, Transcription Factors, DNA Topoisomerase, RNA Polymerase, Tumor Necrosis Factor etc. 21 signaling requires HS involvement, inhibitors of heparin/HS binding to these growth factors can be a potential for anticancer drug discovery (34-36, 146). A number of additional heparin/HS binding proteins have been identified. 22 Endogenous antithrombin III (ATIII) (NOTE: HS does not bind ATIII (9» forms a complex with heparin in serum and inhibits blood clotting. This is the principle for using heparin as an anticoagulant for the treatment of thrombosis for nearly a century. Interactions between heparin and ATIII have also been studied to elucidate the required heparin pentasaccharide oligomer (147) and the critical aa residues in ATIII (144). Another important heparin/HS binding protein is follistatin, an inhibitory polypeptide against TGF-~, which binds HSPG to significantly lower TGF-~ levels (148, 149). In addition, human group IIA phospholipase A2 (hIlA PLA2), a 14 kDa enzyme associated with inflammation and cytokine CD95 both bind HSPG gl ypican-1 in apoptotic human T -cells to stimulate the release of arachidonic acid and generate inflammatory signals (150). HSPG glypican-1 is also a plasma membrane carrier required to deliver polyamines (151), lipoproteins, growth factors, and microbes (39) for intracellular signaling. Another HSPG, syndecan-2, can modulate monocyte diapedesis across the brain endothelium (40). This process can be blocked by heparin or heparinase administration, demonstrating the indispensability of HSPG in these functions. Finally, heparin/HS can also interact with nlany ECM adhesive proteins including fibronectin, laminin, collagen, and vitronectin. Binding of heparin/HS with these molecules contributes to the localization of heparin/HS in extracellular stroma to provide a stable environment for the regulation of cell growth. 23 1.4.3 Other GAG binding proteins It is not surprising that CS and KS also have a variety of binding proteins. As a matter of fact, many HA and heparin/HS binding proteins have cross reactivity with CS and other GAGs. Therefore, it is hard to define a specific CS, KS, or heparin binding protein if viewed from a comprehensive aspect. For example, RHAMM, an HA binding protein, also binds heparin/HS, probably through the electrostatic bonding with its BX7B domains (152). The BX7B motif has been shown to have high cross reactivity with other GAGs including CS and heparin/HS, as is seen with RHAMM and SPACRCAN (7,15, 152). In another example, lactoferrin is a protein inhibitor bearing affinity with HS and CS. Lactoferrin inhibits herpes simplex virus (HSV) infection on cells expressing HS or CS by interfering with the virus glycoprotein C binding with HS or CS on the infected cell surfaces. Such interference is the result of the direct binding affinity of lactoferrin with both HS and CS (153). In addition, midkine (MK), a heparin-binding growth factor, also binds strongly to oversulfated CS proteoglycan (154). These examples indicate that protein-GAG interactions are highly complicated and that extensive cross-reactivity may be a necessity for a comprehensive GAG functional network throughout the in vivo environment. 1.5 Size analysis and quantification of GAGs 1.5.1 Size analysis Because of the variation of molecular weight among all GAGs, size analysis may not be a general analytical method for characterizing GAG molecules. However, given that the molecular weights of GAGs are well controlled (such as fractionated heparin, or 24 polysaccharides with small polydispersity indices), determination of GAG molecular size can be used to judge the purity and reaction degree in an initial estimation. A variety of methods can be used to determine molecular size of GAGs including light scattering, sedimentation-equilibration centrifugation (155), gel permeation chromatography (GPC) (8), size exclusion high performance liquid chromatography (HPLC) (156), mass spectrometry (MS) (67), and electrophoresis (agarose gel electrophoresis (157), polyacrylamide gel electrophoresis (PAGE) (158), or capillary electrophoresis (CE) (159)). Chromatographic and electrophoretic methods are most commonl y used to analyze GAG size due to their facile operation and small sample requirement. In both GPC and PAGE, standard curves (for GPC) or markers (for electrophoresis) are established using pure GAGs with small polydispersity prior to sample analysis. Gels obtained from PAGE are stained with cationic dyes that can bind strongly to the anionic GAGs. Such dyes can be selected from toluidine blue followed by 3,3'-dimethyl-9-methyl-4, 5, 4', 5'-dibenzothiacarbocyanine (157), Alcian blue, Azure A, Acridine orange or silver nitrate, all showing both advantages and disadvantages in various applications (158). 1.5.2 GAG detection and quantification GAG detection and quantification are important for identifying the presence of trace GAGs when purifying one GAG from another. More importantly, because of the intimate association of HA levels with the development of several diseases including cancer, and the anticoagulant application of heparin, measurement of these two GAGs is helpful in evaluating cancer prognosis and heparin pharmacokinetic profiles. Heretofore, 25 only a few analytical methods have been developed. These include chromatography, electrophoresis, safranin 0 assay, and other solid-phase assays, which are often combined in order to acquire reliable data. Chromatography such as GPC and HPLC detect GAGs based on their sizes, electrostatic charges, and hydrophobicity/hydrophilicity. By knowing chromatographic profiles of standard GAGs, with which GAG contained in the sample of interest can be compared, the composition of GAGs in the sample can be measured from the integral of the spectral profiles. For electrophoresis, GAG standards are used and GAGs in samples are identified by the migration and quantified by band densitometry, also calibrated using GAG standards. There are some novel electrochemical assays used to detect GAGs, especially heparin/HS, by utilizing the highly anionic charges from the polysulfated groups (160, 161). However, since many other compounds such as proteins or other polysaccharides may interfere with these analyses, such methods must be used in combination with other quantitative methods to ensure reliability. Safranin 0 assay is a chemical method based on the reaction between GAGs and safranin 0 to form precipitates with red-orange color that can be measured densitometrically (162). Modification using cetylpyridinium chloride (CPC) to dissolve the precipitates provides the feasibility of spectrophotometric analysis (163). Safranin 0 assay has advantages over other assays, including good sensitivity to nanogram levels and easy operation (162, 163), thereby finding wide usage for quantification of total GAGs. Other chemical methods targeting to the uronic acid (164) and hexosamine structures (165) in GAGs are also available. The classical borate-sulphuric acid assay is based on the reaction between uronic acid and carbazole and has been used for several decades (164). One primary disadvantage of these chemical methods, however, is the inability to differentiate each GAG. These chemical methods can be combined with enzymatic digestions, in which each GAG is digested by specific lyases, which then provides specificity to the aforementioned chemical methods (61). 26 The specificity of GAG binding proteins or ligands has shown promise in detecting and quantifying GAGs with excellent selectivity and reduced interference. Although many GAG binding proteins have strong cross-reactivity between different GAGs, as mentioned in Section 1.4.3, there are still a number of proteins and ligands that have the potential to be specific GAG detectors. These proteins and ligands with specificity for each GAG can be used in an enzyme-linked immunoabsorbent assay (ELISA) (103, 156, 166) via antigen conjugation, or labeling with fluorescent tags (167, 168). Biotin-labeled HA-specific binding protein derived from aggrecan and link protein (17, 25, 28, 29, 32, 103, 167), HA-specific binding aggrecan (166), recombinant protein engineered from RHAMM that switches to heparin-specific binding protein (7), human interleukin-8 (IL-8) (104), and ATIII (168) as heparin binding proteins have all been reported, or even further clinically employed to measure HA and heparin levels. Taken together, solid-phase assays using proteins and ligands specific to each GAG are being developed with solid promise. 1.6 Chemical modifications of GAGs Chenlical modifications of GAGs increase the ability of GAGs to react with other polymers to construct bio-conjugate compounds and biomaterials for mUltiple functions. 27 Crosslinked biomaterials made from GAGs can immobilize GAGs into a solid-phase to prevent their dissolution and retard their catabolism in vivo. Increasingly, techniques are being developed to create novel chemical modifications of GAGs, reSUlting in new crosslinked GAG biomaterials (5). As a whole, the most common modifications of GAGs are performed on the carboxyl and hydroxyl functionalities. Other modifications include reducing end modification, and amide modification (6). Because of the structural similarity between all GAGs, modification methods for one GAG are often applicable for all GAGs, but probably with variable reaction conditions. 1.6.1 Carboxyl modifications The carboxyl group is an active functionality in GAGs that can be modified by many chemical reagents to introduce desired groups such as ester, N-hydroxyl succinimide-ester (NHS ester), hydrazine, thiol (8, 169-171), aldehyde, amine (5), etc. Basically, carboxyl modification can be classified into esterification (172) and carbodiimide-mediated modification (6). Esterification has been reported via using the reaction of tetra (n-butyl) ammonium salt of HA with a poly-alcohol in dimethylformamide (DMF) solvent, resulting in an insoluble biomaterial, HY AFF®, which was used for controlled release of the steroids hydrocortisone and a-methylprednisolone (173, 174). Another example is HA benzyl ester, which is suitable for fashioning into suitable physical forms for intranasal, buccal, ocular, and vaginal drug delivery, as well as cell substrate for chondrocytes and bone marrow-derived mesenchymal cells in wound healing (6). 28 Carbodiimide-mediated reactions (usually using 1-ethyl-3-[3-( dimethylamino) propyl] carbodiimide (ED C» are generally performed at pH 4.75, at which the carboxylic acid is protonated. The protonation will lead a nucleophilic attack from carbodiimide to the central carbon of carboxylic acid to form O-acylisourea. This intermediate product will rearrange to a stable N-acylurea (175) even with amine added because of the reduced nucleophilicity of most anlines at pH 4.75 to continue coupling with O-acylisourea. However, with the addition of highly nucleophilic reagents at this pH, such as hydrazides, aminooxyls, hydroxylbenzotriazole (HOBt), or NHS that feature low pKa values «4), the intermediate O-acylisourea will be coupled with those agents (6, 8, 175). This coupling can directly add new groups via nucleophilic reagents that bear other functional groups, or introduce new groups by following reactions using intermediate HOBt or NHS esters (5). Two GAGs can be crosslinked by introducing HOBt or NHS esters to one followed by reaction with another GAG functionalized with amine or hydrazide groups. Carbodiimide-mediated modifications have been widely used to introduce new functional groups to GAGs to develop biomaterials for drug delivery and cell culture applications (169-171, 176-182). 1.6.2 Hydroxyl modifications A variety of reactions can happen at hydroxyls of GAGs: 1) sulfation, 2) esterification, 3) isourea coupling, 4) periodate oxidations. Sulfation can be performed using sulfur trioxide-pyridine complex in DMF. Sulfated HA exhibits new features, including resistance to hyaluronidase and remarkable reduction of cellular attachment and bacterial growth (6, 183). Esterification of hydroxyls is reported by coupling HA with 29 butyric anhydride in DMF containing a sym-collidinium salt and dimethylaminopyridine. The product, HA butyrate ester, provides a drug delivery system targeted at tumor cells because of the overexpression of HA binding protein CD44 on these cells and the inhibi tory effect of butyrate toward a number of human tumors (6). Figures 1.3 and 1.4 respectively show the isourea coupling and periodate oxidation of HA to synthesize fluorescent or drug conjugate molecules for potential fluorescence labeling or targeted drug delivery. However, because of the harsh oxidative conditions with these modifications, GAG backbones may be broken and the biocompatibility of GAGs may be compromised (6). This is illustrated by the difference between degraded low molecular weight GAGs and natural ones (see Section 1.3.3). 1.6.3 Reducing end modification Each GAG molecule contains one reducing sugar terminus as a result of hydrolysis or enzymolysis of the glycosyl bonds. Modification of the reducing end of GAGs provides only one attachment point per molecule, which is used to "graft" only one exogenous molecule at the reducing end to control the molar ratio, as well as to preserve the other reactive groups on the GAG backbone for further modifications. Asayama et ai. reported reductive amination of the reducing end of enzymatically hydrolyzed HA using cyanoborohydride (NaBH3CN), followed by the graft of poly (L­lysine) (PLL). The HA-PLL graft polymer was used as a DNA carrier to target sinusoidal endothelial liver cells (184). Eliaz et ai. also used NaBH3CN for the reductive amination of HA oligomers and grafted it to phosphatidylethanolamine lipid to obtain 30 OH BrCN -0 ... -0 0 0,,\ NH -0 0=<,° NH \ drug OH OH 0- NHCOCH3 0- NHCOCH3 0- NHCOCH3 drug-NH2 Figure 1.3. Isourea coupling of hydroxyl groups on HA. Cyanogen bromide (CNBr) activates the coupling by producing a highly reactive isourea intermediate followed by attachment of amine-containing drugs to hydroxyls via the urethane bond. .. OH -0 OH -0 0 OH -0 HN \ peptl' d e 0- NHCOCHa 0- NHCOCH3 0- NHCOCH3 31 Nal04 .. NaCNBHa ... peptide-NH2 Figure 1.4. Period ate oxidations of hydroxyl groups on HA. The intermediate product bisaldehyde is produced from the vicinal hydroxyls on HA, thus such oxidation may not happen to KS. This is the standard method to attach a fluorescent probe to GAGs, or glycoproteins. 32 phosphatidylethanolamine-HA conjugates that were then incorporated into liposomes for targeted drug delivery to tumor cells with CD44 overexpression (185). 1.6.4 Acetamido modification Deacetylation can convert acetamido groups of GAGs into amines. Native GAGs can bear some naturally deacetylated glucosamine or galactosamine units, but the de acetylation degree is seldom determined. During normal modification, such as reducing end modification, a very low number of deacetylated amino-sugar residues can be produced. However, if GAGs undergo a sequential hydrazinolysis method using hydrazine and iodic acid, the nlinimally cleaved GAG backbone will be largely modified with deacetylation. Partially deacetylated GAGs with glucosamine and galactosamine units can be further modified with reactions utilizing the amine groups derived from the removal of N-acetyl functionality (186). 1. 7 GAG crosslinking Crosslinking of GAGs is a common method used to produce solid-phase biomaterials and is based on modifications that introduce crosslinkable functional groups. Two GAG molecules with the appropriately introduced functional groups (often different from each other, such as NHS ester and amine) can be directly crosslinked. However, it is more common to crosslink GAG molecules with the same functional group by adding a crosslinker that contains one corresponding reactive group at each end. Therefore, the length of the crosslinker contributes largely to the crosslinking density and is chosen carefully. It should be noted that some unreacted functionalities on the crosslinkers can be cytotoxic and therefore should be removed or carefully evaluated before using in medical applications. 33 Currently employed GAG crosslinkers include the following: 1) bisepoxide and divinylsulfone, which crosslink hydroxyls of GAGs (187); 2) bis-carbodiimide, which crosslinks carboxyls of GAGs by forming stable N-acrylureas in aqueous isopropanol (6); 3) bis-hydrazide and bis- NHS ester, which crosslink carboxyls of GAGs under EDC condition; 4) poly (ethylene glycol) (PEG)-dialdehyde, or PEG-diacrylate, which crosslink GAGs modified to contain hydrazides (169-171, 188) or thiols (181, 189); 5) residual proteins, which bridge the hydroxyls of GAGs and amino or imino groups of proteins using formaldehyde (190), dimethylurea, dimethylolethyleneurea, ethylene oxide, polyaziridine, or polyisocyanante (191). An example of crosslinked biomaterials formed using residual protein method is Hylan@, a hydrogel or hydrosol product from Biomatrix, Inc. (Ridgefield, NJ). Hylan@ and its derivatives are used to treat joint diseases due to the enhanced rheological properties which prevent chondrocyte injury (6); 6) multicomponent crosslinkers, which are composed of two or more crosslinkers conjugated. For instance, the Ugi four-component reaction utilizes HA plus three crosslinkers: cyclohexyl isocyanide, formaldehyde, and lysine ethyl ester. The two amine groups of lysine connect carboxyls on HA for the crosslinking (192). GAG crosslinking is possible without the use of an added crosslinker. Autocrosslinked polysaccharides (ACP) (193) is accomplished by internal esterification of carboxyl and hydroxyl groups. ACP does not require any exogenously added agents, thereby minimizing the possibility of toxicity. Another example is the disulfide oxidation-based crosslinking seen with thiol-modified GAGs (8). Autocrosslinking can 34 also occur under UV or laser exposure through photo-crosslinking process. GAGs have been modified to introduce methacrylate functionality, which can be photocrosslinked to form stable hydrogels either under argon ion laser exposure (514 run) (194-196) or UV irradiation (197). Other photocrosslinkable modifications on GAGs include cinnamate (198) and ethanouracil (199). Metal cations are also able to facilitate GAG crosslinking due to the electrostatic interactions of carboxylates and cationic metals. Ferric ion has been used to mediate HA crosslinking to produce a reddish hydrogel formulation (Intergel@ (FeHA, LifeCore, Chaska, MN» that was successful to reduce postsurgical adhesions (200). Other chelating metals including copper and zinc are also potential crosslinking agents. Novel crosslinking strategies continue to be developed. Many crosslinking methods for non-GAG polymers have potential to be applied to GAG crosslinking if appropriate functional groups can be introduced through modifications. Radical polymerization, enzyme-catalyzed crosslinking, crystallization, block and graft co­polymers, hydrogen-bond crosslinking, antigen-antibody-based crosslinking, and genetically engineered protein-based crosslinking methods are all being actively studied (201). 1.8 Medical applications of GAGs The excellent biocompatibility and physiochemical properties of GAGs, as well as their versatile interactions with proteins spreading from the ECM to intracellular organelles, have provided numerous potential applications for GAGs. The modifications of GAGs have further expanded their applications for various medical and 35 pharmaceutical areas. In addition, numerous studies are being performed to develop more novel GAG-based therapeutic agents and biomaterials. 1.8.1 Therapeutic agents The rheological properties of HA have made it an ideal candidate to treat bone and joint diseases. Hylan@ and Hyalgan® (Sanofi-Synthelabo, Malvern, PA) are commercially available HA products proven to enhance healing of osteoarthritis (202, 203), although there have been rare cases of inflammation in Hylan® products (204). HA is also widely used for soft tissue augmentation in skin therapy. Representative products include Restylane@ (Medicis Aesthetics Inc., Scottsdale, AZ) and Hyalform® (Inamed Corp., Santa Barbara, CA), both of which have been used to fill and correct facial contour defects (205, 206). There have been, however, reports of Restylane® causing inflammatory nodules that require hyaluronidase treatment (207, 208). Therefore, the safe use of Restylane® is still under debate. Heparin is a well-known anticoagulant therapeutic agent used for a variety of thromboses. Unfractionated heparin (UFH) and low molecular weight heparin (LMWH) are both widely used. Recent studies have shown that LMWH has improved bioavailability over UFH and, thus, may be more commonly used in the future (209-212). Many formulations of LMWH (average molecular weight 3000-7000 (213)) have been developed, including Dalteparin® (Pfizer, New York, NY), Enoxaparin® (also Lovenox®, Sanofi-Aventis, Bridgewater, NJ), Tinzaparin® (Dupont Pharmaceuticals, Wilmington, DE), etc., through the chemical or enzymatic depolymerization of heparin. 36 Furthermore, the studies showing the association of HA, CS, and heparin/HS with human cancer and inflammatory diseases indicate that these GAGs will have potential as biomarkers for clinical diagnoses (17,19,27,30,41). Due to the specific interactions of GAGs with their binding proteins, GAGs may be used as probes for disease prognosis (36, 214). Finally, small molecule HA and heparin are also considered potential anticancer drugs due to their interference with many PI3K or HSPG-mediated cell signaling pathways that are abnormally regulated in cancer (see Section 1.4.2) (34, 35, 39, 100, 146, 151). With such broad applications of GAGs, researchers have started to artificially synthesize low molecular weight compounds to mimic GAGs, adding flexibility for broadened medical applications. Synthetic peptides that mimic HA (215) and heparin (36, 46) have been reported with potential applications in the clinic and laboratory research. 1.8.2 Biomaterials As polymers with good biocompatibility and biodegradability (216), GAGs are useful to construct biomaterials for wound healing, tissue engineering, cell culture, and drug delivery. Numerous investigations have reported on the synthesis of crosslinked GAG biomaterials with additional polymers including liposomes (217), proteins, chitosan (6), and alginate (218) and incorporation of small bioactive molecules for controlled release. Many of these materials show interesting results in cell-based assays and animal studies. GAG biomaterials, such as HY~ mentioned in Section 1.6.1 (173, 174), have been widely used for wound healing and tissue engineering. Epithelial wound healing 37 improved significantly with GAG film and hydrogel application (169-171, 219). In addition, a variety of cells are able to grow healthily in GAG-based biomaterials, which can be further applied to three-dimensional (3-D) cell culture. Stem cell culture in GAG biomaterials provides the possibility for cell proliferation and differentiation, with potential for tissue engineering applications through implantation of cell-containing GAG hydrogels in situ. Recently, novel crosslinking strategies using thiolated GAGs and PEG diacrylate have made it feasible to inject hydrogel component mixtures that gel in minutes to allow in situ gelation, thereby eliminating some laborious surgical implantations (178, 189). Controlled drug delivery can reduce drug catabolism by retarding the release of drug from macromolecule-based biomaterials. A variety of drugs, such as growth factors (218, 220) and mitomycin C (182, 188, 221), have been incorporated into GAG hydro gels or films, resulting in controlled release and extended effective time. By adding other ECM proteins and peptides such as fibronectin, gelatin, RGD peptide, laminin, collagen, and so forth (222), GAG biomaterials can minlic natural ECM for better outcomes in cell culture and tissue engineering, including areas of artificial skin and cartilage reconstruction (174, 177). Because of the ability of HA to target cancer cells due to their increased expression of HA binding proteins, HA-based co-polymers have been synthesized for targeted anticancer drug (doxorubicin, taxol, etc.) delivery (176, 223). In addition, polycationic molecules (poly (L-Iysine), PLL) conjugated with HA can be used to deliver polyanionic DNA to liver sinusoidal endothelial cells (184, 224). 38 Other applications of GAGs include surface immobilization of GAGs for medical device coating, which can yield reduced inflammatory response with increased biocompatibility (225). Immobilized GAGs also have wide applications to construct affinity chromatography for purification and identification of GAG-specific binding proteins (104, 226, 227). 1.9 Summary GAGs are naturally derived polysaccharides distributed on extracelluar matrix, basement membrane, cell surface, and intracellular granules. GAGs can interact with a myriad of proteins and ligands to mediate the comprehensive cell signaling pathways. Because of these properties, extensive studies are being carried out to investigate detection, quantification, chemical modification, and medical application of GAGs. It can be anticipated that novel GAG- and GAG binding protein-based drugs, materials, and techniques will be continuously discovered and developed for biotech, pharmaceutical and medical purposes. 1.10 References 1. Rose, M. J. and Page, C. Glycosaminoglycans and the regulation of allergic inflammation. Curro Drug. Targets Inflamm. Allergy, 3: 221-225, 2005. 39 2. Talyshinsky, M. M., Souprun, Y. Y., and Huleihel, M. M. Anti-viral activity of red micro algal polysaccharides against retroviruses. Cancer Cell Int., 2: 8, 2002. 3. Kolset, S. 0., Prydz, K., and Pejler, G. Intracellular proteoglycans. Biochem. J., 379: 217-227, 2004. 4. Day, A. J. Understanding hyaluronan-protein interactions. Glycoforum, URL: http://www.glycotorum.gr.ip/sciencelhyaluronanlHA16/16E.html. 2001. 5. Bulpitt, P. and Aeschlimann, D. New strategy for chemical modification of hyaluronic acid: preparation of functionalized derivatives and their use in the formation of novel biocompatible hydrogels. J. Biomed. Mater. Res., 47: 152-169, 1999. 6. Prestwich, G. D. Biomaterials from chemically-modified hyaluronan. Glycoforum, URL: http://glycoforum.gr.jp/science/hyaluronan/HA18/HA18E.html, 2001. 7. Cai, S., Dufner-Beattie, 1. L., and Prestwich, G. D. A selective protein sensor for heparin detection. Anal. Biochem., 326: 33-41, 2004. 8. Shu, X. Z., Liu, Y., Roberts, M. C., and Prestwich, G. D. Disulfide cross-linked hyaluronan hydrogels. Biomacromolecules, 3: 1304-1311,2002. 9. Varki, A., Cummings, R., Esko, J., Freeze, H., Hart, G., and Marth, J. (eds.) Essentials of Glycobiology. Plainview, NY: Cold Spring Harbor Laboratory Press, 1999. 10. Holmes, M. W., Bayliss, M. T., and Muir, H. Hyaluronic acid in human articular cartilage. Age-related changes in content and size. Biochem. J., 250: 435-441, 1988. 11. Manicourt, D. H. and Pita, J. C. Quantification and characterization of hyaluronic acid in different topographical areas of normal articular cartilage from dogs. ColI. Relat. Res., 8: 39-47, 1988. 12. Comper, W. D. and Laurent, T. C. Physiological function of connective tissue polysaccharides. Physiol. Rev., 58: 255-315, 1978. 13. Hascall, V. C. and Riolo, R. L. Characteristics of the protein-keratan sulfate core and of keratan sulfate prepared from bovine nasal cartilage proteoglycan. J. BioI. Chern., 247: 4529-4538, 1972. 14. Murata, K. and Yokoyama, Y. Dermatan sulfate isomers in human articular cartilage characterized by high-performance liquid chromatography. Biochem. Int., 15: 87-94, 1987. 40 15. Chen, Q., Lee, J. W., Nishiyama, K., Shadrach, K. G., Rayborn, M. E., and Hollyfield, J. G. SPACRCAN in the interphotoreceptor matrix of the mouse retina: molecular, developmental and promoter analysis. Exp. Eye Res., 76: 1-14, 2003. 16. Danckwardt-Lilliestrom, N., Laurent, C., Hellstrom, S., Friberg, U., Kinnefors, A., and Rask-Anderson, H. Localization of hyaluronan in the human endolymphatic Sac. Acta Otolaryngol., 114: 382-386, 1994. 17. Lokeshwar, V. B., Obek, C., Pham, H. T., Wei, D., Young, M. J., Duncan, R. C., Soloway, M. S., and Block, N. L. Urinary hyaluronic acid and hyaluronidase: markers for bladder cancer detection and evaluation of grade. J. Urol., 163: 348- 356,2000. 18. McHutchison, J. G., Blatt, L. M., Medina, M. D., Craig, J. R., Conrad, A., Schiff, E. R., Tong, M. J., and Group, T. C. I. S. Measurement of serum hyaluronic acid in patients with chronic hepatitis C and its relationship to liver histology. J. Gastroenterol. Hepatol., 15: 945-951, 2000. 19. Thylen, A., Wallin, J., and Martensson, G. Hyaluronan in serum as an indicator of progressive disease in hyaluronan-producing malignant mesothelioma. Cancer Res., 86: 2000-2005, 1999. 20. Evanko, S. P., Parks, W. T., and Wight, T. N. Intracellular hyaluronan in arterial smooth muscle cells: association with microtubules, RHAMM, and the mitotic spindle. J. Histochem. Cytochem., 52: 1525-1535,2004. 21. Matrosova, V. Y., Orlovskaya, I. A., Serobyan, N., and Khaldoyanidi, S. K. Hyaluronic acid facilitates the recovery of hematopoiesis following 5-fluorouracil administration. Stem Cells, 22: 544-555, 2004. 22. Maniwa, S., Ochi, M., Motomura, T., Nishikori, T., Chen, J., and Naora, H. Effects of hyaluronic acid and basic fibroblast growth factor on motility of chondrocytes and synovial cells in culture. Acta Orthop. Scand., 72: 299-303, 2001. 23. Li, H., Guo, L., U, J., Liu, N., Qi, R., and Liu, J. Expression of hyaluronan receptors CD44 and RHAMM in stomach cancers: relevance with tumor progression. Int. J. Oncol., 17: 927-932, 2000. 24. Rao, C. M., Salotra, P., and Datta, K. Possible role of the 34-kilodalton hyaluronic acid-binding protein in visceral Leishmaniasis. 1. Parasitol., 85: 682-687, 1999. 41 25. Shibutani, T., Imai, K., Kanazawa, A., and Iwayama, Y. Use of hyaluronic acid binding protein for detection of hyaluronan in ligature-induced periodontitis tissue. J. Periodont. Res., 33: 265-273, 1998. 26. Toole, B. P., Wight, T. N., and Tammi, M. I. Hyaluronan-cell interactions in cancer and vascular disease. J. BioI. Chern., 277: 4593-4596, 2001. 27. LLaneza, A., Vizoso, F., Rodriguez, J. C., Raigoso, P., Garcia-Muniz, J. L., Allende, M. T., and Garcia-Moran, M. Hyaluronic acid as prognostic marker in resectable colorectal cancer. Br. J. Surg., 87: 1690-1696, 2000. 28. Setala, L. P., Tammi, M. I., Tammi, R. H., Eskelinen, M. J., Lipponen, P. K., Agren, U. M., Parkkinen, J. J., Alhava, E. M., and Kosma, V. M. Hyaluronan expression in gastric cancer cells is associated with local and nodal spread and reduced survival rate. Br. J. Cancer, 79: 1133-1138, 1999. 29. Pirinen, R., Tammi, R., Tammi, M., Hirviroski, P., Parkkinen, J. J., Johansson, R., Bohm, J., Hollmen, S., and Kosma, V. M. Prognostic value of hyaluronan expression in non-small-celliung cancer: increased stromal expression indicates unfavorable outcome in patients with adenocarcinoma. Int. J. Cancer, 95: 12-17, 2001. 30. Lokeshwar, V. B., Rubinowicz, D., Schroeder, G. L., Forgacs, E., Minna, J. D., Block, N. L., Nadji, M., and Lokeshwar, B. L. Stromal and epithelial expression of tumor markers hyaluronic acid and HYAL1 hyaluronidase in prostate cancer. J. BioI. Chern., 276: 11922-11932,2001. 31. Karvinen, S., Kosma, V. M., Tammi, M. I., and TAmmi, R. Hyaluronan, CD44 and versican in epidermal keratinocyte tumours. Br. J. DermatoI., 148: 86-94, 2003. 32. Anttila, M. A., Tammi, R. H., Tammi,M. J., Syrjanen, K. J., Saarikoski, S. V., and Kosma, V. M. High levels of stromal hyaluronan predict poor disease outcome in epithelial ovarian cancer. Cancer Res., 60: 150-155, 2001. 33. Andresen, D. M., Barker, J. H., and Hjortdal, V. E. Local heparin is superior to systemic heparin in preventing arterial thrombosis. Microsurgery, 22: 265-272, 2002. 34. Dowsland, M. H., Harvey, J. R., Lennard, T. W. J., Kirby, J. A., and Ali, S. Chemokines and breast cancer: a gateway to revolutionary targeted cancer treatments? Curro Med. Chern., 10: 579-592, 2003. 42 35. Smorenburg, S. M. and Noorden, C. J. F. V. The complex effects of heparins on cancer progression and metastasis in experimental studies. Pharmacol. Rev., 53: 93-105,2001. 36. Freeman, C., Liu, L., Banwell, M. G., Brown, K. J., Bezos, A., Ferro, V., and Parish, C. R. Use of sulfated linked cyclitols as heparan sulfate mime tics to probe the heparin!heparan sulfate binding specificity of proteins. J. BioI. Chern., 280: 8842-8849, 2005. 37. Ishihara, M. Growth factors and heparan sulfate. GlycoForum, URL: http://www.glycoforum.gr.jp/science/word/proteoglycan/PGAOlE.htInl, 1997. 38. Liu, J. and Thorp, S. C. Cell surface heparan sulfate and its roles in assisting viral infections. Med. Res. Rev., 22: 1-25, 2002. 39. Belting, M. Heparan sulfate proteoglycan as a plasma membrane carrier. Trends Biochem. Sci., 28: 145-151,2003. 40. Floris, S., van den Born, J., van der Pol, S. M. A., Dijkstra, C. D., and de Vries, H. E. Heparan sulfate proteoglycans modulate monocyte migration across cerebral endothelium. J. Neuropathol. Exp. Neurol., 62: 780-790, 2003. 41. Giannobile, W. V., AI-Shammari, K. F., and Sarment, D. P. Matrix molecules and growth factors as indicators of periodontal disease activity. Periodontol. 2000, 31: 125-134, 2003. 42. Umehara, Y., Yamada, S., Nishimura, S., Shioi, J., Robakis, N. K., and Sugahara, K. Chondroitin sulfate of appican, the proteoglycan form of amyloid precursor protein, produced by C6 glioma cells interacts with heparin-binding neuroregulatory factors. FEBS Lett., 557: 233-238, 2004. 43. Bjelle, A. Content and composition of glycosaminoglycans in human knee joint cartilage. Variation with site and age in adults. Connect. Tissue Res., 3: 141-147, 1975. 44. Nieduszynski, 1. A., Huckerby, T. N., Dickenson, J. M., Brown, G. M., Tai, G. H., Morris, H. G., and Eady, S. There are two major types of skeletal keratan sulphates. Biochem. J., 271: 243-245, 1990. 45. Sasisekharan, R. and Venkataraman, G. Heparin and heparan sulfate: biosynthesis, structure and function. Curro Opin. Chem. BioI., 4: 626-631,2000. 46. Unhardt, R. J. Heparin: structure and activity. J. Med. Chem., 46: 2551-2564, 2003. 47. Habuchi, H., Habuchi, 0., and Kimata, K. Biosynthesis of heparan sulfate and heparin: How are the multifuncational glycosaminoglycans built up? Trends Glycosci. GlycotechnoI., 10: 65-80, 1998. 48. Pedersen, L. C., Tsuchida, K., Kitagawa, H., Sugahara, K., Darden, T. A., and Negishi, M. Heparan/chondroitin sulfate biosynthesis. 1. BioI. Chem., 275: 34580-34585,2000. 43 49. DeLuca, S., Richmond, M. E., and Silbert, J. E. Biosynthesis of chondroitin sulfate. Sulfation of the polysaccharide chain. Biochemistry, 12: 3911-3915, 1973. 50. McCormick, C., Duncan, G., Goutsos, K. T., and Tufaro, F. The putative tumor suppressors EXT1 and EXT2 form a stable complex that accumulates in the Goigi apparatus and catalyzes the synthesis of heparan sulfate. Proc. Nati. Acad. Sci. USA, 97: 668-673, 2000. 51. Otsu, K., Inoue, H., Tsuzuki, Y., Yonekura, H., Nakanishi, Y., and Suzuki, S. A distinct terminal structure in newly synthesized chondroitin sulphate chains. Biochem. J., 227: 37-48,1985. 52. Midura, R. J., Calabro, A., Yanagishita, M., and Hascall, V. C. Nonreducing end structures of chondroitin sulfate chains on aggrecan isolated from Swarm rat chondrosarcoma cultures. J. BioI. Chern., 270: 8009-8015, 1995. 53. Prehm, P. Hyaluronate is synthesized at plasma membranes. Biochem. J., 220: 597-600, 1984. 54. Tammi, M.I., Day, A. 1., and Turley, E. A. Hyaluronan and homeostasis: a balancing act. J. BioI. Chern., 277: 4581-4584, 2002. 55. DeAngelis, P. L. Hyaluronan synthases: fascinating glycosyltransferases from vertebrates, bacterial pathogens, and algal viruses. Cell Mol. Life Sci., 56: 670- 682, 1999. 56. Spicer, A. P. and McDonald, J. A. Eukaryotic hyaluronan synthases. Glycoforum, URL: http://www.glycoforum.gr.jp/science/hyaluronanJHA07 /HA07E.html, 2001. 57. Tirone, E., D'Alessandris, C., Hascall, V. C., Siracusa, G., and Salustri, A. Hyaluronan synthesis by mouse cumulus cells is regulated by interactions between follicle-stimulating hormone (or epidermal growth factor) and a soluble oocyte factor (or transforming growth factor beta1). J. BioI. Chern., 272: 4787- 4794, 1997. 58. Syrokou, A., Tzanakakis, G. N., Hjerpe, A., and Karamanos, N. K. Proteoglycans in human malignant mesothelioma. Stimulation of their synthesis induced by epidermal, insulin and platelet-derived growth factors involves receptors with tyrosine kinase activity. Biochimie, 81: 733-744, 1999. 44 59. TIapak-Simmons, V. L., Baron, C. A., Gotschall, R., Haque, D., Canfield, W. M., and Weigel, P. H. Hyaluronan biosynthesis by the Class I Streptococcal hyaluronan synthases occurs at the reducing end. J. BioI. Chern., 280: 13012- 13018, 2005. 60. Kleinman, H. K., McGarvey, M. L., Liotta, L. A., Robey, P. G., Tryggvason, K., and Martin, G. R. Isolation and characterization of type IV procollagen, laminin, and heparan sulfate proteoglycan from the EHS sarcoma. Biochemistry, 21: 6188- 6193, 1982. 6l. Mitropoulou, T. N., Theocharis, A. D., Stagiannis, K. D., and Karamanos, N. K. Identification, quantification and fine structural characterization of glycosaminoglycans from uterine leiomyoma and normal myometrium. Biochimie, 83: 529-536, 200l. 62. Eriksen, G. V., Carlstedt, 1., Morgelin, M., Uldbjerg, N., and Malmstrom, A. Isolation and characterization of proteoglycans from human follicular fluid. Biochem. J., 340 (Pt 3): 613-620, 1999. 63. Carlson, D. M. Oligosaccharides isolated from pig submaxillary mucin. J. BioI. Chern., 241: 2984-2986, 1966. 64. Chevanne, M., Caldini, R., Manao, G., Ruggiero, M., and Vannucchi, S. Heparin binding peptides co-purify with glycosaminoglycans from human plasma. FEBS Lett., 463: 121-124, 1999. 65. Ruggiero, M., Melli, M., Parma, B., Bianchini, P., and Vannucchi, S. Isolation of endogenous anticoagulant N-sulfated glycosaminoglycans in human plasma from healthy subjects. PathophysioI. Haemost. Thromb., 32: 44-49, 2002. 66. Schick, B. P., Walsh, C. J., and Jenkins-West, T. Sulfated proteoglycans and sulfated proteins in guinea pig megakaryocytes and platelets in vivo. Relevance to megakaryocyte maturation and platelet activation. J. BioI. Chern., 263: 1052-1062, 1988. 67. Vercruysse, K. P., Li, H., Luo, Y., and Prestwich, G. D. Thermosensitive lanthanide complexes of hyaluronan. Biomacromolecules, 3: 639-643, 2002. 68. Suzuki, S. Microbial hyaluronan lyases. Glycoforum, URL: http://www.glycoforum.gr.jp/science/hyaluronanJHA14IHA 14E.html, 200l. 45 69. Rye, C. S. and Withers, S. G. Synthesis and evaluation of potential inhibitors of chondroitin AC lyase from Flavobacterium heparinum. J. Org. Chern., 67: 4505- 4512,2002. 70. Huang, W., Matte, A., Li, Y., Kim, Y. S., Linhardt, R. J., Su, H., and Cygler, M. Crystal structure of chondroitinase B from Flavobacterium heparinum and its complex with a disaccharide product at 1.7 A resolution. J. Mol. BioI., 294: 1257- 1269, 1999. 71. Meyer, K., Hoffman, P., and Linker, A. Hyaluronidases. In: The Enzymes, 2nd ed, pp.447-460, 1960. 72. Kelly, S. J., Taylor, K. B., Li, S., and Jedrzejas, M. J. Kinetic properties of Streptococcus pneumoniae hyaluronate lyase. Glycobiology, 11: 297-304, 2001. 73. Linker, A., Meyer, K., and Hoffman, P. The production of hyaluronate oligosaccharides by leech hyaluronidase and alkali. J. BioI. Chern., 235: 924-927, 1960. 74. Ohya, T. and Kaneko, Y. Novel hyaluronidase from streptomyces. Biochim. Biophys. Acta, 198: 607-609, 1970. 75. Tam, Y. C. and Chan, E. C. Purification and characterization of hyaluronidase from oral Peptostreptococcus species. Infect. Immun., 47: 508-513, 1985. 76. Hiyama, K. and Okada, S. Crystallization and some properties of chondroitinase from Arthrobacter aurescens. J. BioI. Chern., 250: 1824-1828, 1975. 77. Jedrzejas, M. J. and Chantalat, L. Structural studies of streptococcus agalactiae hyaluronate lyase. Acta Crystallogr. D BioI. Crystallogr., 56 ( Pt 4): 460-463, 2000. 78. Li, S. and Jedrzejas, M. J. Hyaluronan binding and degradation by Streptococcus agalactiae hyaluronate lyase. J. BioI. Chern., 276: 41407-41416, 2001. 79. Li, S., Kelly, S. J., Lamani, E., Ferraroni, M., and Jedrzejas, M. J. Structural basis of hyaluronan degradation by Streptococcus pneumoniae hyaluronate lyase. Embo J.,19: 1228-1240,2000. 80. Mello, L. V., De Groot, B. L., Li, S., and Jedrzejas, M. J. Structure and flexibility of Streptococcus agalactiae hyaluronate lyase complex with its substrate. Insights into the mechanism of processive degradation of hyaluronan. J. BioI. Chern., 277: 36678-36688, 2002. 81. Ponnuraj, K. and Jedrzejas, M. J. Mechanism of hyaluronan binding and degradation: structure of Streptococcus pneumoniae hyaluronate lyase in complex 46 with hyaluronic acid disaccharide at 1.7 A resolution. J. Mol. BioI., 299: 885-895, 2000. . 82. Jedrzejas, M. J., Mello, L. V., de Groot, B. L., and Li, S. Mechanism of hyaluronan degradation by Streptococcus pneumoniae hyaluronate lyase. Structures of complexes with the substrate. J. BioI. Chern., 277: 28287-28297, 2002. 83. Linhardt, R. J., Turnbull, J. E., Wang, H. M., Loganathan, D., and Gallagher, J. T. Examination of the substrate specificity of heparin and heparan sulfate I yases. Biochemistry, 29: 2611-2617, 1990. 84. Lohse, D. L. and Linhardt, R. J. Purification and characterization of heparin lyases from Flavobacterium heparinum. J. BioI. Chern., 267: 24347-24355,1992. 85. Yang, V. C., Linhardt, R. J., Bernstein, H., Cooney, C. L., and Langer, R. Purification and characterization of heparinase from Flavobacterium heparinum. J. BioI. Chem., 260: 1849-1857, 1985. 86. Pojasek, K., Shriver, Z., Kiley, P., Venkataraman, G., and Sasisekharan, R. Recombinant expression, purification, and kinetic characterization of chondroitinase AC and chondroitinase B from Flavobacterium heparinum. Biochem. Biophys. Res. Commun., 286: 343-351, 2001. 87. Ototani, N. and Yosizawa, Z. Purification of chondroitinase Band chondroitinase C using glycosaminoglycan-bound AH-Sepharose 4B. Carbohydr. Res., 70: 295- 306, 1979. 88. Nakazawa, K. [Keratanase from Pseudomonas Spa and sulfatases from Actinobacillus sp]. Tanpakushitsu Kakusan Koso, 30: 40-44, 1985. 89. Roden, L., Campbell, P., Fraser, J. R., Laurent, T. C., Pertofi, H., and Thompson, J. N. Enzymic pathways ofhyaluronan catabolism. Ciba Found. Symp., 143: 60- 76; discussion 76-86,281-285, 1989. 90. Tammi, R., Rilla, K., Pienimaki, J. P., MacCallum, D. K., Hogg, M., Luukkonen, M., Hascall, V. C., and Tammi, M. Hyaluronan enters keratinocytes by a novel endocytic route for catabolism. J. BioI. Chem., 276: 35111-35122, 2001. 91. Stern, R. Hyaluronan catabolism: a new metabolic pathway. Eur. J. Cell BioI., 83: 317-325, 2004. 92. Laurent, U. B., Dahl, L. B., and Reed, R. K. Catabolism of hyaluronan in rabbit skin takes place locally, in lymph nodes and liver. Exp. Physiol., 76: 695-703, 1991. 93. Fraser, J. R., Laurent, T. C., and Laurent, U. B. Hyaluronan: its nature, distribution, functions and turnover. J. Intern. Med., 242: 27-33, 1997. 94. Smedsrod, B., Kjellen, L., and Pertoft, H. Endocytosis and degradation of chondroitin sulphate by liver endothelial cells. Biochem. J., 229: 63-71, 1985. 47 95. Laurent, U. B., Fraser, J. R., Engstrom-Laurent, A., Reed, R. K., Dahl, L. B., and Laurent, T. C. Catabolism of hyaluronan in the knee joint of the rabbit. Matrix, 12: 130-136, 1992. 96. Turley, E. A., Noble, P. W., and Bourguignon, L. Y. Signaling properties of hyaluronan receptors. J. BioI. Chem., 277: 4589-4592, 2002. 97. Tempel, C., Gilead, A., and Neeman, M. Hyaluronic acid as an anti-angiogenic shield in the preovulatory rat follicle. BioI. Reprod., 63: 134-140,2000. 98. West, D. C. and Kumar, S. Hyaluronan and angiogenesis. Ciba Found. Symp., 143: 187-201; discussion 201-207, 281 .. 285, 1989. 99. Liu, N., Gao, F., Han, Z., Xu, X., Underhill, C. B., and Zhang, L. Hyaluronan synthase 3 overexpression promotes the growth of TSU prostate cancer cells. Cancer Res., 61: 5207-5214, 2001. 100. Ghatak, S., Misra, S., and Toole, B. P. Hyaluronan oligosaccharides inhibit anchorage-independent growth of tumor cells by suppressing the phosphoinositide 3-kinase/Akt cell survival pathway. J. BioI. Chem., 277: 38013-38020, 2002. 101. Zeng, C., Toole, B. P., Kinney, S. D., Kuo, J. W., and Stamenkovic, 1. Inhibition of tumor growth in vivo by hyaluronan oligomers. Int. J. Cancer., 77: 396-401, 1998. 102. Lesley, J., Hascall, V. C., Tammi, M., and Hyman, R. Hyaluronan binding by cell surface CD44. J. BioI. Chern., 275: 26967-26975, 2000. 103. Maeda, H., Fujita, H., Sakura, Y., Miyazaki, K., and Goto, M. A competitive enzyme-linked immunosorbent assay-like method for the measurement of urinary hyaluronan. Biosci. Biotechnoi. Biochem., 63: 892-895, 1999. 104. Mahoney, D. J., Whittle, J. D., Milner, C. M., Clark, S. J., Mulloy, B., Buttle, D. J., Jones, G. C., Day, A. J., and Short, R. D. A method for the non-covalent immobilization of heparin to surface. Anal. Biochem., 330: 123-129, 2004. 105. Kreuger, J., Salmivirta, M., Sturiale, L., Gimenez-Gallego, G., and Lindahl, U. Sequence analysis of heparan sulfate epitopes with graded affinities for fibroblast growth factors 1 and 2. J. BioI. Chem., 276: 30744-30752, 2001. 48 106. Day, A. J. and Prestwich, G. D. Hyaluronan-binding proteins: tying up the giant. J. BioI. Chern., 277: 4585-4588, 2001. 107. Kohda, D., Morton, C. J., Parkar, A. A., Hatanaka, H., Inagaki, F. M., Campbell, I. D., and Day, A. J. Solution structure of the link module: a hyaluronan-binding domain involved in extracellular matrix stability and cell migration. Cell, 86: 767- 775, 1996. 108. Peach, R. J., Hollenbaugh, D., Stamenkovic, I., and Aruffo, A. Identification of hyaluronic acid binding sites in the extracellular domain of CD44. J. Cell BioI., 122: 257-264, 1993. 109. Banerji, S., Day, A. J., Kahmann, J. D., and Jackson, D. G. Characterization of a functional hyaluronan-binding domain from the human CD44 molecule expressed in Escherichia coli. Protein Expr. Purif., 14: 371-381, 1998. 110. Teriete, P., Banerji, S., Noble, M., Blundell, C. D., Wright, A. J., Pickford, A. R., Lowe, E., Mahoney, D. J., Tammi, M. I., Kahmann, J. D., Campbell, I. D., Day, A. J., and Jackson, D. G. Structure of the regulatory hyaluronan binding domain in the inflammatory leukocyte homing receptor CD44. Mol. Cell, 13: 483-496, 2004. 111. Watanabe, H., Cheung, S. C., Hano, N., Kimata, K., and Yamada, Y. Identification of hyaluronan-binding domains of aggrecan. J. BioI. Chern., 272: 28057-28065, 1997. 112. Grover, J. and Roughley, P. J. The expression of functional link protein in a haculovirus system: analysis of mutants lacking the A, Band B' domains. Biochem. J., 300 ( Pt 2): 317-324, 1994. 113. Kalunann, J. D., O'Brien, R., Werner, J. M., Heinegard, D., Ladbury, J. E., Campbell, I. D., and Day, A. J. Localization and characterization of the hyaluronan-binding site on the link module from human TSG-6. Structure Fold. Des., 8: 763-774, 2000. 114. Bajorath, J., Greenfield, B., Munro, S. B., Day, A. J., and Aruffo, A. Identification of CD44 residues important for hyaluronan binding and delineation of the binding site. J. BioI. Chern., 273: 338-343, 1998. 115. Yang, B., Zhang, L., and Turley, E. A. Identification of two hyaluronan-binding domains in the hyaluronan receptor RHAMM. J. BioI. Chern., 268: 8617-8623, 1993. 116. Yang, B. H., Yang, B. L., Savani, R. C., and Turley, E. A. Identification of a common hyaluronan binding motif in the hyaluronan binding proteins RHAMM, CD44 and link protein. EMBO J., 13: 286-296, 1994. 49 117. Acharya, S., Rodriguez, I. R., Moreira, E. F., Midura, R. J., Misono, K., Todres, E., and Hollyfield, J. G. SPACR, a novel interphotoreceptor matrix glycoprotein in human retina that interacts with hyaluronan. J. BioI. Chern., 273: 31599-31606, 1998. 118. Acharya, S., Foletta, V. C., Lee, J. W., Rayborn, M. E., Rodriguez, I. R., Young, W. S., 3rd, and Hollyfield, J. G. SPACRCAN, a novel human interphotoreceptor matrix hyaluronan-binding proteoglycan synthesized by photoreceptors and pinealocytes. J. BioI. Chern., 275: 6945-6955, 2000. 119. Nishina, H., Inageda, K., Takahashi, K., Hoshino, S., Ikeda, K., and Katada, T. Cell surface antigen CD38 identified as ecto-enzyme of NAD glycohydrolase has hyaluronate-binding activity. Biochem. Biophys. Res. Commun., 203: 1318-1323, 1994. 120. Grammatikakis, N., Grammatikakis, A., Yoneda, M., Yu, Q., Banerjee, S. D., and Toole, B. P. A novel glycosaminoglycan-binding protein is the vertebrate homologue of the cell cycle control protein, Cdc37. J. BioI. Chern., 270: 16198- 16205, 1995. 121. Huang, L., Grammatikakis, N., Yoneda, M., Banerjee, S. D., and Toole, B. P. Molecular characterization of a novel intracellular hyaluronan-binding protein. J. BioI. Chem., 275: 29829-29839, 2000. 122. Bourguignon, L. Y., Zhu, H., Chu, A., Iida, N., Zhang, L., and Hung, M. C. Interaction between the adhesion receptor, CD44, and the oncogene product, p185HER2, promotes human ovarian tumor cell activation. J. BioI. Chern., 272: 27913-27918, 1997. 123. Bourguignon, L. Y., Zhu, H., Shao, L., and Chen, Y. W. CD44 interaction with c­Src kinase promotes cortactin-mediated cytoskeleton function and hyaluronic acid-dependent ovarian tumor cell migration. J. BioI. Chern., 276: 7327-7336, 2001. 124. Fujita, Y., Kitagawa, M., Nakamura, S., Azuma, K., Ishii, G., Higashi, M., Kishi, H., Hiwasa, T., Koda, K., Nakajima, N., and Harigaya, K. CD44 signaling through focal adhesion kinase and its anti-apoptotic effect. FEBS Lett., 528: 101- 108,2002. 125. Oliferenko, S., Kaverina, 1., Small, J. V., and Huber, L. A. Hyaluronic acid (HA) binding to CD44 activates Rac1 and induces lamellipodia outgrowth. J. Cell BioI., 148:1159-1164,2000. 126. Hall, C. L., Lange, L. A., Prober, D. A., Zhang, S., and Turley, E. A. pp60 (c-src) is required for cell locomotion regulated by the hyaluronanreceptor RHAMM. Oncogene, 13: 2213-2224, 1996. 127. Lokeshwar, V. B. and Selzer, M. G. Differences in hyaluronic acid-mediated functions and signaling in arterial, microvessel, and vein-derived human endothelial cells. J. BioI. Chern., 275: 27641-27649, 2000. 128. Hall, C. L., Collis, L. A., Bo, A. J., Lange, L., McNicol, A., Gerrard, J. M., and Turley, E. A. Fibroblasts require protein kinase C activation to respond to hyaluronan with increased locomotion. Matrix BioI., 20: 183-192, 2001. 129. Turley, E. A. and Harrison, R. RHAMM, a member of the hyaladherins. Glycoforum, URL: http://www.glycoforum.gr.ip/sciencelhyaluronanlHAllllIE.html. 2001. 130. Prevo, R., Banerji, S., Ferguson, D. J., Clasper, S., and Jackson, D. G. Mouse LYVE-1 is an endocytic receptor for hyaluronan in lymphatic endothelium. J. BioI. Chern., 276: 19420-19430,2001. 50 131. Courel, M. N., Maingonnat, C., Tranchepain, F., Deschrevel, B., Vincent, J. C., Bertrand, P., and Delpech, B. Importance of hyaluronan length in a hyaladherin­based assay for hyaluronan. Anal. Biochem., 302: 285-290, 2002. 132. Cichy, J. and Pure, E. Cytokines regulate the affinity of soluble CD44 for hyaluronan. FEBS Lett., 556: 69-74, 2004. 133. Zhu, G., Mallery, S. R., and Schwendeman, S. P. Stabilization of proteins encapsulated in injectable poly (lactide-co-glycolide). Nat. Biotechnol., 18: 52-57, 2000. 134. Montgomery, E., Abraham, S. C., Fisher, C., Deasel, M. R., Ann, S. S., Sheikh, S. S., House, M., Lilliemoe, K., Choti, M., Borck, M., Ephron, D. T., Zahuruk, M., and Chadburn, A. CD44 loss in gastric stromal tumors as a prognostic marker. Am. J. Surg. Pathol., 28: 168-177, 2004. 135. Muramaki, M., Miyake, H., Kamidono, S., and Rara, I. Overexpression of CD44V8-10 in human bladder cancer cells decreases their interaction with hyaluronic acid and potentiates their malignant progression. J. Urol., 171: 426- 430,2004. 136. Yue, S. Q., Yang, Y. L., DOli, K. F., and Li, K. Z. Expression ofPCNA and CD44mRNA in colorectal cancer with venous invasion and its relationship to liver metastasis. World J. Gastroenterol., 9: 2863-2865, 2003. 137. Desai, U. R. Heparins. URL: http://www.people.vcu.edul---urdesailhep.htm#Structure%20- %20Activity%20Relationship, 2000. 51 138. Loo, B. M. and Salmivirta, M. Heparin/heparan sulfate domains in binding and signaling of fibroblast growth factor 8b. J. BioI. Chern., 277: 32616-32623, 2002. 139. Delehedde, M., Lyon, M., Gallagher, J. T., Rudland, P. S., and Fernig, D. G. Fibroblast growth factor-2 binds to small heparin-derived oligosaccharides and stimulates a sustained phosphorylation of p42/44 mitogen-activated protein kinase and proliferation of rat mammary fibroblasts. Biochem. J., 366: 235-244, 2002. 140. Delehedde, M., Lyon, M., Vidyasagar, R., McDonnell, T. J., and Femig, D. G. Hepatocyte growth factor/scatter factor binds to small heparin-derived oligosaccharides and stimulates the proliferation of human HaCaT keratinocytes. J. BioI. Chern., 277: 12456-12462, 2002. 141. Hileman, R. E., Fromm, J. R., Weiler, J. M., and Linhardt, R. J. Glycosaminoglycan-protein interactions: definition of consensus sites in glycosaminoglycan binding proteins. Bioessays, 20: 156-167, 1998. 142. Fath, M. A., Wu, X., Hileman, R. E., Linhardt, R. J., Kashem, M. A., Nelson, R. M., Wright, C. D., and Abraham, W. M. Interaction of secretory leukocyte protease inhibitor with heparin inhibits proteases involved in asthma. J. BioI. Chem.,273: 13563-13569, 1998. 143. Hileman, R. E., Jennings, R. N., and Linhardt, R. J. Thermodynamic analysis of the heparin interaction with a basic cyclic peptide using isothermal titration calorimetry. Biochemistry, 37: 15231-15237, 1998. 144. Jairajpuri, M. A., Lu, A., Desai, U., Olson, S. T., Bjork, I., and Bock, S. C. Antithrombin III phenylalanines 122 and 121 contribute to its high affinity for heparin and its conformational activation. J. BioI. Chern., 276: 15941-15950, 2003. 145. Klein, D. E., Nappi, V. M., Reeves, G. T., Shvartsman, S. Y., and Lemmon, M. A. Argos inhibits epidermal growth factor receptor signalling by ligand sequestration. Nature,430: 1040-1044, 2004. 146. Holash, J., Davis, S., Papadopoulos, N., Croll, S. D., Ho, L., Russell, M., Boland, P., Leidich, R., Hylton, D., Burova, E., Loffe, E., Huang, T., Radziejewski, C., Bailey, K., Fandi, J. P., Daly, T., Wiegand, S. J., Yancopoulos, O. D., and Rudge, J. S. VEGF-Trap: A VEGF blocker with potent antitumor effects. Proc. Nati. Acad. Sci. USA, 99: 11393-11398,2002. 147. Quinsey, N. S., Whisstock, J. C., Le Bonniec, B., Louvain, V., Bottomley, S. P., and Pike, R. N. Molecular determinants of the mechanism underlying acceleration of the interaction between antithrombin and factor Xa by heparin pentasaccharide. J. BioI. Chern., 277: 15971-15978, 2002. 52 148. Bernardini, N., Cupisti, A., Mattii, L., Segnani, C., Dolf, A., Barsotti, M., and Barsotti, G. Effect of heparan sulphate on kidney tissue expression of TOF-beta, rhoA, laminin and fibronectin in subtotally nephrectomized rats. J. Nephrol., 15: 530-538, 2002. 149. Innis, C. A. and Hyvonen, M. Crystal structures of the heparan sulfate-binding domain of follistatin. Insights into ligand binding. J. BioI. Chern., 278: 39969- 39977,2003. 150. Boilard, E., Bourgoin, S. G., Bernatchez, C., Poubelle, P. E., and Surette, M. E. Interaction of low molecular weight group IIA phospholipase A2 with apoptotic human T cells: role of hepar an sulfate proteoglycans. FASEB J., 17: 1068-1080, 2003. 151. Belting, M., Mani, K., Jonsson, M., Cheng, P., Sandgren, S., Jonsson, S., Ding, K., Delcros, J. G., and Fransson, L. A. Glypican-1 is a vehicle for polyamine uptake in mammalian cells: a pivital role for nitrosothiol-derived nitric oxide. J. BioI. Chem., 278: 47181-47189, 2003. 152. Yang, B., Hall, C. L., Yang, B. L., Savani, R. C., and Turley, E. A. Identification of a novel heparin binding domain in RHAMM and evidence that it modifies HA mediated locomotion of ras-transformed cells. J. Cell Biochem., 56: 455-468, 1994. 153. Marchetti, M., Trybala, E., Superti, F., Johansson, M., and Bergstrom, T. Inhibition of herpes simplex virus infection by lactoferrin is dependent on interference with the virus binding to glycosaminoglycans. Virology, 318: 405- 413,2004. 154. Zou, P., Zou, K., Muramatsu, H., Ichihara-Tanaka, K., Habuchi, 0., Ohtake, S., Ikematsu, S., Sakuma, S., and Muramatsu, T. Glycosaminoglycan structures required for strong binding to midkine, a heparin-binding growth factor. Glycobiology, 13: 35-42, 2003. 155. Heinegard, D., Paulsson, M., Inerot, S., and Carlstrom, C. A novel low-molecular weight chondroitin sulphate proteoglycan isolated from cartilage. Biochem. J., 197: 355-366, 1981. 156. Mahoney, D. J., Aplin, R. T., Calabro, A., Hascall, V. C., and Day, A. J. Novel methods for the preparation and characterization of hyaluronan oligosaccharides of defined length. Glycobiology, 11: 1025-1033,2001. 157. Volpi, N. and Maccari, F. Detection of submicrogram quantities of glycosaminoglycans on agarose gels by sequential staining with toluidine blue and Stains-All. Electrophoresis, 23: 4060-4066, 2002. 53 158. Mao, W., Thanawiroon, C., and Linhardt, R. J. Analysis of glycosaminoglycans and glycosaminoglycan-derived oligo saccharides by polyacrylamide gel electrophoresis. In: N. Volpi (ed.), Analytical Techniques to Evaluate the Structure and Function of Natural Polysaccharides, Glycosaminoglycans, pp. 53- 78. Kerala, India: Research Signpost, 2002. 159. Mao, W., Thanawiroon, C., and Linhardt, R. J. Capillary electrophoresis for the analysis of glycosaminoglycans and glycosaminoglycan-derived oligosaccharides. Biomed. Chromatogr., 16: 77-94, 2002. 160. Gadzekpo, V. P. Y., Buhlmann, P., Xiao, K. P., Aoki, H., and Umezawa, Y. Development of an ion-channel sensor for heparin detection. Anal. Chim. Acta, 411: 163-173,2000. 161. Qin, W., Zhang, W., Xiao, K. P., and Meyerhoff, M. E. Enhanced sensitivity electrochemical assay of low-molecular-weight-heparins using rotating polyion­sensitive membrane electrodes. Anal. Bioanal. Chern., 5: 929-936, 2003. 162. Lammi, M. and Tammi, M. Densitometric assay of nanogram quantities of proteoglycans precipitated on nitrocellulose membrane with Safranin O. Anal. Biochem., 168: 352-357, 1988. 163. Carrino, D. A., Arias, 1. L., and Caplan, A. I. A spectrophotometric modification of a sensitive densitometric safranin 0 assay for glycosaminoglycans. Biochem. Int., 24: 485-495, 1991. 164. Bitter, T. and Muir, H. M. A modified uronic acid carbazole reaction. Anal. Biochem., 4: 330-334, 1962. 165. Bosworth, T. R. and Scott, J. E. A specific fluorometric assay for hexosamines in glycosaminoglycans, based on deaminative cleavage with nitrous acid. Anal. Biochem., 223: 266-273, 1994. 166. Grigoreas, G. H., Anagnostides, S. T., and Vynios, D. H. A solid-phase assay for the quantitative analysis of hyaluronic acid at the nanogram level. Anal. Biochem., 320: 179-184, 2003. 167. Martins, J. R., Passerotti, C. C., Maciel, R. M., Sampaio, L. 0., Dietrich, C. P., and Nader, H. B. Practical determination of hyaluronan by a new noncompetitive fluorescence-based assay on serum of normal and cirrhotic patients. Anal. Biochem., 319: 65-72, 2003. 168. Zhong, Z. and Anslyn, E. V. A colormeric sensing ensemble for heparin. J. Am. Chern. Soc., 124: 9014-9015, 2002. 54 169. Luo, Y., Kirker, K. R., and Prestwich, G. D. Cross-linked hyaluronic acid hydrogel films: new biomaterials for drug delivery. J. Control. Release, 69: 169- 184,2000. 170. Kirker, K. R., Luo, Y., Nielson, J. H., Shelby, J., and Prestwich, G. D. Glycosaminoglycan hydrogel films as bio-interactive dressings for wound healing. Biomaterials, 23: 3661-3671, 2002. 171. Kirker, K. R., Luo, Y., Morris, S. E., Shelby, J., and Prestwich, G. D. Glycosaminoglycan hydrogel films as supplemental wound dressings for donor sites. J. Burn Care Rehabil., 25: 276-286, 2004. 172. Campoccia, D., Doherty, P., Radice, M., Brun, P., Abatangelo, G., and Williams, D. -P. Semisynthetic resorb able materials from hyaluronan esterification. Biomaterials, 19: 2101-2127, 1998. 173. Benedetti, L., Cortivo, R., Berti, T., Berti, A., Pea, F., Mazzo, M., Moras, M., and Abatangelo, G. Biocompatibility and biodegradation of different hyaluronan derivatives (Hyaff) implanted in rats. Biomaterials, 14: 1154-1160, 1993. 174. Mori, M., Yamaguchi, M., Sumitomo, S., and Takai, Y. Hyaluronan-based biomaterials in tissue engineering. Acta Histochem. Cytochem., 2004. 175. Nakajima, N. and Ikada, Y. Mechanism of amide formation by carbodiimide for bioconjugation in aqueous media. Bioconjug. Chern., 6: 123-130, 1995. 176. Luo, Y., Ziebell, M. R., and Prestwich, G. D. A hyaluronic acid-taxol antitumor bioconjugate targeted to cancer cells. Biomacromolecules, 1: 208-218, 2000. 177. Shu, X. Z., Liu, Y., Palumbo, F. S., and Prestwich, G. D. Disulfide-crosslinked hyaluronan-gelatin hydrogel films: a covalent mimic of the extracellular matrix for in vitro cell growth. Biomaterials,24: 3825-3834, 2003. 178. Shu, X. Z. and Prestwich, G. D. Therapeutic biomaterials from chemically­modified hyaluronan. In: H. Garg and C. Hales (eds.), Chemistry and Biology of Hyaluronan, pp. 475-504. Oxford, UK: Elsevier Ltd., 2004. 179. Liu, L. S., Ng, C. K., Thompson, A. Y., Poser, J. W., and Spiro, R. C. Hyaluronate-heparin conjugate gels for the delivery of basic fibroblast growth factor (FGP-2). J. Biomed. Mater. Res., 62: 128-135, 2002. 180. Liu, Y., Shu, X. Z., Gray, S. D., and Prestwich, O. D. Disulfide-crosslinked hyaluronan-gelatin sponge: growth of fibrous tissue in vivo. J. Biomed. Mater. Res. A, 68: 142-149,2004. 55 181. Liu, Y., Li, H., Shu, X. Z., Gray, S. D., and Prestwich, G. D. Reduction of post­operative adhesions by in situ crosslinked hyaluronan hydrogels. In: HA 2003, pp. in press. Abington, UK: Woodhead Publishing Ltd, 2004. 182. Li, H., Liu, Y., Shu, X. Z., Gray, S. D., and Prestwich, G. D. Synthesis and biological evaluation of a cross-linked hyaluronan-mitomycin C hydrogel. Biomacromolecules, 5: 895-902, 2004. 183. Chen, G., Ito, Y., Imanishi, Y., Magnani, A., Lamponi, S., and Barbucci, R. Photoimmobilization of sulfated hyaluronic acid for antithrombogenicity. Bioconjug. Chern., 8: 730-734, 1997. 184. Asayama, S., Nogawa, M., Takei, Y., Akaike, T., and Maruyama, A. Synthesis of novel polyampholyte comb-type copolymers consisting of a poly(L-lysine) backbone and hyaluronic acid side chains for a DNA carrier. Bioconjug. Chern., 9: 476-481, 1998. 185. Eliaz, R. E. and Szoka, F. C., Jr. Liposome-encapsulated doxorubicin targeted to CD44: a strategy to kill CD44-overexpressing tumor cells. Cancer Res., 61: 2592- 2601,2001. 186. Crescenzi, V., Francescangeli, A., Renier, D., and Bellini, D. New cross-linked and sulfated derivatives of partially deacetylated hyaluronan: synthesis and preliminary characterization. Biopolymers, 64: 86-94, 2002. 187. Segura, T., Anderson, B. C., Chung, P. H., Webber, R. E., Shull, K. R., and Shea, L. D. Crosslinked hyaluronic acid hydrogels: a strategy to functionalize and pattern. Biomaterials, 26: 359-371, 2005. 188. Peattie, R., Nayate, A., Firpo, M., Shelby, J., Fisher, R., and Prestwich, G. D. Stimulation of in vivo angiogenesis by cytokine-Ioaded hyaluronic acid hydrogel implants. Biomaterials, 25: 2789-2798, 2004. 189. Shu, X. Z., Liu, Y., Palumbo, F. S., and Prestwich, G. D. In situ crosslinkable hyaluronan hydrogels for tissue engineering. Biomaterials, 25: 1339-1348, 2004. 190. Larsen, N. E., Leshchiner, E. A., Parent, E. G., and Balazs, E. A. Hylan and hylan derivatives in drug delivery. In: C. G. Gebelein (ed.), Cosmetic and Pharmaceutical Applications of Polymers, pp. 147-157. New York: Plenum Press, 1991. 191. Lapcik, L., Jr., Lapcik, L., De Smedt, S., Demeester, J., and Chabrecek, P. Hyaluronan: Preparation, Structure, Properties, and Applications. Chern. Rev., 98: 2663-2684, 1998. 192. Crescenzi, V., Tomasi, M., and Francescangeli, A. New routes to hyaluronan­based networks and supramolecular assemblies. In: G. Abatangelo and P. H. Weigel (eds.), New Frontiers in Medical Sciences: Redefining Hyaluronan, pp. 173-180. Padua, Italy: Elsevier Science, 1999. 56 193. Mensitieri, M., Ambrosio, L., and Nicolais, L. Viscoelastic properties modulation of a novel autocrosslinked hyaluronic acid polymer. J. Mater. Sci.: Mater. Med., 7: 695-698, 1996. 194. Park, Y. D., Tirelli, N., and Hubbell, J. A. Photopolymerized hyaluronic acid­based hydrogels and interpenetrating networks. Biomaterials, 24: 893-900, 2003. 195. Burdick, J. A., Chung, C., Jia, X., Randolph, M. A., and Langer, R. Controlled degradation and mechanical behavior of photopolymerized hyaluronic acid networks. Biomacromolecules, 6: 386-391, 2005. 196. Li, Q., Williams, C. G., Sun, D. D., Wang, J., Leong, K., and Elisseeff, J. H. Photocrosslinkable polysaccharides based on chondroitin sulfate. J. Biomed. Mater. Res. A, 68: 28-33, 2004. 197. Smeds, K. A., Pfister-Serres, A., Miki, D., Dastgheib, K., Inoue, M., Hatchell, D. L., and Grinstaff, M. W. Photocrosslinkable polysaccharides for in situ hydrogel formation. J. Biomed. Mater. Res., 54: 115-121, 2001. 198. Matsuda, T., Miwa, H., Moghaddam, M. J., and Hda, F. Newly designed tissue adhesion prevention technology based on photocurable mucopolysaccharides. In vivo evaluation. ASAIO. J., 39: M327-331, 1993. 199. Matsuda, T. and Magoshi, T. Preparation of vi nyla ted polysaccharides and photofabrication of tubular scaffolds as potential use in tissue engineering. Biomacromolecules, 3: 942-950,2002. 200. Johns, D. B., Rodgers, K. E., Donahue, W. D., Kiorpes, T. C., and diZerega, G. S. Reduction of adhesion formation by postoperative administration of ionically cross-linked hyaluronic acid. Fertil. Steril., 68: 37-42, 1997. 201. Hennink, W. E. and van Nostrum, C. F. Novel crosslinking methods to design hydrogels. Adv. Drug Deliv. Rev., 54: 13-36,2002. 202. Karatosun, V., Unver, B., Gocen, Z., Sen, A., and Gunal, I. Intra-articular hyaluranic acid compared with progressive knee exercises in osteoarthritis of the knee: a prospective randomized trial with long-term follow-up. Rheumatol. Int., 2005. 57 203. Goldberg, V. M. and Buckwalter, J. A. Hyaluronans in the treatment of osteoarthritis of the knee: evidence for disease-modifying activity. Osteoarthritis Cartilage, 13: 216-224, 2005. 204. Goldberg, V. M. and Coutts, R. D. Pseudoseptic reactions to hylan visco supplementation: diagnosis and treatment. Clin. Orthop. Relat. Res. 130-137, 2004. 205. Monheit, G. D. Hylaform: a new hyaluronic acid filler. Facial. Plast. Surg., 20: 153-155, 2004. 206. Dover, J. S., Carruthers, A., Carruthers, J., and Alam, M. Clinical use of Restylane. Skin Therapy Lett., 10: 5-7, 2005. 207. Soparkar, C. N. and Patrinely, J. R. Managing inflammatory reaction to restylane. Ophthal. Plast. Reconstr. Surg., 21: 151-153, 2005. 208. Soparkar, C. N., Patrinely, J. R., and Tschen, J. Erasing restylane. Ophthal. Plast. Reconstr. Surg., 20: 317-318, 2004. 209. Eikelboom, J. W. and Hankey, G. J. Low molecular weight heparins and heparinoids. Med. J. Aust., 177: 379-383, 2002. 210. Counsell, C. and Sandercock, P. Low-molecular-weight heparins or heparinoids versus standard unfractionated heparin for acute ischemic stroke (Cochrane review). Stroke, 33: 1925-1926, 2002. 211. Li, Y., Rodriquez, M., Spencer, F. A., and Becker, R. C. Comparative effects of unfractionated heparin and low molecular weight heparin on vascular endothelial cell tissue factor pathway inhibitor release: a model for assessing intrinsic thromboresistance. J. Thromb. Thrombolysis, 14: 123-129,2002. 212. SpinIer, S. A. and Evans, C. M. Update in unfractionated heparin, low-molecular­weight heparins, and heparinoids in the elderly (age >/= 65 years). J. Thromb. Thrombolysis, 9: 117,2000. 213. Linhardt, R. J., Loganathan, D., aI-Hakim, A., Wang, H. M., Walenga, J. M., Hoppensteadt, D., and Fareed, J. Oligosaccharide mapping of low molecular weight heparins: structure and activity differences. J. Med. Chem.,33: 1639-1645, 1990. 214. Steams, N. A., Prigent-Richard, S., Letoumeur, D., and Castellot, J. J., Jr. Synthesis and characterization of highly sensitive heparin probes for detection of heparin-binding proteins. Anal. Biochem., 247: 348-356, 1997. 58 215. Ziebell, M. R., Zhao, Z.-G., Luo, B., Luo, Y., Turley, E. A., and Prestwich, G. D. Peptides that mimic glycosaminoglycans: high affinity ligands for a hyaluronic acid binding domain. Chern. BioI., 8: 1081-1084,2001. 216. Kirker, K. R. and Prestwich, G. D. Physical properties of glycosaminoglycan hydrogels. J. Polym. Sci. [B]: Polymer Physics, 42: 4344-4356, 2004. 217. Yerushalmi, N., Arad, A., and Margalit, R. Molecular and cellular studies of hyaluronic acid-modified liposomes as bioadhesive carriers for topical drug delivery in wound healing. Arch Biochem Biophys, 313: 267-273,1994. 218. Chinen, N., Tanihara, M., Nakagawa, M., Shinozaki, K., Yamamoto, E., Mizushima, Y., and Suzuki, Y. Action of microparticles of heparin and alginate crosslinked gel when used as injectable artificial matrices to stabilize basic fibroblast growth factor and induce angiogenesis by controlling its release. J. Biomed. Mater. Res. A, 67: 61-68,2003. 219. Gilbert, M. E., Kirker, K. R., Gray, S. D., Ward, P. D., Szakacs, J. G., Prestwich, G. D., and Orlandi, R. R. Chondroitin sulfate hydrogel and wound healing in rabbit maxillary sinus mucosa. Laryngoscope, 114: 1406-1409,2004. 220. Cai, S., Liu, Y., Shu, X. Z., and Prestwich, G. D. Injectable glycosaminoglycan hydrogels for controlled release of human basic fibroblast growth factor. Biomaterials, 26: 6054-6067, 2005. 221. Liu, Y., Li, H., Shu, X. Z., Gray, S. D., and Prestwich, G. D. Crosslinked hyaluronan hydro gels containing mitomycin C reduce postoperative abdominal adhesions. Fertil. Steril., 83 Supp14: 1275-1283,2005. 222. Shu, X. Z., Ghosh, K., Liu, Y., Palumbo, F. S., Luo, Y., Clark, R. A., and Prestwich, G. D. Attachment and spreading of fibroblasts on an RGD peptide­modified injectable hyaluronan hydrogel. J. Biomed. Mater. Res. A, 68: 365-375, 2004. 223. Luo, Y. and Prestwich, G. D. Synthesis and selective cytotoxicity of a hyaluronic acid-antitumor bioconjugate. Bioconjug. Chern., 10: 755-763, 1999. 224. Takei, Y., Maruyama, A., Ferdous, A., Nishimura, Y., Kawano, S., Ikejima, K., Okumura, S., Asayama, S., Nogawa, M., Hashimoto, M., Makino, Y., Kinoshita, M., Watanabe, S., Akaike, T., Lemasters, J. J., and Sato, N. Targeted gene delivery to sinusoidal endothelial cells: DNA nanoassociate bearing hyaluronan­glycocalyx. FASEB J., 18: 699-701, 2004. 225. Heublein, B., Evagorou, E. G., Rohde, R., Ohse, S., Meliss, R. R., Barlach, S., and Haverich, A. Polymerized degradable hyaluronan--a platform for stent coating with inherent inhibitory effects on neointimal formation in a porcine coronary model. Int. J. Artif. Organs,25: 1166-1173,2002. 59 226. Zamora, P.O., Tsang, R., Pena, L. A., Osaki, S., and Som, P. Local delivery of basic fibroblast growth factor (bFGF) using adsorbed silyl-heparin, benzyl­bis( dimethylsilylmethyl)oxycarbamoyl-heparin. Bioconjug. Chem., 13: 920-926, 2002. 227. Zhao, R., Luo, J., Shangguan, D., and Liu, G. A novel matrix for high performance affinity chromatography and its application in the purification of antithrombin III. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci., 816: 175- 181,2005. CHAPTER 2 RHAMM BINDS HYALURONAN AND HEPARIN: A SELECTIVE PROTEIN SENSOR IN A COMPETITIVE ENZYME-LINKED IMMUNOSORBENT ASSAY FOR HEPARIN DETECTION Reproduced from [Cai, S., Dufner-Beattie, J. and Prestwich, G.D. (2004) "A Selective Protein Sensor for Heparin Detection," Analytical Biochemistry, 326 (1), 33-41], Copyright [2003] with permission from Elsevier Inc. In this project, the plasmid construction work (Section 2.2.2) was performed by Dr. Jodi Dufner-Beattie. 61 2.1 Introduction The receptor of hyaluronan (HA) -mediated motility (RHAMM) features a 63- amino acid HA binding domain (HABD) at the C-terminus (aa 518-580) (1, 2). This HABD contains two base-rich motifs and possesses an overall helix-turn-helix structure (3,4). RHAMM has been located both in the cytoplasm and on the surfaces of activated leukocytes, sub confluent fibroblasts, and endothelial cells (5), functioning as a mediator for cell migration and proliferation (6). The expression of RHAMM on the cell surface is correlated with progression of selected types of cancers including glioma (6), desmoid tumor (7), myeloma (8), myeloid leukemia (9), bladder cancer (10), and stomach cancer (11). Recently, an isoform of RHAMM has been found intracellularly that binds with cytoskeletal proteins such as dynein, gamma-TuRC, and TPX2 for microtubule nucleation and spindle pole stabilization (12-15) to associate with erk1 kinase involved in Ras-signaling pathway (16, 17) and to mediate the cell cycle through its interaction with pp60v - src (15). The binding between RHAMM and its ligand HA is attributed to ionic interactions, which was demonstrated by the discovery that HA-mimetic peptides, consisting of spaced acidic amino acids, could block HA-RHAMM HAHD interaction (18). In addition, previous studies have shown that HABD also has significant affinity with heparin, a multisulfated glycosaminoglycan (GAG) (19). Here in this chapter we envisaged the use of multiple repeats of RHAMM HABD for HA binding properties and potential applications for HA detection, as previously accomplished using both native and recombinant HABDs from aggrecan (20-22). We found that these constructs show dramatically higher affinity and selectivity for heparin, compelling us to develop a novel heparin detection reagent and create a protein-based assay for heparin detection. 62 Both heparin and HA are defined glycosaminoglycans with alternating uronic acid and aminoglycoside residues. However, in contrast to homogeneous and unsulfated HA, heparin is highly heterogeneous, having two epimeric uronic acids and both Nand 0- sulfations (Figure 2.1) (23-28). Heparin interacts with antithrombin III (AT-III), forming a complex that can block activation of factor Xa thereby preventing blood coagulation (28,29). Currently two forms of heparin, unfractionated free heparin (UFH) and low molecular weight heparin (LMWH), are clinically employed as blood anticoagulants to reduce blood clot formation and thrombosis (30-34). Although LMWH has better bioavailability, the less expensive UFH is still widely used in the United States (35). With a view to these situations, nlonitoring heparin levels in blood is an important issueto study heparin pharmacokinetics and thus to control the applied dose of therapeutic heparin. Plasma heparin levels can be quantified by several clinically approved methods: (i) determination of activated coagulation time (ACT), which measures the time for whole blood to clot with celite or kaolin as an activating agent (36); (ii) activated partial thromboplastin time (aPTI), measuring the clotting time from activation of factor XII to formation of fibrin clot (37); (iii) the heparin management test (HMT), using a variety of disposable test cards to rapidly determine the blood activated clotting time (36); or (iv) the anti-factor Xa assay, utilizing the inhibition on factor Xa due to the heparin-ATIII complex in plasma, thereby allowing measurement of prolonged clotting time (38). Measurement of ACT or aPTI had been the most widely used protocols for prescribing and monitoring the use of anticoagulants in patients for over 30 years (39). Subsequently, HMT was developed with advantages in smaller samples and better sensitivity (36). However, these methods continue to be problematic because of the 63 H H Hyaluronan (homogeneous) Heparin (heterogeneous) Figure 2.1 Partial tetrasaccharide structures of hyaluronan and heparin. 64 poor correlation between coagulation time and heparin concentration due to uncontrollable variations from patient to patient (38, 40, 41). While the anti-Xa assay is an improved method with increased reliability, its considerably higher expense deters widespread acceptance for clinical use (35). Recently Zhong et at. reported a chemical method by monitoring inhibition of thrombin activity on a flu orogenic substrate (42); however, this method lacked the sensitivity required for clinical use. Initial studies on RHAMM already showed its affinity for heparin, but lower than for HA (19), an observation that was confirmed during preparation of the 63-amino acid minimal HABD (RHAMM-P1) of RHAMM for structural studies (18). It is possible that other regions of RHAMM contribute to the specificity for HA by reducing the cross reactivity of RHAMM with other GAGs, including heparin. The polycationic binding motifs in RHAMM-HABD might be expected to show increased affinity with heparin simply as a result of increased electrostatic interactions with this polysulfated GAG (3,4). Therefore, this chapter describes the generation of recombinant GST (glutathione S-transferase) -fusion proteins containing single and multiple HABD copies and studies on their affinities for HA and heparin. As anticipated, when HABD was subcloned and reconstructed, in all the GST -tagged proteins with HABD copy number of one to three (respectively referred to as GST-HB1, GST-HB2, and GST-HB3), the affinity for heparin became higher than for HA. Further examination of the affinity and selectivity of GST - HB3 led to the development of a rapid ELISA assay for clinical determination of heparin levels in human plasma. 65 2.2 Experimental procedures 2.2.1 Materials RHAMM (518-580) cDNA was provided by Dr. M.R. Ziebell (The University of Utah). pGEX-2T vector and Glutathione Sepharose™ 4B bead slurry were purchased from Amersham Biosciences (Piscataway,NJ). E.coli strain BL21 (DE3) was purchased from Novagen (San Diego, CA). Isopropyl J3-D-thiolgalactoside (IPTG) and biotin­hydrazide were purchased from Pierce (Rockford, IL). Reagent 1-[3-( dimethylamino) propyl]-3-ethylcarbodiimide hydrochloride (EDCI) was purchased from Aldrich (Milwaukee, WI). Protease inhibitors (phenylmethylsulfonyl fluoride (PMSF), aprotinin, pepstatin A and leupeptin), dithiothreitol (DIT), glutathione (GSH), Bradford reagent, bovine serum albumin (BSA), bovine thrombin, mouse monoclonal anti-GST antibody, horseradish peroxidase (HRP)-streptavidin conjugate, HRP-conjugated goat anti-mouse IgG, 3, 3', 5, 5'-tetramethyl benzidene (TMB), unfractionated heparin (UFH, sodium salt from porcine mucosa, average 15 kDa), low molecular weight heparin (LMWR, 6 kDa), 4-sulfate and 6-sulfate chondroitin sulfate (CS A and CS C), keratan sulfate (KS), heparan sulfate (RS), human plasma samples and Accucolor anti-Xa heparin assay kit were all purchased from Sigma (St. Louis, MO). Biotinylated heparin was obtained from Celsus Laboratories (Cincinnati, OR). High-binding 96-well polystyrene plates were purchased from E&K Sciences (Campbell, CA). Streptavidin precoated 96-well plates were purchased from Roche Applied Science (Indianapolis, IN). The blocking buffer StabilGuard solution was purchased from Surmodics Inc. (Eden Prairie, MN). HA (sodium salt, 1,500 kDa) was obtained from Clear Solutions Biotech, Inc. (Stony Brook, NY) 2.2.2 Construction of recombinant plasmids The modified vector pGEX-ERL (Figure 2.2) was developed from pGEX-2T by replacing SmaI with SacI, Not!, XhoI, and HindIII sites in multicloning region to add flexibility during DNA manipulation. RHAMM (518-580) cDNA was amplified with the following designed primers: a forward primer, 5'-CGGGATCCGGTGCTAGCCGTGAC TCCTATGCACAGCTCCTTGG-3' with BamHI and NheI cleavage sites at 5'; and a reverse primer, 5'-GGAGCGGTCGACACGGATGCCCAGAGCTTT ATCT AA TTC-3' with a SaIl site at 5'. The PCR product was digested with BamHI and San and ligated into the modified pGEX-ERL vector, which had also been digested with BamHI and XhoI to obtain the HBI construct. This subcloning step eliminates the downstream restriction sites so that the insert cannot be excised during subsequent manipulations. To connect the consecutive multiple copies of the P1 open reading frame (ORF), a (GlySer)9Gly linker was introduced using the forward primer 5'-GATCCGGTCTCGAGGGAAGTGGTICTGGAAGTGGTICAGGTICGGGTA GCGGATCTGGTTCAGGAAGTGGTT -3' containing a XhoI site, . and the reverse primer 5'-CT AGAACCACTTCCTGAACCAGATCCGCTACCCGAACCTGAACC ACTTCCAGAACCACTTCCCTCGAGACCG-3' containing a BamHI site. The vector with single P1 ORF was linearized with BamHI and NheI and ligated with the annealed linker primers. This intermediate product was again digested with BamHI and XhoI and then ligated with another PCR-amplified PI ORF cDNA,which had been digested with BamHI and SalI to give the HB2 recombinant construct. The 66 BamHI Sac I Not I Xho I Hind III EcoR I CTG GTT CCG CGT GGA TCC CCG GGA GCT CGG GGC CGC eTe GAG MG CTT GGA A TT CAT CGT GAC TGA eTG ACG GAC CM GGCGCA CCT AGG GGC CCT CGA GCG CCG GCG GAG CTC TTC GM CCT TM GTA GCA CTG ACT GAC TGC t Narl' EcoAV BssH II Apa t BstE II pG EX-E RL -4950 bp Mlu I Pst I ori Figure 2.2. Modified pGEX-ERL vector. (Data from Dr. Jodi Dufner-Beattie) ... 0'1 -.....) HB3 construct was synthesized by repeating the steps above with another linker and amplified P1 cDNA. All recombinant constructs were sequenced to confirm the presence of in-frame fusions with GST and the absence of mutations that may have been introduced during PCR amplification of RHAMM cDNA. 2.2.3 Protein synthesis 68 Each of the GST-HB plasmids, as well as the empty pGEX-ERL vector, was transformed into E. coli strain BL21 (DE3) by heat-shock. Bacteria were grown in 20 ml (LB) culture at 37°C overnight, transferred to one liter of fresh LB, and incubated at 37°C for 3 hr. Expression was induced by addition of 0.1 mM IPTG (for GST alone and GST-HB1) or 0.5 mM IPTO (for GST-HB2 and GST-HB3) and incubated at 22°C to increase the fusion protein solubility. After 4 hr incubation, the bacterial pellet was collected by centrifugation (4,000 x g, 15 min), resuspended with 100 ml of STE (salt­Tris- EDTA) buffer (10 mM Tris pH 8.0,150 mM NaCI, 1 mM EDTA), and incubated for 15 min on ice. Next, a mixture of 1 mM each of four protease inhibitors (PMSF,