Mechanisms of genome degeneration and adaptation in symbiosis

Intracellular mutualistic endosymbionts are widespread among insect species and perform many different functions for their hosts. While the role of each symbiont varies among hosts, the evolution of symbiont genomes follows a similar degenerative trajectory. Genome degeneration is a consequence of relaxed selection on gene functions no longer required in the symbiotic relationship. Previous efforts to understand the forces shaping symbiont genomes have involved comparing long established symbionts with distantly related free-living bacteria. In order to characterize the mechanisms driving symbiont genome degeneration, recently established symbionts must be compared with closely related free-living relatives. This work describes the discovery of a non host-associated member of the Sodalis-allied clade of insect symbionts, Sodalis praecaptivus str. HS1. Whole genome comparisons between S. praecaptivus and the recently established symbionts, Sodalis glossinidius and Candidatus Sodalis pierantonius show that these symbionts evolved independently from an S. praecaptivus-like ancestor. Detailed genomic comparisons between S. praecaptivus and Ca. S. pierantonius reveal that insertions and deletions resulting from replication slippage errors associated with G+C-rich repeat sequences are an important driver of gene inactivation and deletion in the early stages of symbiosis. This slippage-prone phenotype is mechanistically associated with the loss of certain components of the bacterial DNA recombination machinery at an early stage in symbiotic life and is expected to facilitate rapid adaptation to the novel host environment. This work also includes a comparative analysis of the PhoP-PhoQ two-component systems of S. praecaptivus and S. glossinidius, which is involved in mediating resistance to antimicrobial peptides produced by the host immune system. Comparative transcriptomics identifies significant differences in the PhoP regulatory networks of these closely related organisms. This work also describes the discovery of a novel transcriptional regulator involved in resistance to antimicrobial peptides. The role of genome degeneration as it relates to bacterial adaptation in novel environments is also explored. Using a library of transposon Tn 5 mutants of S. praecaptivus this work shows that the inactivation of various genes, many of which are global transcriptional regulators, can provide significant fitness advantages in novel environments, including an insect host. This rapid adaptation is thought to occur by disrupting established regulatory networks allowing existing genes and metabolic pathways to be reconfigured in ways that are better suited to the novel environments encountered by the cell.

1 MECHANISMS OF GENOME DEGENERATION AND ADAPTATION IN SYMBIOSIS by Adam Larsen Clayton A dissertation submitted to the faculty of The University of Utah in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Biology The University of Utah December 2016 2 Copyright © Adam Larsen Clayton 2016 All Rights Reserved The University of Utah Graduate School STATEMENT OF DISSERTATION APPROVAL The dissertation of Adam Larsen Clayton has been approved by the following supervisory committee members: , Chair Colin Dale 8/25/16 Date Approved , Member Kelly Hughes 8/25/16 Date Approved , Member Jon Seger 8/25/16 Date Approved , Member Richard Clark 8/25/16 Date Approved , Member Robert Weiss 8/23/16 Date Approved and by , Chair of Denise Dearing the Department of and by David B. Kieda, Dean of The Graduate School. Biology ABSTRACT Intracellular mutualistic endosymbionts are widespread among insect species and perform many different functions for their hosts. While the role of each symbiont varies among hosts, the evolution of symbiont genomes follows a similar degenerative trajectory. Genome degeneration is a consequence of relaxed selection on gene functions no longer required in the symbiotic relationship. Previous efforts to understand the forces shaping symbiont genomes have involved comparing long established symbionts with distantly related free-living bacteria. In order to characterize the mechanisms driving symbiont genome degeneration, recently established symbionts must be compared with closely related free-living relatives. This work describes the discovery of a non host-associated member of the Sodalis-allied clade of insect symbionts, Sodalis praecaptivus str. HS1. Whole genome comparisons between S. praecaptivus and the recently established symbionts, Sodalis glossinidius and Candidatus Sodalis pierantonius show that these symbionts evolved independently from an S. praecaptivus-like ancestor. Detailed genomic comparisons between S. praecaptivus and Ca. S. pierantonius reveal that insertions and deletions resulting from replication slippage errors associated with G+C-rich repeat sequences are an important driver of gene inactivation and deletion in the early stages of symbiosis. This slippage-prone phenotype is mechanistically associated with the loss of certain components of the bacterial DNA recombination machinery at an early stage in symbiotic iv life and is expected to facilitate rapid adaptation to the novel host environment. This work also includes a comparative analysis of the PhoP-PhoQ twocomponent systems of S. praecaptivus and S. glossinidius, which is involved in mediating resistance to antimicrobial peptides produced by the host immune system. Comparative transcriptomics identifies significant differences in the PhoP regulatory networks of these closely related organisms. This work also describes the discovery of a novel transcriptional regulator involved in resistance to antimicrobial peptides. The role of genome degeneration as it relates to bacterial adaptation in novel environments is also explored. Using a library of transposon Tn5 mutants of S. praecaptivus this work shows that the inactivation of various genes, many of which are global transcriptional regulators, can provide significant fitness advantages in novel environments, including an insect host. This rapid adaptation is thought to occur by disrupting established regulatory networks allowing existing genes and metabolic pathways to be reconfigured in ways that are better suited to the novel environments encountered by the cell. iv v I dedicate this work to my family. Their support and patience allows me to follow my dreams. vi TABLE OF CONTENTS ABSTRACT ....................................................................................................................... iii LIST OF TABLES ........................................................................................................... viii ACKNOWLEDGEMENTS ............................................................................................... ix Chapters 1. INTRODUCTION .........................................................................................................1 References ................................................................................................................6 2. A NOVEL HUMAN-INFECTION-DERIVED BACTERIUM PROVIDES INSIGHTS INTO THE EVOLUTIONARY ORIGINS OF MUTUALISTIC INSECTBACTERIAL SYMBIOSES ..........................................................................................9 Abstract ..................................................................................................................10 Introduction ............................................................................................................10 Results ....................................................................................................................11 Discussion ..............................................................................................................15 Materials and Methods ...........................................................................................19 Acknowledgments..................................................................................................21 References ..............................................................................................................21 3. ADAPTATION BY DELETOGENIC REPLICATION SLIPPAGE IN A NASCENT SYMBIONT .................................................................................................................23 Abstract ..................................................................................................................24 Introduction ............................................................................................................24 Results and Discussion ..........................................................................................25 Materials and Methods ...........................................................................................31 Acknowledgments..................................................................................................32 References ..............................................................................................................32 7 4. THE REGULATION OF ANTIMICROBIAL PEPTIDE RESISTANCE IN THE TRANSITION TO INSECT SYMBIOSIS ...................................................................34 Abstract ..................................................................................................................35 Introduction ............................................................................................................35 Results ....................................................................................................................39 Discussion ..............................................................................................................48 Materials and Methods ...........................................................................................52 Acknowledgments..................................................................................................64 References ..............................................................................................................64 5. GLOBAL GENE REGULATION CONSTRAINS MICROBIAL ADAPTATION....77 Abstract ..................................................................................................................78 Introduction ............................................................................................................78 Results ....................................................................................................................82 Discussion ..............................................................................................................95 Material and Methods ..........................................................................................100 Acknowledgments................................................................................................106 References ............................................................................................................106 6. CONCLUSIONS AND FUTURE DIRECTIONS .....................................................121 References ............................................................................................................124 APPENDIX: LIST OF PUBLICATIONS .......................................................................125 vii 8 LIST OF TABLES 2.1. General features of the strain HS, SOPE, and S. glossinidius genome sequences ................................................................................................................................14 2.2 Allelic spectrum of pseudogene mutations in strain HS orthologs found in SOPE and S. glossinidius .......................................................................................18 3.1 G+C-content of terminal sequences of NUCmer predicted deletion fragments ....28 3.2 Density of genome wide G+C-rich and A+T-rich direct repeats ...........................30 4.1 Bacterial strains used in this study .........................................................................69 9 ACKNOWLEDGEMENTS I would like to thank past and present members of the Dale Lab for their contributions to this work, and especially acknowledge all the time and effort of my PhD advisor Colin Dale. Thank you to my committee members for your helpful comments, suggestions and encouragement. I wish to also acknowledge the Genetics Training Grant for its financial support and David Grunwald and the other trainees for their moral support, feedback and suggestions. Most of all, thank you to my dear wife for all of your support and encouragement. 1 CHAPTER 1 INTRODUCTION 2 Obligate mutualistic symbiotic bacteria are common in approximately 10% of all insect species (Buchner 1965; Douglas 1989). Insect symbionts perform a variety of functions for their hosts including nutritional supplementation of the host diet (Gündüz and Douglas 2009; McCutcheon and von Dohlen 2011; Sloan and Moran 2012) as well as protection from parasites (Oliver et al. 2003), pathogens (Scarborough et al. 2005; Hedges et al. 2008; Teixeira et al. 2008), and environmental stress (Russell and Moran 2006). While the roles of mutualistic symbionts vary, the evolution of symbiont genomes follows a similar degenerative process. Over long periods of time, the sizes of mutualistic symbiont genomes are significantly reduced compared to their free-living relatives (Andersson and Kurland 1998; Dale and Moran 2006). This reduction in size follows the transition from dynamic environments, where diverse genes and regulatory networks are required to survive, to a relatively static host-associated lifestyle, where only a small fraction of the original gene inventory is required. This transition to a static host environment places a large number of symbiont genes under relaxed selection allowing them to accumulate inactivating mutations and be deleted (Moran 1996). Mutualistic endosymbionts also evolve in isolation where they are unable to benefit from laterally acquired DNA (Andersson and Kurland 1998). This isolation leads to an irreversible accumulation of deleterious mutations and substantial gene loss. Furthermore, the early stages of this degenerative process can also include an expansion in the amount of mobile DNA (phage and insertion sequence elements; IS-elements) in the symbiont genome (Wu et al. 2004; Toh et al. 2006; Plague et al. 2008). While the long-term effects of static host association have been described previously, the actual mechanisms driving gene inactivation and deletion have not been 3 clearly defined. In order to analyze the mechanisms of gene inactivation in the early stages of symbiosis, it is necessary to compare recently established symbionts with closely related free-living relatives. Chapter 2 introduces the discovery of strain HS (later named Sodalis praecaptivus str. HS1; Chari et al. 2015), a free-living relative of a group of insect symbionts referred to as the Sodalis-allied clade. Symbionts from this clade are found in diverse insect hosts including, but not limited to, stinkbugs, bird lice, chestnut weevils, grain weevils, and tsetse flies. Genome comparisons in chapters two-five are made between S. praecaptivus and two recently established symbionts of the Sodalisallied clade. Sodalis glossinidius, a symbiont of the tsetse fly, and Candidatus Sodalis pierantonius str. SOPE, the symbiont of the rice weevil Sitophilus oryzae. Genome comparisons in Chapter 2 provide evidence that these symbionts are initially acquired independently in each insect host, and that each symbiont genome is derived from a common S. praecaptivus-like template. Comparisons with S. praecaptivus also identify Ca. S. pierantonius as sharing 98% genome-wide nucleotide sequence identity, making it the most recently established endosymbiont for which we have a complete genome sequence. The extremely close relationship between S. praecaptivus and Ca. S. pierantonius provides an opportunity to analyze the mechanisms involved in the degeneration of this symbiont genome shortly following host association. By aligning the pseudogenes of Ca. S. pierantonius with their intact S. praecaptivus homologs in Chapter 2, we identified insertions and deletions (indels) as the most abundant class of mutation in the Ca. S. pierantonius genome. Analysis of indels in Ca. S. pierantonius in Chapter 3 identifies mutations in recombination and repair genes as likely contributing to frequent slip-strand 4 mispairing events. These slippage events occur specifically in G+C-rich and repetitive sequences and appear to function as a strong driver of gene inactivation and deletion. The benefits and costs of such a mutator phenotype are also explored. The environment inhabited by non host-associated bacteria is dynamic, requiring the maintenance of functions involved in sensing and responding to environmental changes. One mechanism whereby all organisms, including bacteria, adapt to changes in their environment is through transcriptional regulatory proteins (Balleza et al. 2009). The most predominant form of transcriptional regulation in bacteria is through twocomponent systems (Stock et al. 2000; Bijlsma and Stock 2003). Such systems consist of a sensor kinase capable of detecting environmental cues and transmitting signals (usually through phosphorylation) to a response regulator. Response regulators then modulate the expression of genes, usually by direct interaction with promoters and other regulatory proteins (Stock et al. 2000). Together, PhoP and PhoQ constitute one such twocomponent system that, in many Enterobacteriaceae, responds to Mg2+, Ca2+, pH and antimicrobial peptides (AMPs; Bader et al. 2005; Prost et al. 2007; Prost and Miller 2008; García Véscovi et al. 2009; Perez et al. 2009). Previous work on PhoP-PhoQ in S. glossinidius determined that this system is required for survival in its insect host, but that PhoQ is attenuated in its ability to sense these signals (Pontes et al. 2011). To understand the evolution of this two-component system in symbiosis, Chapter 4 presents a comparative analysis of the phoP regulatory networks from both S. glossinidius and S. praecaptivus. We also determined that neither PhoP nor PhoQ, in S. praecaptivus, is required for survival in the presence of AMPs or in an insect host. This discovery prompted a search for other genes involved in resistance to AMPs. By screening a 5 transposon Tn5 mutant library of S. praecaptivus for AMP sensitive mutants, we identified a novel transcriptional regulator (Sant_4061) that is critical to both AMP resistance and survival in an insect host. Unexpectedly, ∆Sant_4061 mutants also exhibit a growth advantage over the WT strain when grown in rich media. Further analysis of the Tn5 library revealed that mutants with inactivating insertions in Sant_4061 were the most abundant in this library. This observation prompted a search to identify which mutants might be advantageous in other conditions. By passaging the Tn5 mutant library introduced in Chapter 4 through various conditions both in vitro and in vivo and sequencing the surviving mutants, we identified mutant alleles in nearly every condition that displayed significant fitness increases. Interestingly, the majority of these mutant alleles contained insertions in known global transcriptional regulators. Over time, transcriptional regulators and the genes they regulate become optimized to respond to specific changes in the environment. This is curious considering the fact that the inactivation of so many global transcriptional regulators can provide such significant fitness increases in novel environments. Thus, a trade-off exists with global transcriptional regulators. On the one hand, global regulators increase efficiency by regulating large numbers of genes in response to routinely encountered signals. On the other hand, this functional optimization comes at the cost of lost flexibility when transitioning to novel environments, where different combinations of signals might exist and regulatory networks would benefit from rewiring to meet the demands of the new environment. This trade-off could explain the loss of most regulatory proteins in recently established insect symbionts and suggests that the advantages gained by the inactivation of these regulators following host association are greater than the 6 costs of their loss (Hottes et al. 2013). The elimination of regulators from symbiont genomes makes sense given that symbionts inhabit a relatively constant environment where the need for regulatory proteins that respond to environmental dynamism is limited. Furthermore, the inactivation of global regulators could function as a mechanism of rapid adaptation following the onset of symbiosis by disrupting existing deleterious regulatory networks in an effort to quickly adapt to the new host environment. References Andersson SG, Kurland CG. 1998. Reductive evolution of resident genomes. Trends Microbiol. 6:263-8. Akman Gündüz E, Douglas AE. 2009. Symbiotic bacteria enable insect to use a nutritionally inadequate diet. Proc Biol Sci. 276:987-91. Bader MW, Sanowar S, Daley ME, Schneider AR, Cho U, Xu W, et al. 2005. Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell 122:461– 472. Balleza E, López-Bojorquez LN, Martínez-Antonio A, Resendis-Antonio O, LozadaChávez I, Balderas-Martínez YI, et al. 2009. Regulation by transcription factors in bacteria: beyond description. FEMS Microbiol Rev. 33:133-51. Bijlsma JJ, Groisman EA. 2003. Making informed decisions: regulatory interactions between two-component systems. Trends Microbiol. 11:359-66. Buchner P. 1965. Endosymbiosis of animals with plant microorganisms. [Revised English [Translation by Bertha, Mueller with the collaboration of Frances H. Fockler, editor]. New York: Interscience Publishers. Chari A, Oakeson KF, Enomoto S, Jackson DG, Fisher MA, Dale C. 2015. Phenotypic c haracterization of Sodalis praecaptivus sp. nov., a close non-insect-associated member of the Sodalis-allied lineage of insect endosymbionts. Int J Syst Evol Microbiol. 65:1400-5. Dale C, Moran NA. 2006. Molecular interactions between bacterial symbionts and their hosts. Cell. 126:453-65. 7 Douglas AE. 1989. Mycetocyte symbiosis in insects. Biol Rev Camb Philos Soc. 64:40934. García Véscovi E, Soncini FC, Groisman EA. 1996. Mg2+ as an extracellular signal: environmental regulation of Salmonella virulence. Cell 84:165-74. Hedges LM, Brownlie JC, O'Neill SL, Johnson KN. 2008. Wolbachia and virus protection in insects. Science. 322:702. Hottes AK, Freddolino PL, Khare A, Donnell ZN, Liu JC, Tavazoie S. 2013. Bacterial adaptation through loss of function. PLoS Genet. 9:e1003617. McCutcheon JP, von Dohlen CD. 2011. An interdependent metabolic patchwork in the nested symbiosis of mealybugs. Curr Biol. 21:1366-72. Oliver KM, Russell JA, Moran NA, Hunter MS. 2003. Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc Natl Acad Sci U S A. 100:18037. Perez JC, Shin D, Zwir I, Latifi T, Hadley TJ, Groisman EA. 2009. Evolution of a bacterial regulon controlling virulence and Mg(2+) homeostasis. PLoS Genet 5:e1000428. Plague GR, Dunbar HE, Tran PL, Moran NA. 2008. Extensive proliferation of transposable elements in heritable bacterial symbionts. J Bacteriol. 190:777-9. Pontes MH, Smith KL, De Vooght L, Van Den Abbeele J, Dale C. 2011. Attenuation of the sensing capabilities of PhoQ in transition to obligate insect-bacterial association. PLoS Genet 7:e1002349. Prost LR, Daley ME, Le Sage V, Bader MW, Le Moual H, Klevit RE, Miller SI. 2007. Activation of the bacterial sensor kinase PhoQ by acidic pH. Mol Cell 26:165-74. Prost LR, Miller SI. 2008. The Salmonellae PhoQ sensor: mechanisms of detection of phagosome signals. Cell Microbiol 10:576-82. Russell JA, Moran NA. 2006. Costs and benefits of symbiont infection in aphids: variation among symbionts and across temperatures. Proc Biol Sci. 273:603-10. Scarborough CL, Ferrari J, Godfray HC. 2005. Aphid protected from pathogen by endosymbiont. Science. 310:1781. Sloan DB, Moran NA. 2012. Endosymbiotic bacteria as a source of carotenoids in whiteflies. Biol Lett. 8:986-9. 8 Stock AM, Robinson VL, Goudreau PN. 2000. Two-component signal transduction. Annu Rev Biochem. 69:183-215. Teixeira L, Ferreira A, Ashburner M. 2008. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. PLoS Biol. 6:e2. Toh H, Weiss BL, Perkin SA, Yamashita A, Oshima K, Hattori M, Aksoy S. 2006. Massive genome erosion and functional adaptations provide insights into the symbiotic lifestyle of Sodalis glossinidius in the tsetse host. Genome Res. 16: 14956. Wu M, Sun LV, Vamathevan J, Riegler M, Deboy R, Brownlie JC, et al. 2004. Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements. PLoS Biol. 2:E69. 9 CHAPTER 2 A NOVEL HUMAN-INFECTION DERIVED BACTERIUM PROVIDES INSIGHTS INTO THE EVOLUTIONARY ORIGINS OF MUTUALISTIC INSECT-BACTERIAL SYMBIOSES Reprinted with permission from Clayton, A. L. et al. A Novel Human-Infection-Derived Bacterium Provides Insights into the Evolutionary Origins of Mutualistic Insect-Bacterial Symbioses. PLoS Genet 8, e1002990 (2012). 10 11 12 13 14 15 16 17 18 19 20 21 22 23 CHAPTER 3 ADAPTATION BY DELETOGENIC REPLICATION SLIPPAGE IN A NASCENT SYMBIONT Reprinted with permission from Clayton, A. L. et al. Adaptation by Deletogenic Replication Slippage in a Nascent Symbiont. Mol Biol Evol 33:1957-66 (2016). 24 25 26 27 28 29 30 31 32 33 34 CHAPTER 4 THE REGULATION OF ANTIMICROBIAL PEPTIDE RESISTANCE IN THE TRANSITION TO INSECT SYMBIOSIS 35 Abstract Many bacteria utilize two-component systems consisting of a sensor kinase and a transcriptional response regulator to detect environmental signals and modulate gene expression. The response regulator PhoP and its cognate sensor kinase PhoQ compose a well characterized two-component system known for its role in responding to low levels of Mg2+, Ca2+, and pH as well as responding to the presence of antimicrobial peptides and activating the expression of genes involved in adaptation to host association. Compared to their free-living or opportunistic relatives, mutualistic insect symbiotic bacteria inhabit a relatively static environment where the requirement for sensory functions is expected to be relaxed. Previous work shows that the insect symbiont Sodalis glossinidius requires PhoP to resist being killed by host-derived antimicrobial peptides. However, the sensing capability of the S. glossinidius PhoQ is diminished, facilitating constitutive antimicrobial peptide resistance. Here we show that the PhoP-PhoQ system of Sodalis praecaptivus, a close non host-associated relative of S. glossinidius, is capable of sensing Mg2+/Ca2+ and pH to modulate the expression of genes involved in antimicrobial peptide resistance in vitro. However, in an insect host, the S. praecaptivus PhoQ protein is dispensable and bacterial survival is enhanced by the introduction of an S. glossinidius PhoQ ortholog. This work also reveals that a novel MarR-type transcriptional regulator also controls resistance to antimicrobial peptides in vitro and in vivo in S. praecaptivus. Introduction Bacteria must sense the presence or absence of signals in their environment in order to generate appropriate transcriptional responses. Two-component systems are 36 widely used to sense environmental signals and respond by facilitating transcriptional changes in accordance with environmental signal input (Stock et al. 2000). Such systems generally consist of a membrane-bound histidine kinase that senses environmental stimuli such as ions or nutrients. Following detection, the sensor kinase autophosphorylates and transfers its phosphate to a cognate transcriptional response regulator. Most response regulators are capable of freely diffusing through the bacterial cytoplasm and modulating gene expression, usually through interaction with gene promoters (Krell et al. 2010). The ability of a bacterium to sense and modulate transcription provides an adaptive advantage in a dynamic environment where the flexibility provided by a sensory response capability substantially increases the efficiency of resource allocation. Mutualistic symbionts of insects inhabit a relatively static environment, often residing in specialized host tissues and undergoing strict vertical transmission (Wernegreen 2002). Following the transition to symbiotic life, a large fraction of the symbiont genome evolves under relaxed selection and is inactivated and lost, leaving only a minimal suite of genes that is required to survive on the resources provided by the host and to fulfill symbiotic functions (Andersson and Kurland 1998; Dale and Moran 2006; O’Fallon 2008). Consequently, long-established symbionts maintain the smallest genomes characterized to date among bacteria, with many representatives having genome sizes of less than 200 kbp (Nakabachi et al. 2006; McCutcheon and von Dohlen 2011; Bennett and Moran 2013). Many genes involved in regulatory functions are lost early in the process of genome degeneration following the onset of symbiosis (Clayton et al. 2012), presumably because their functions are of limited value (or perhaps deleterious) in a static lifestyle (Shigenobu et al. 2000; Gil et al. 2003; Moran et al. 2005). However, it is 37 clear that the functions of some regulators are maintained, at least for a period of time, following the onset of symbiosis (Toh et al. 2006; Pontes et al. 2008; Pontes et al. 2011; Clayton et al. 2012). The PhoP-PhoQ system of Sodalis glossinidius is one example of a regulatory system that maintains an essential function following the transition to symbiosis. This two-component system is known to control genes involved in nutrient acquisition and virulence in a wide range of facultative pathogenic microbes (Llama-Palacios et al. 2005; Bozue et al. 2011; Gellatly et al. 2012). The functions of PhoQ have been well characterized in Salmonella enterica, where it acts as a sensor of Mg2+ (Perez et al. 2009), Ca2+ (García Véscovi et al. 1996), pH (Prost et al. 2007), and antimicrobial peptides (Bader et al. 2005; Prost and Miller 2008). At high Mg2+ concentrations (10 mM), PhoP is dephosphorylated, whereas at low concentrations of Mg2+ (10 µM), PhoP is phosphorylated by PhoQ. The latter condition drives an increase in expression of genes involved in Mg2+transport (Groisman 2001), virulence, and resistance to low pH and antimicrobial peptides (AMPs; Groisman and Mouslim 2006; Mitrophanov et al. 2008). AMP resistance is facilitated by the modification of LPS by increasing its charge, disrupting electrostatic forces within the LPS and thereby preventing damage caused by host derived AMPs (Guaní-Guerra et al. 2010). Previous work on the PhoP/PhoQ system of S. glossinidius showed that it is required for the bacteria to survive in its insect host by mediating the expression of genes involved in resistance to host AMPs (Pontes et al. 2011). However, S. glossinidius PhoQ lacked the ability to sense Mg2+, pH, and antimicrobial peptides (Pontes et al. 2011). It was hypothesized that an ancestral precursor of the S. glossinidius PhoQ protein likely 38 had a functional Mg2+ sensing capability but that relaxed selection on the sensory capability of PhoQ resulted in the loss of this capability in the symbiotic lifestyle (Pontes et al. 2011). This was predicted to be a consequence of mutations in the metal binding "acidic patch" of the PhoQ protein, which prevent the binding of divalent cations that result in dephosphorylation of PhoP. The recent discovery of a close free-living relative of S. glossinidius, designated S. praecaptivus (Clayton et al. 2012) provides an opportunity to examine the "ancestral" functions of PhoP-PhoQ in this lineage of bacteria. Several Sodalis-allied symbionts (including S. glossinidius) appear to have descended independently from an S. praecaptivus-like ancestor, as evidenced by comparative genomic analyses showing that the symbiont genomes are subsets of this free-living relative (Clayton et al. 2012). In the present study we analyze the sensory capability of the S. praecaptivus PhoP-PhoQ system using in vitro assays of polymyxin B resistance. We then compare the transcriptomes of wild-type (WT) and ∆phoP mutant strains of S. praecaptivus and S. glossinidius to determine if the functions of the PhoP regulon have been modulated in the transition to insect symbiosis. Finally, we compare the abilities of wild type and mutant strains of S. praecaptivus to sustain infection in an insect host that maintains a recently derived Sodalis-allied symbiont and discover an additional (MarR-like) regulatory system that also controls AMP resistance in S. praecaptivus. 39 Results Phylogenetic analysis of phoQ and 16S rDNA In S. enterica, PhoQ functions as a sensor of divalent cations by coordinating the binding of these metals using various conserved acidic residues throughout the protein (Cho et al. 2006; Prost et al. 2008). Inspection of these acidic residues revealed a single region where acidic residues had been lost. This region in particular (located between Glu148 and Asp152 in S. enterica) is composed of 5 tandem acidic residues, which are positioned in the periplasmic domain of PhoQ. This "acidic patch" is best characterized for its role in coordinating the binding the divalent cations including, among others, Mg2+ (Chamnongpol et al. 2003). The change of three of these acidic residues to nonacidic residues in S. glossinidius was anticipated to contribute to its loss of sensitivity to divalent cations (Pontes et al. 2011). In order to determine how the PhoQ sensor of S. praecaptivus compares with S. glossinidius and other Enterobacteriaceae, we performed a phylogenetic analysis of the nucleotide sequence of PhoQ and 16S rDNA in other related bacteria. The phylogenetic tree shows that PhoQ of S. praecaptivus is most closely related to other members of the Sodalis-allied clade of insect symbionts (Figure 4.1). We also performed an amino acid alignment of PhoQ and assessed the content of its "acidic patch." We found that S. praecaptivus maintains an additional acidic residue in this region that is absent in S. glossinidius (Figure 4.1), which may explain its increased sensitivity to PhoQ activating divalent cations. 40 Antimicrobial peptide resistance In order to assess the functionality of the PhoP-PhoQ system in S. praecaptivus, we assayed the abilities of WT and phoP strains to resist the killing effect of the AMP, polymyxin B, in vitro (Figure 4.2). Under all conditions tested, the phoP mutant strain was highly susceptible to polymyxin B, indicating that PhoP-PhoQ play an important role in mediating resistance to AMPs in this bacterium, similar to what has been observed previously in S. glossinidius (Pontes et al. 2011). Wild type S. praecaptivus also showed a small but significant increase in polymyxin B sensitivity when grown in media containing high levels of Mg2+ and Ca2+, similar to what was observed in S. glossinidius previously. This effect was observed in media at both pH 5 and pH 7, although pH did not significantly affect bacterial survival following challenge. It should be noted that AMPs (such as polymyxin B) are known to be capable of displacing Mg2+ cations from PhoQ (Bader et al. 2005), potentially reducing the effects of the different cation concentrations used in our experiment. In order to determine that the loss of polymyxin B resistance was due to inactivation of phoP, we complemented the phoP mutant strain with a plasmid expressing phoP under the control of an IPTG inducible promoter. Notably, polymyxin resistance was restored when this strain was grown in the presence of the inducing agent (0.1 mM IPTG). Transcriptome analysis In facultative pathogens, PhoP is activated in low Mg2+, low pH, and in the presence of antimicrobial peptides (Prost and Miller 2008) where it responds by activating genes involved in resistance to AMPs, type III secretion, and magnesium 41 transport (Prost and Miller 2008). Based on qPCR analysis of select PhoP-regulated genes and assays of AMP resistance, it was previously demonstrated that the S. glossinidius PhoQ is insensitive to changes in the levels of Mg2+. This results in the constitutive PhoP-mediated activation of genes involved in AMP resistance and type III secretion so that a phoP mutant is unable to survive following microinjection into an insect host (Pontes et al. 2011). In order to determine the genome-wide regulatory capability of PhoP and to understand changes that have been mediated in its regulatory network in the transition to symbiosis, we performed transcriptomic analysis of WT and phoP mutants of S. praecaptivus and S. glossinidius following growth in media containing high (10 mM) or low (10 µM) Mg2+ and Ca2+ at pH 7 or pH 5. The resulting data was then analyzed in pairwise conditional comparisons to delineate PhoP-dependent and PhoP-independent transcriptional changes that take place as a consequence of changes in the concentrations of Mg2+/Ca2+ and pH. Significant differences in gene expression were observed in all pairwise comparisons. Figure 4.3 shows the numbers of genes undergoing a log2fold change in expression > 2 in response to a change in cation concentration, pH or bacterial genotype. The most striking observation is that both S. glossinidius and S. praecaptivus have similar numbers of genes whose expression changes in accordance with the concentration of Mg2+/Ca2+ in the culture media despite the fact that S. glossinidius has lost over half of its ancestral genes (Figure 4.3). This effect is most apparent at pH 5 and almost exclusively represents genes that are up regulated in low Mg2+/Ca2+ conditions, which is consistent with the known functionality of the PhoP-PhoQ system (Prost and Miller 2008). In this context, it is notable that this effect is only observed in the pairwise comparisons 42 conducted on data derived from WT strains, which strongly suggests that it is a consequence of PhoP-mediated signaling in both bacterial species. In S. praecaptivus we observed many PhoP-dependent transcriptional changes occurring as a consequence of a change in pH at a low cation concentration. However, the pH-mediated changes observed in S. glossinidius occurred at both low and high cation concentrations and are largely PhoP-independent, based on the fact that similar numbers of genes show significant changes in expression in both the WT and phoP mutant strains. Pairwise analyses of gene expression changes between WT and phoP mutants grown in the same conditions (Figure 4.3; inset) shows that the S. glossinidius PhoP-PhoQ system modulates the expression of similar numbers of genes under both low and high Mg2+/Ca2+ concentrations, with increased numbers of genes showing changes in expression at pH 7. This is in contrast to S. praecaptivus, in which most PhoP-mediated changes were observed to occur in low pH with a low level of Mg2+/Ca2+ (Figure 4.3). The S. praecaptivus data is consistent with the canonical role of PhoP-PhoQ modulating expression of genes under conditions of low pH and low levels of Mg2+/ Ca2+, whereas the data for S. glossinidius indicate that its PhoP-PhoQ system has a modified function that lacks sensitivity towards these conditions. In order to further understand the role of PhoP-PhoQ in S. praecaptivus and S. glossinidius, we manually inspected the transcriptomic data to identify changes that impact known PhoP-regulated functions and genes sharing similar functions (Figure 4.4). This analysis revealed that genes involved in Mg2+ transport (mgtCB) are highly expressed in WT S. glossinidius at low pH, but that this expression is reduced in the presence of high concentrations of Mg2+/Ca2+. However, it is notable that both the mgtC 43 and mgtB genes in S. glossinidius are pseudogenes that are disrupted by mutations, indicating that the role of PhoP in driving their expression is a relic of a bygone lifestyle, as described previously (Pontes et al. 2011). This is supported by the fact that the intact mgtC and mgtB Mg2+ transport genes in WT S. praecaptivus display significant activation by PhoP under conditions of low pH and low Mg2+/ Ca2+. However, S. praecaptivus exhibits a strong pH dependent ability to significantly change the expression of mgtC and mgtB in the absence of PhoP, suggesting that there are additional regulatory mechanism(s) controlling expression of these genes. In support of this prediction, the mgtCB operon of S. enterica is known to undergo increased expression in response to acid pH (Smith et al. 1998). Genes involved in LPS modification (and AMP resistance) in S. glossinidius, aside from ugd (pmrE) also depend on PhoP for their activation under conditions of low pH and low levels of Mg2+/Ca2+. However, it is interesting that many of these genes also exhibit a significant increase in expression at high Mg2+/Ca2+ levels at pH 7. This represents a novel adaptation in S. glossinidius, which is not observed in S. praecaptivus, in which the majority of LPS modification genes are most strongly activated by low pH. This observation prompted us to identify other regulatory genes involved in activating AMP resistance in S. praecaptivus, which is discussed later. Analysis of type III secretion genes in S. glossinidius shows that a large fraction of genes in the ysa-island are responsive to a change in pH in a PhoP-dependent manner. However the type III secretion system genes of S. praecaptivus seem to exhibit a much broader response to PhoP, and changes in expression are responsive to both pH and the levels of Mg2+/Ca2+. Similarly, genes involved in flagellar motility are generally more 44 responsive to PhoP-mediated activation in S. praecaptivus, whereas changes in the expression of these genes in S. glossinidius seem to be enhanced in the absence of PhoP. Interestingly, our analysis reveals that S. glossinidius, but not S. praecaptivus, shows significant upregulation of genes involved in sulfate transport and cysteine biosynthesis in 10 mM Mg2+/Ca2+ at pH 5, which is independent of PhoP. CysP, CysU, CysW, and CysA together make up a sulfate/thiosulfate permease known as SulT (Aguilar-Barajas et al. 2011). Once inside the cell, CysD, CysN, CysC, CysH, CysJ, and CysI convert sulfate into hydrogen sulfide, which can then be added to O-acetyl-L-serine by CysK to produce L-cysteine (Aguilar-Barajas et al. 2011). The expression of this system appears to represent a unique adaptation in S. glossinidius, possibly to enhance cysteine biosynthesis for its host, or to mediate increased resistance to oxidative stress (MacLeod et al. 2007) via glutathione production, which is dependent on L-cysteine. Curiously, MetK is also upregulated in S. glossinidius under the same conditions as the cysteine biosynthesis genes discussed above, although the remaining methionine biosynthesis genes are not (Figure 4.4). MetK catalyzes the synthesis of Sadenosoylmethionine, which can also act as an antioxidant (Cavallaro et al. 2010). We also inspected genes involved in a more general stress response to determine if they are also upregulated in any of our transcriptomic data. To this end, we observed that many other genes involved in stress response in S. glossinidius exhibit significant upregulation in response to pH, relative to S. praecaptivus, albeit in a largely PhoP-independent manner (Figure 4.4). 45 Insect infection assays involving phoP and phoQ mutants The insect immune system combats invading pathogenic microbes by producing and secreting AMPs (Lemaitre and Hoffmann 2007). Some recently derived insect symbionts such as S. glossinidius are known to inhabit multiple host tissues, including the haemolymph (Cheng and Aksoy 1999), where they encounter host AMPs. The maize weevil Sitophilus zeamais maintains a symbiont that is a very close relative of S. praecaptivus and S. glossinidius known as Sitophilus zeamais primary endosymbiont (SZPE; Heddi et al. 1999). Unlike S. glossinidius, SZPE resides in a specialized host tissue known as the bacteriome, which contains a specialized set of immune factors that control the size of the symbiont population (Anselme et al. 2008). It was also demonstrated that the weevil host could produce an immune challenge to SZPE cells when microinjected into the haemolymph (Anselme et al. 2008). Thus, we chose to use S. zeamais for an in vivo immune challenge to assess the abilities of WT, ∆phoP, and ∆phoQ mutant strains of S. praecaptivus, as well as S. praecaptivus with its native phoQ replaced with the S. glossinidius ortholog (Sg-phoQ), to maintain infection following intrathoracic microinjection. This yielded several surprising results (Figure 4.5): First, the S. praecaptivus ∆phoQ null strain demonstrated no significant reduction in its ability to persist in vivo in the insect host. Second, the S. praecaptivus strain that was engineered with an S. glossinidius phoQ ortholog maintained larger numbers of cells in the insect. Together these observations indicate that while the WT S. praecaptivus PhoQ does not play any significant role in mediating survival in vivo, the S. glossinidius phoQ ortholog seems to enhance survival, possibly due to its altered sensing capability. In addition, the fact that the ∆phoP mutants only demonstrated a reduction in persistence in the insect 46 (and were not totally eliminated), suggested that S. praecaptivus has another means to activate genes involved in AMP resistance in vivo. Identification of a novel AMP resistance regulator in S. praecaptivus PhoP is known to regulate genes involved in LPS modifications that mediate resistance to AMPs (Mitrophanov et al. 2008; Pontes et al. 2011). However, the results of our in vivo assays suggested that AMP resistance genes might be subject to control by a PhoP-independent mechanism in S. praecaptivus. In order to understand this mechanism, we screened a library comprising greater than 34,000 S. praecaptivus transposon Tn5 mutants in order to identify genes that facilitate polymyxin B resistance in vitro. Following replica plating of mutants on non-selective media and media containing polymyxin B, nine polymyxin B sensitive mutants were recovered. The Tn5 insertion sites within these mutants were then identified using an inverse PCR and sequencing approach. Only one mutant was identified that contained a disrupted phoP allele. The remaining eight Tn5 mutants were found to contain insertions in the promoter region or coding sequence of a gene designated Sant_4061 in the S. praecaptivus genome annotation (Figure 4.6). In order to validate this finding, we confirmed that an independently generated knockout of Sant_4061 is sensitive to polymyxin B. Furthermore, resistance to polymyxin B was restored following complementation with Sant_4061+ in trans. According to domain-based (Finn et al. 2014) and structural prediction analyses (Zhang 2008), Sant_4061 is a member of the MarR (multiple antibiotic resistance regulator) family of transcriptional regulators (Figure 4.7). Members of this family are 47 regulators (typically repressors) that control the expression of genes involved in host immune resistance (Spory et al. 2002; Stapleton et al. 2002; Shi et al. 2004), antibiotic resistance (Poole et al. 1996), the oxidative stress response (Sukchawalit et al. 2001), and catabolism of aromatic compounds (Providenti and Wyndham 2001; for review see Wilkinson and Grove 2006). The abundance of Sant_4061 mutants in our screen prompted us to check the representation of these mutants in our Tn5 library. Highthroughput sequence analysis of the Tn5 library shows that the Sant_4061 mutants are highly represented in the library prior to the polymyxin B plate-based selection experiment (Figure 4.6). This suggests that the inactivation of Sant_4061, or disruption of its promoter sequence, provides an adaptive advantage for growth in LB medium. This was confirmed by growth assays in LB media where an independently generated ∆Sant_4061 mutant demonstrated a 39% increase in fitness over the WT strain (Figure 4.6, panel B). Insect infection assays involving Sant_4061 mutants After identifying the role of Sant_4061 in S. praecaptivus as an important determinant of AMP resistance, we sought to determine its role in mediating survival in an insect host. This was achieved by comparing the abilities of WT, ∆Sant_4061, and a ∆phoP+∆Sant_4061 double mutant to persist in Sitophilus zeamais following intrathoracic microinjection. The ∆Sant_4061 mutant displayed a significant reduction in its ability to persist in an insect host, relative to the WT strain (Figure 4.5). However, only the ∆phoP+∆Sant_4061 double mutant was completely defective in its ability to persist in vivo. This indicates that phoP and Sant_4061 each play an important role in 48 vivo in S. praecaptivus, including driving the expression of genes involved in AMP resistance. Discussion In this study we compared the sensory and regulatory capabilities of the twocomponent PhoP-PhoQ system in the insect symbiont S. glossinidius and its free-living relative S. praecaptivus. In a previous study it was hypothesized that the ability of PhoQ to sense divalent cations had been attenuated in S. glossinidius in transition to an obligate static lifestyle in its insect host. This was based on the notion that the S. glossinidius PhoQ is not responsive to changes in the levels of divalent cations, and that a Mg2+binding patch in the PhoQ sensor protein is lacking in acidic amino acid residues that are known to participate in cation binding (Pontes et al. 2011). S. praecaptivus is the only non insect-associated member of the Sodalis-allied clade of insect symbionts and analysis of its genome sequence shows that it has not undergone any of the characteristic changes associated with genome degeneration in symbiotic life. Experimental comparisons between S. praecaptivus and S. glossinidius therefore provide an opportunity to characterize the molecular changes that accompany the transition from a free-living to symbiotic state. Analysis of the PhoQ sensor protein in S. praecaptivus reveals that it maintains one additional acidic amino acid residue in its sensory domain in comparison to its counterpart in S. glossinidius. This occurs as a result of a G > A transition that changes an aspartic acid residue at position 151 to an asparagine. Based on an alignment of PhoQ homologues from related Enterobacteriaceae that includes the weevil symbiont 49 Candidatus Sodalis pierantonius, this mutation occurred only in the lineage leading to S. glossinidius, which is consistent with the notion that it is an adaptive mutation that has modulated the functionality of PhoQ in the S. glossinidius-tsetse fly symbiosis to ensure constitutive expression of genes facilitating AMP resistance. Based on assays of AMP resistance in vitro, the PhoQ homolog of S. praecaptivus is capable of sensing divalent cations under both acidic and neutral conditions. Transcriptomic analyses confirm this finding, indicating that the S. praecaptivus PhoQ is adept at sensing conditions of low pH and low levels of Mg2+/Ca2+, which is typical of PhoQ function in a wide range of bacteria. However, the transcriptomic analyses focusing on S. glossinidius suggest that its PhoP-PhoQ system lacks the ability to differentiate between different conditions. It is interesting to note that the S. glossinidius PhoP-PhoQ system still seems to play a role in driving the expression of large numbers of genes (Figure 4.3, inset), however this effect is greatest at pH 7 regardless of Mg2+/Ca2+ concentration, supporting the observation that the PhoP-PhoQ system has undergone modifications that limit its ability to respond to canonical signals and instead results in a constitutive expression profile of PhoP-regulated genes in this organism. Moreover, it should be noted that the PhoQ of S. glossinidius can respond to changes in divalent cation concentrations, as we observed in the transcriptomic profile of the pseudogenes mgtC and mgtB, which are activated in low levels of divalent cations, but only at pH 5. This requirement of low pH for the expression of mgtCB may be a consequence of the loss of acidic residues in the Mg2+-sensing "acidic patch" of PhoQ, whose Mg2+-binding capability might be enhanced at a lower pH. Alternatively, the activation of the mgtCB operon at low pH could also be a more widely conserved characteristic among 50 Enterobacteriaceae in general. We also observed unique PhoP-independent responses to changes in Mg2+/Ca2+ in S. glossinidius, including the activation of pathways involved in cysteine and Sandenosylmethionine production. The activation of these pathways in S. glossinidius may reflect a requirement to either limit oxidative stress in the bacteria or to increase production of cysteine for its insect host. Other pathways involved in stress response were also activated uniquely in S. glossinidius. However, neither the cysteine biosynthesis nor the stress response pathways exhibit a dependence on PhoP for their expression, identifying these as additional novel adaptations that likely result from obligate host association. The PhoP-PhoQ system is known to influence the expression of both type III secretion and motility genes in S. enterica (Adams et al. 2001; Beuzón et al. 2001), and we observed a larger number of these genes in S. praecaptivus that displayed dependence on PhoP for their expression. The small number of type III secretion and motility genes influenced by PhoP in S. glossinidius likely reflects a regulatory decoupling of PhoP from the regulation of these genes in the symbiosis. The static host environment encountered by S. glossinidius is anticipated to have driven modifications in PhoP-PhoQ such that the system constitutively activates the expression of AMP resistance genes. In this study, we determined that the expression of PhoP-regulated genes in S. praecaptivus could be modulated by either pH or changes in Mg2+/Ca2+ concentration. However, while an S. praecaptivus phoP mutant was found to be sensitive to AMPs in vitro, it was still capable of persisting in an insect host (in the presence of AMPs), unlike its S. glossinidius counterpart. In addition, an S. praecaptivus phoQ showed no significant difference relative to the wild type strain in its ability to 51 persist in an insect host, suggesting that there is no requirement for signaling between PhoQ and PhoP to mediate AMP resistance in the insect host. Furthermore, our results show that the replacement of the phoQ allele in S. praecaptivus, with its S. glossinidius counterpart, actually enhances bacterial survival in vivo. This suggests that modifications (mutations) in the S. glossinidius PhoQ protein have improved the capability of this protein to serve as a driver for PhoP-mediated activation of genes important for survival in the insect. This could be due to changes in the sensory capability of PhoQ, as postulated previously (Pontes et al. 2011), perhaps by negating the impact of a negative sensory interaction. Notably, there are several amino acid substitutions between the PhoQ homologs of S. praecaptivus and S. glossinidius and it will be of interest to delineate which one(s) are responsible for the change in functionality. Our work also revealed that PhoP is not the only transcriptional regulator involved in driving the expression of genes involved in AMP resistance in S. praecaptivus. By screening a Tn5 mutant library for AMP sensitive mutants, we identified a novel regulator (Sant_4061) that is also needed for AMP resistance in vitro. This protein is a member of the MarR family of transcriptional regulators that are found in a wide range of bacteria and respond to myriad environmental and intracellular signals to modulate gene expression. Consequently, a ∆phoP ∆Sant_4061 double mutant strain of S. praecaptivus was found to be incapable of persisting in an insect host. Interestingly, orthologs of Sant_4061 are maintained in S. glossinidius and other Sodalis-allied symbionts, based on BLAST analysis. However, a phoP mutant strain of S. glossinidius was found to be completely defective in vivo (Pontes et al. 2011), suggesting that AMP resistance is not backed up by Sant_4061 in that symbiont. 52 The transition from a free-living lifestyle to obligate host association is often accompanied by the loss of genes that provide an adaptive advantage in the free-living state but are no longer required in symbiosis. This includes genes encoding sensory and regulatory functions that have little adaptive value in a lifestyle in which the environment remains static. While PhoP is still required to drive the expression of important symbiotic determinants in the insect symbiont S. glossinidius, it has clearly undergone changes in its regulatory capabilities. In addition, its cognate sensor, PhoQ, has undergone changes that have apparently enhanced its function in an insect host. These results provide an example of how the process of evolution can modulate the functions of two-component regulatory systems to maintain their adaptive value in accordance with changes in signaling molecules. Materials and Methods Culture conditions Bacterial strains used in this study are listed in Table 4.1. Sodalis praecaptivus str. HS1 was grown at 30°C in LB or at 25°C in a defined medium composed of 6 g/L casamino acids, 4 g/L glucose, 0.2 g/L KCl, 7.0 g/L NaCl, 0.12 g/L NaHCO3, 0.18 g/L, 0.18 g/L NaH2PO3, 10 mg/mL of thiamine, 10 mM or 10 mM of CaCl2, 10 µM or 10 mM MgCl2, and pH 5 or pH 7. When indicated antibiotics were added at the following concentrations unless otherwise indicated: 50 µg mL-1 polymyxin B, 40 µg mL-1 spectinomycin, 30 µg mL-1 chloramphenicol, 50 µg mL-1 streptomycin, 10 µg mL-1 gentamicin or 30 µg mL-1 kanamycin. Sodalis glossinidius was maintained at 25°C in the semidefined liquid Mitsuhashi-Maramorosch (MM) medium as described previously 53 (Dale and Maudlin 1999) or in the same defined media described above. Phylogenetic analysis Sequence alignments were generated using MUSCLE (Edgar, 2004) for the phoQ and 16S rRNA genes from S. praecaptivus, Ca. S. pierantonius, S. glossinidius, Dickeya solani, Yersinia mollaretii, and Salmonella enterica. Alleles used in this study were retrieved from Genbank under the following accession numbers: S. praecaptivus phoQ and 16S (CP006569.1), Ca. S. pierantonius phoQ and 16S (CP006568.1), S. glossinidius phoQ (AP008232.1) and 16S (NR_074525), Dickeya solani phoQ (AMWE01000003.1) and 16S (NZ_AMWE01000004.1), Yersinia mollaretii phoQ (NZ_CQDS01000001.1) and 16S (NZ_CQDS01000018.1), Salmonella enterica phoQ and 16S (NC_003197.1). PhyML (Guindon et al. 2010) was then used to construct phylogenetic trees using the HKY85 (Hasegawa et al. 1985) model of sequence evolution with 25 random starting trees and 100 bootstrap replicates. Sequences of the putative Mg2+-binding region were added below each strain name on the PhoQ tree. Construction of phoP and phoQ knockouts A plasmid construct consisting of approximately 500 bp of homologous sequence up and downstream of phoP with an internal kanamycin cassette was commercially produced (Genscript). Plasmid template was used for PCR amplification of the knockout construct. PCR products were gel purified to remove residual plasmid template using the QIAquick Gel Extraction Kit (Qiagen). A construct consisting of approximately 200 bp of homologous sequence up and downstream of phoQ with an internal spectinomycin 54 cassette was amplified and joined together using PCR as described previously (Shevchuk et al. 2004) using Phusion polymerase (Thermo Fisher). PCR products were then cleaned using AMPure XP magnetic beads (Beckman Coulter) according to the manufacturer’s recommendations. Replacement of S. praecaptivus phoQ with the S. glossinidius ortholog PCR products consisting of 881 bases upstream and 944 bases downstream of S. praecaptivus phoQ were amplified using GCGGCGATGGTTGATGAATT, the following primers: #156: #177: TTGTGGCGTAACGGAAATAGGGTCATAGAGCCTAGTTAACATCAAAACG, #159: CATGGCGCGATTGGGAAATA, and #178: CAAGCGGCAGGGGCCTCAGCCCGAAGACAACTAAGCCCGGTTATGGGCG. The phoQ gene from S. glossinidius was PCR amplified using the following primers: #175: ATGACCCTATTTCCGTTACGC, #176: TCAGTTGTCTTCGGGCTGAG. These three PCR products were assembled together using PCR as described previously (Shevchuk et al. 2004). The resulting PCR product was then transformed into an S. praecaptivus ∆phoQ strain and transformants were selected on LB plates containing polymyxin B. Transformants were subsequently screened for spectinomycin sensitivity to confirm replacement of the spectinomycin resistance gene. The replacement of phoQ was then confirmed to be complete (and free of unintended mutations) by Sanger sequencing. 55 Transformation of plasmid and knockout constructs WT S. praecaptivus was transformed with pKD3 containing the lambda red recombination genes and transformants were selected on LB agar plates containing appropriate antibiotics. Subsequent gene knockouts were generated as follows: cultures were grown in 25 mL of LB until the OD600 reached 0.4. Arabinose was added (0.5%) to induce expression of lambda red genes followed by an additional 30 mins of growth at 30°C. Cultures were placed on ice for 10 minutes and centrifuged at 6,700 x g for 10 minutes at 4°C and washed twice with ice-cold nuclease free water. Following the washes, the pellet was resuspended in the residual liquid and 80 µl aliquots of cells were transferred to chilled 1.5 mL tubes. 25-100 ng of DNA was added and cells were incubated on ice for 10 minutes. The entire volume was transferred to a chilled 1 mm electroporation cuvette and pulsed with 1.6 kV using an Eppendorf electroporator 2510. Cells were resuspended in 1 mL of LB and allowed to recover for 3 hours shaking (225 rpm) at 30°C. Following recovery, cells were plated on LB agar plates containing the appropriate antibiotic. Complementation of phoP The WT phoP allele was amplified by PCR using the following primers: BamHI_phoP_comp_F1: ATGCGAGTTCTGGTAATAG and HindIII_phoP_comp_R1: AGAACTACGCAGGCTGCAGC. PCR products were cleaned using AMPure XP magnetic beads (Beckman Coulter) according to the manufacturer’s recommendations. PCR product and plasmid pKH66 were digested using BamHI and HindIII FastDigest enzymes (Thermo Fisher). Plasmid was digested by combining 200 ng of plasmid DNA 56 with 1 µl of HindIII enzyme and 1 µl of a 1:140 fold dilution of BamHI enzyme in a 20µl reaction. PCR product was digested by combining 1 µg of plasmid DNA with 1 µl of both HindIII and BamHI enzymes in a 20µl reaction. Both plasmid and PCR digestions were incubated at 37°C for 10 min and 80°C for 5 min. Digested DNA was purified using AMPure XP magnetic beads (Beckman Coulter) according to the manufacturers recommendations and quantified using a NanoDrop Lite (Thermo Fisher). Digested insert and vector were ligated in a 2:1 ratio in a 20 µl reaction using 1 µl of T4 DNA ligase (Thermo Fisher) according to the manufacturers recommendations to produce the complementation plasmid pKH66/phoP+. This plasmid was transformed into the ∆phoP mutant using the aforementioned protocol and transformants were plated on LB plates containing streptomycin and spectinomycin. Transformants were then screened for resistance to polymyxin B. Complementation of Sant_4061 Plasmid pSE526 was made from pCM66 (Marx & Lidstrom 2001) by replacing the region between bases 3771-7486, containing the traA and kanamycin resistance genes, with a gentamycin resistance gene by recombineering in E. coli CD31(Datsenko and Wanner 2000). The Sant_4061+ locus was PCR amplified using the following primers: #1277: GTAAAACGACGGCCAGTGAATTCCGACGACAGGATATCAGGGG and #1278: CAGCTATGACCATGATTACGCCAAGCTTAAAGTAATGCTGTCCGTGCG. Insertion of the Sant_4061+ gene into pSE526 was performed using homologous recombination as described previously (Li & Elledge 2007). The plasmid and PCR 57 product were transformed together into TOP10 E. coli (Thermo Fisher) according to the manufacturer’s recommendations. Transformants were selected in L broth containing gentamicin. Antimicrobial peptide resistance assay Assays were performed using a modified version of a previously described method (Groisman et al. 1992). Briefly, 1 mL aliquots from 4 mL overnight cultures of S. praecaptivus WT and ∆phoP grown in LB were washed twice in 1 mL of 0.85% NaCl. After washing, the aliquots were inoculated in 4 mL of defined media containing 10 µM or 10 mM Mg2+ and Ca2+ at pH 5 or pH 7 and grown for 3 hours at 30°C with shaking (225 rpm). Cultures were then washed twice and resuspended in 1 mL 0.85% NaCl. 100 µl of each culture was diluted and plated on LB agar to determine the initial number of colony forming units (CFUs) in the culture. A negative control without AMP or Polymyxin B was then added to the remaining cells and incubated at room temperature for 1 hour. 100 µl of each culture was again diluted and plated on LB agar. CFUs mL-1 were determined from each condition tested and standard errors were calculated. RNA isolation WT and ∆phoP S. praecaptivus were grown in 20 mL of LB overnight and washed twice with 10 mL of 0.85% NaCl and diluted to an OD600 = 0.01 in 20 mL of defined media. WT and ∆phoP S. glossinidius were grown in stationary 20 mL cultures of MM until the OD600 reached 0.13. Cultures were then placed in an orbital shaker and grown until the OD600 was between 0.3-0.4 then cultures were washed 2x with 10 mL of 58 0.85% NaCl and diluted to and OD600 = 0.01 in 20 mL of defined media. Both S. praecaptivus and S. glossinidius were then grown at 25°C shaking (225 rpm) for 8 hours. Total nucleic acid content was extracted from each culture as described previously (Sung et al. 2003). Following nucleic acid extraction, RNA was purified using the PureLink RNA mini kit (Ambion) according to the manufacturer’s recommendations. To avoid biases in transcriptomic analyses, we excluded any additional rRNA removal steps in our sample preparation. Samples were submitted for library preparation according to the manufacturer's recommendations. Samples were multiplexed in a single HiSeq 2500 lane and sequenced using 50 bp single-end sequencing at the University of Utah sequencing core facility. All experiments were performed in triplicate. Comparative transcriptomics Sequence reads were filtered using NGSQCToolkit (Patel and Jain 2012) using optional settings -l 70 -s 20. Filtered reads were then mapped to the appropriate reference genome using bowtie2 (Langmead and Salzberg 2012) using the --very-sensitive preset. Counts of reads mapping to each gene were generated using HTSeq (Anders et al. 2015) by running htseq-count using the options -s no -a 0 -m intersection-nonempty -t gene. WT and ∆phoP replicate counts files from each condition were combined using custom Perl scripts. Combined counts files were then normalized and compared using DESeq2 (Love et al. 2014). Significant differences in expression were identified as having adjusted p-values less than 0.05. 59 Reannotation of S. glossinidius Prior to the discovery of S. praecaptivus, the annotation of recently established Sodalis-allied symbiont genomes was complicated by large numbers of pseudogenes and insertion sequence elements present in these genomes. Due to this fact, we sought to improve the sensitivity of transcriptomic data from S. glossinidius by reannotating its genome using the manually annotated genome of S. praecaptivus as a guide. This was accomplished using the "transfer annotations" feature built into Geneious version 8.1.7 (Kearse et al. 2012) requiring 75% sequence identity for an annotation to be transferred. This annotation of S. glossinidius was then manually inspected for errors and any unannotated region larger than 100 bp was inspected for coding sequences using Blastx (Camacho et al. 2009). Weevil microinjection and screening Aposymbiotic Sitophilus zeamais weevils were generated by diluting 100 µl of a 10 mg/ml solution of rifampicin dissolved in N,N-Dimethylformamide (DMF) into 2.9 ml of nuclease free water and mixing this solution with 100 g of organic whole yellow corn (Purcell Mountain Farms). After the corn had dried for 16 hours, approximately 100 weevils were added and allowed to oviposit in the corn for one week at 25°C and 62% relative humidity. 5th instar larvae were confirmed to be lacking bacteriome organs (aposymbiotic) by dissection. Newly emerged adults were microinjected by dipping the tips of capillary needles in overnight cultures of cells grown in LB and inserting the tip of the needle on the underside of the insect on the left or right side of the insect, between the middle and hind legs. Insects were maintained on fresh corn following microinjection for 60 14 days. Following incubation, 10 surviving weevils from each group were surface sterilized in a 10% bleach solution for 5 minutes and dried. Insects were homogenized in 100 µl of sterile nuclease-free water and serially diluted and plated on LB. Growth was assessed following a 24 hour incubation at 30° C. Transposon Tn5 mutagenesis WT S. praecaptivus was mutagenized by electroporation with the transposon Tn5 using the EZ-Tn5 method (Epicentre) as follows: 4 mL cultures were grown in LB at 30°C overnight. 25 mL of fresh LB was then added and cultures were grown until the OD600 reached 0.4. Cultures were then placed on ice for 10 minutes followed by centrifugation at 6,700 x g for 10 minutes at 4°C. Cell pellets were then resuspended in 20 mL of ice-cold nuclease free water. Centrifugation was repeated and cells were washed with 10 mL of ice-cold nuclease free water. Centrifugation was repeated and the supernatant was discarded. Cell pellets were resuspended in the residual liquid and placed on ice for 10 minutes. 80 µl aliquots of cells were then mixed with 1 µl of transposon and incubated on ice for 10 minutes. The entire volume was transferred to a chilled 1 mm electroporation cuvette and pulsed with 1.6 kV using an Eppendorf electroporator 2510. Cells were resuspended in 1 mL LB and allowed to recover for 3 hours shaking (225 rpm) at 30°C. Following recovery, cells were spread on LB agar plates containing kanamycin. Mutagenesis was repeated until ~23,000 mutants were obtained. All Tn5 mutants were then combined in LB + kanamycin in a single 50 mL culture and grown overnight at 30°C with shaking (225 rpm). DNA was isolated from a 1 mL aliquot of overnight culture using the DNeasy Blood and Tissue Kit (Qiagen). 1 mL aliquots of the 61 remaining culture were then mixed with 225 µl of sterile 80% glycerol and archived at 80°C for subsequent experiments. Screening Tn5 mutants 100 µl of the Tn5 mutant library was diluted in LB to 10-7 and plated on LB kanamycin. 10,000 mutants were screened by replica printing onto plates containing LB + kanamycin and LB + kanamycin and polymyxin B. Colonies that grew on LB + kanamycin and did not grow on polymyxin B were characterized by inverse PCR to identify the site of Tn5 insertion. Inverse PCR to identify transposon insertions Individual Tn5 mutants were grown overnight in 4 mL cultures of LB with kanamycin at 30°C with shaking (225 rpm). 1 mL aliquots of each mutant were then mixed with 225 µl of sterile 80% glycerol and stored at -80°C. DNA from 1.5 mL of each culture was prepared using CTAB as described previously (Wilson, 2001). 500 ng of DNA was digested using the restriction enzyme HpyCH4IV (NEB) followed by heat inactivation according to the manufacturer's recommendations. 1 µl of digested DNA was then ligated in a 10 µl reaction using T4 DNA Ligase (Thermo Fisher) according to the manufacturer's recommendations. 1 µl of ligated template was then used in a 50 µl PCR reaction using 2X PCR Master Mix GGGTGTTATGAGCCATATTCAACGGG, (Thermo Fisher) and and primers F: R: CATCGATGATGGTTGAGATGTG. Thermocycling conditions were as follows: 95°C for 5 minutes following by 35 cycles of 95°C for 30 seconds, 49°C for 30 seconds, 72°C 62 for 40 seconds followed by 1 cycle of 72°C for 5 minutes. PCR products were visualized in a 1% agarose gel stained with ethidium bromide and purified using AMPure XP magnetic beads (Beckman Coulter) according to the manufacturer's recommendations. Cleaned PCR products were submitted with primer F for Sanger sequencing at the University of Utah sequencing core facility. Chromatograms were analyzed using Geneious version 8.1.7 (Kearse et al. 2012). High throughput sequencing of transposon mutants DNA from the entire pool of Tn5 mutants was submitted for library construction and 50 bp single-end sequencing at the Huntsman Cancer Institute sequencing core at the University of Utah. Library construction was performed as described previously (Subashchandrabose et al. 2013). Briefly, DNA is sheared and sequencing adapters are ligated. Enrichment of transposon-chromosome junctions is performed by PCR using primers that anneal to the 3' end of the transposon and the sequencing adapter. Sequencing is then performed on the HiSeq 2500 using a primer targeting the end of the transposon. Sequence reads were filtered using the NGSQCToolkit (Patel and Jain 2012) using optional settings -l 70 -s 20. High quality reads were separated and trimmed using the "separate reads by barcode" function in Geneious version 8.1.7 (Kearse et al. 2012) to include only reads beginning with the last six bases of the Tn5 transposon. This tool also removes the six bases of transposon sequence from each filtered read. Reads were then mapped to the S. praecaptivus genome using the Geneious mapper with optional settings "minimum overlap identity" 100% and "maximum mismatches per read" 0%. Alignment files in .sam format were exported from Geneious with the "export padded CIGARs" 63 option enabled. Because the Tn5 transposon duplicates a nine base insertion sequence, the alignment file was curated to include only the first or last nine bases of forward or reverse sequence, respectively, using custom Perl scripts. Reads were then counted and visualized according to the first base of the insertion site. Growth curves of S. praecaptivus S. praecaptivus strains were grown overnight in 4 mL cultures of LB shaking (225 rpm) at 30° C. The following morning each culture was diluted to an OD600 = 0.01 in fresh LB or LB + polymyxin B. Cultures were incubated with shaking (225 rpm) at 30° C. OD600 measurements were recorded every hour for 10 hrs. Each strain was grown in triplicate and the average OD600. Error bars show standard error of the mean. Comparison of predicted structures of Sant_4061 and MarR Amino acid sequences from Sant_4061 and MarR from Escherichia coli str. K-12 substr. MG1655 were submitted for structural prediction using the I-TASSER online submission tool (Zhang 2008). Protein structures were aligned using the PyMOL Molecular Graphics System, Version 1.7.4 (Schrödinger LLC). Following alignment each structure was manually placed side-by-side for visual comparison. Sequences are available from GenBank under the following accession numbers: Sant_4061 (CP006569.1), E. coli marR (NC_000913.2). 64 Acknowledgments This work was funded by the National Institutes of Health (Grant No. 1R01AI095736) awarded to C.D. We thank Kelly T. Hughes for providing plasmids used for complementation experiments. References Adams P, Fowler R, Kinsella N, Howell G, Farris M, Coote P, O'Connor CD. 2001. Proteomic detection of PhoPQ- and acid-mediated repression of Salmonella motility. Proteomics. 1:597-607. Aguilar-Barajas E, Díaz-Pérez C, Ramírez-Díaz MI, Riveros-Rosas H, Cervantes C. 2011. Bacterial transport of sulfate, molybdate, and related oxyanions. Biometals. 24:687-707. Anders S, Pyl PT, Huber W. 2015. HTSeq--a Python framework to work with highthroughput sequencing data. Bioinformatics. 31:166-9. Andersson SG, Kurland CG. 1998. Reductive evolution of resident genomes. Trends Microbiol. 6:263-8. Anselme C, Pérez-Brocal V, Vallier A, Vincent-Monegat C, Charif D, Latorre A, et al. 2008. Identification of the weevil immune genes and their expression in the bacteriome tissue. BMC Biol. 6:43. Bader MW, Sanowar S, Daley ME, Schneider AR, Cho U, Xu W, et al. 2005. Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell. 122:461– 472. Bennett GM, Moran NA. 2013. Small, smaller, smallest: the origins and evolution of ancient dual symbioses in a Phloem-feeding insect. Genome Biol Evol. 5:1675-88. Bozue J, Mou S, Moody KL, Cote CK, Trevino S, Fritz D, Worsham P. 2011. The role of the phoPQ operon in the pathogenesis of the fully virulent CO92 strain of Yersinia pestis and the IP32953 strain of Yersinia pseudotuberculosis. Microb Pathog. 50:314-21. Beuzón CR, Unsworth KE, Holden DW. 2001. In vivo genetic analysis indicates that PhoP-PhoQ and the Salmonella pathogenicity island 2 type III secretion system contribute independently to Salmonella enterica serovar Typhimurium virulence. 65 Infect Immun. 69:7254-61. Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL. 2009. BLAST+: architecture and applications. BMC Bioinformatics. 10:421. Cavallaro RA, Fuso A, Nicolia V, Scarpa S. 2010. S-adenosylmethionine prevents oxidative stress and modulates glutathione metabolism in TgCRND8 mice fed a B-vitamin deficient diet. J Alzheimers Dis. 20:997-1002. Chamnongpol S, Cromie M, Groisman EA. 2003. Mg2+ sensing by the Mg2+ sensor PhoQ of Salmonella enterica. J Mol Biol. 325:795-807. Cheng Q, Aksoy S. 1999. Tissue tropism, transmission and expression of foreign genes in vivo in midgut symbionts of tsetse flies. Insect Mol Biol. 8:125-32. Cho US, Bader MW, Amaya MF, Daley ME, Klevit RE, Miller SI, Xu W. 2006. Metal bridges between the PhoQ sensor domain and the membrane regulate transmembrane signaling. J Mol Biol. 356:1193-206. Clayton AL, Oakeson KF, Gutin M, Pontes A, Dunn DM, von Niederhausern AC, et al. 2012. A novel human-infection-derived bacterium provides insights into the evolutionary origins of mutualistic insect-bacterial symbioses. PLoS Genet. 8:e1002990. Dale C, Maudlin I. 1999. Sodalis gen. nov. and Sodalis glossinidius sp. nov., a microaerophilic secondary endosymbiont of the tsetse fly Glossina morsitans morsitans. Int J Syst Bacteriol. 49:267–275. Dale C, Moran NA. 2006. Molecular interactions between bacterial symbionts and their hosts. Cell. 126:453-65. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 97:6640-5. Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32:1792–1797. Finn RD, Bateman A, Clements J, Coggill P, Eberhardt RY, Eddy SR, et al. 2014. Pfam: the protein families database. Nucleic Acids Res. 42:D222-30. García Véscovi E, Soncini FC, Groisman EA. 1996. Mg2+ as an extracellular signal: environmental regulation of Salmonella virulence. Cell. 84:165-74. Gellatly SL, Needham B, Madera L, Trent MS, Hancock RE. 2012. The Pseudomonas aeruginosa PhoP-PhoQ two-component regulatory system is induced upon 66 interaction with epithelial cells and controls cytotoxicity and inflammation. Infect Immun. 80:3122-31. Gil R, Silva FJ, Zientz E, Delmotte F, González-Candelas F, Latorre A, et al. 2003. The genome sequence of Blochmannia floridanus: comparative analysis of reduced genomes. Proc Natl Acad Sci U S A. 100:9388-93. Groisman EA. 2001. The pleiotropic two-component regulatory system PhoP-PhoQ. J Bacteriol. 183:1835–1842. Groisman EA, Heffron F, Solomon F. 1992. Molecular genetic analysis of the Escherichia coli phoP locus. J Bacteriol. 174:486–491. Groisman EA, Mouslim C. 2006. Sensing by bacterial regulatory systems in host and non-host environments. Nat Rev Microbiol. 4:705–709. Guaní-Guerra E, Santos-Mendoza T, Lugo-Reyes SO, Terán LM. 2010. Antimicrobial peptides: general overview and clinical implications in human health and disease. Clin Immunol. 135:1–11. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol. 59:307–321. Hasegawa M, Kishino H, Yano T. 1985. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J Mol Evol. 22:160–174. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 28:1647-9. Heddi A, Grenier AM, Khatchadourian C, Charles H, Nardon P. 1999. Four intracellular genomes direct weevil biology: nuclear, mitochondrial, principal endosymbiont, and Wolbachia. Proc Natl Acad Sci U S A. 96:6814-9. Krell T, Lacal J, Busch A, Silva-Jiménez H, Guazzaroni ME, Ramos JL. 2010. Bacterial sensor kinases: diversity in the recognition of environmental signals. Annu Rev Microbiol. 64:539-59. Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with Bowtie 2. Nat Methods. 9:357-9. Lemaitre B, Hoffmann J. 2007. The host defense of Drosophila melanogaster. Annu Rev Immunol. 25:697–743. 67 Li MZ, Elledge SJ. 2007. Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat Methods. 4:251-6. Llama-Palacios A, López-Solanilla E, Rodríguez-Palenzuela P. 2005. Role of the PhoPPhoQ system in the virulence of Erwinia chrysanthemi strain 3937: involvement in sensitivity to plant antimicrobial peptides, survival at acid pH, and regulation of pectolytic enzymes. J Bacteriol. 187:2157-62. Love MI, Huber W, Anders S. 2014. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15:550. MacLeod ET, Maudlin I, Darby AC, Welburn SC. 2007. Antioxidants promote establishment of trypanosome infections in tsetse. Parasitology. 134:827-31. Marx CJ, Lidstrom ME. 2001. Development of improved versatile broad-host-range vectors for use in methylotrophs and other Gram-negative bacteria. Microbiology. 147:2065-75. McCutcheon JP, von Dohlen CD. 2011. An interdependent metabolic patchwork in the nested symbiosis of mealybugs. Curr Biol. 21:1366-72. Mitrophanov AY, Jewett MW, Hadley TJ, Groisman EA. 2008. Evolution and dynamics of regulatory architectures controlling polymyxin B resistance in enteric bacteria. PLoS Genet. 4:e1000233. Moran NA, Dunbar HE, Wilcox JL. 2005. Regulation of transcription in a reduced bacterial genome: nutrient-provisioning genes of the obligate symbiont Buchnera aphidicola. J Bacteriol. 187:4229-37. Nakabachi A, Yamashita A, Toh H, Ishikawa H, Dunbar HE, Moran NA, Hattori M. 2006. The 160-kilobase genome of the bacterial endosymbiont Carsonella. Science. 314:267. O'Fallon B. 2008. Population structure, levels of selection, and the evolution of intracellular symbionts. Evolution. 62:361-73. Patel RK, Jain M. 2012. NGS QC Toolkit: a toolkit for quality control of next generation sequencing data. PLoS One. 7: 30619. Perez JC, Shin D, Zwir I, Latifi T, Hadley TJ, Groisman EA. 2009. Evolution of a bacterial regulon controlling virulence and Mg(2+) homeostasis. PLoS Genet. 5:e1000428. Pontes MH, Babst M, Lochhead R, Oakeson K, Smith K, Dale C. 2008. Quorum sensing primes the oxidative stress response in the insect endosymbiont, Sodalis 68 glossinidius. PLoS One. 3:e3541. Pontes MH, Smith KL, De Vooght L, Van Den Abbeele J, Dale C. 2011. Attenuation of the sensing capabilities of PhoQ in transition to obligate insect-bacterial association. PLoS Genet. 7:e1002349. Poole K, Tetro K, Zhao Q, Neshat S, Heinrichs DE, Bianco N. 1996. Expression of the multidrug resistance operon mexA-mexB-oprM in Pseudomonas aeruginosa: mexR encodes a regulator of operon expression. Antimicrob Agents Chemother. 40:2021-8. Prost LR, Daley ME, Le Sage V, Bader MW, Le Moual H, Klevit RE, Miller SI. 2007. Activation of the bacterial sensor kinase PhoQ by acidic pH. Mol Cell. 26:165-74. Prost LR, Miller SI. 2008. The Salmonellae PhoQ sensor: mechanisms of detection of phagosome signals. Cell Microbiol. 10:576-82. Prost LR, Daley ME, Bader MW, Klevit RE, Miller SI. 2008. The PhoQ histidine kinases of Salmonella and Pseudomonas spp. are structurally and functionally different: evidence that pH and antimicrobial peptide sensing contribute to mammalian pathogenesis. Mol Microbiol. 69:503-19. Providenti MA, Wyndham RC. 2001. Identification and functional characterization of CbaR, a MarR-like modulator of the cbaABC-encoded chlorobenzoate catabolism pathway. Appl Environ Microbiol. 67:3530-41. Shevchuk NA, Bryksin AV, Nusinovich YA, Cabello FC, Sutherland M, Ladisch S. 2004. Construction of long DNA molecules using long PCR-based fusion of several fragments simultaneously. Nucleic Acids Res. 32:e19. Shi Y, Latifi T, Cromie MJ, Groisman EA. 2004. Transcriptional control of the antimicrobial peptide resistance ugtL gene by the Salmonella PhoP and SlyA regulatory proteins. J Biol Chem. 279:38618-25. Shigenobu S, Watanabe H, Hattori M, Sakaki Y, Ishikawa H. 2000. Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp. APS. Nature. 407:816. Smith RL, Kaczmarek MT, Kucharski LM, Maguire ME. 1998. Magnesium transport in Salmonella typhimurium: regulation of mgtA and mgtCB during invasion of epithelial and macrophage cells. Microbiology. 144:1835-43. Spory A, Bosserhoff A, von Rhein C, Goebel W, Ludwig A. 2002. Differential regulation of multiple proteins of Escherichia coli and Salmonella enterica serovar Typhimurium by the transcriptional regulator SlyA. J Bacteriol. 184:3549-59. 69 Stapleton MR, Norte VA, Read RC, Green J. 2002. Interaction of the Salmonella typhimurium transcription and virulence factor SlyA with target DNA and identification of members of the SlyA regulon. J Biol Chem. 277:17630-7. Stock AM, Robinson VL, Goudreau PN. 2000. Two-component signal transduction. Annu Rev Biochem. 69:183-215. Subashchandrabose S, Smith SN, Spurbeck RR, Kole MM, Mobley HL. 2013. Genomewide detection of fitness genes in uropathogenic Escherichia coli during systemic infection. PLoS Pathog. 9:e1003788. Sukchawalit R, Loprasert S, Atichartpongkul S, Mongkolsuk S. 2001. Complex regulation of the organic hydroperoxide resistance gene (ohr) from Xanthomonas involves OhrR, a novel organic peroxide-inducible negative regulator, and posttranscriptional modifications. J Bacteriol. 183:4405-12. Sung K, Khan SA, Nawaz MS, Khan AA. 2003. A simple and efficient Triton X-100 boiling and chloroform extraction method of RNA isolation from Gram-positive and Gram-negative bacteria. FEMS Microbiol Lett. 229:97-101. Toh H, Weiss BL, Perkin SA, Yamashita A, Oshima K, Hattori M, Aksoy S. 2006. Massive genome erosion and functional adaptations provide insights into the symbiotic lifestyle of Sodalis glossinidius in the tsetse host. Genome Res. 16:14956. Wernegreen JJ. 2002. Genome evolution in bacterial endosymbionts of insects. Nat Rev Genet. 3:50-61. Wilkinson SP, Grove A. 2006. Ligand-responsive transcriptional regulation by members of the MarR family of winged helix proteins. Curr Issues Mol Biol. 8:51-62. Wilson K. 2001. Preparation of genomic DNA from bacteria. Curr Protoc Mol Biol. Chapter 2:Unit 2.4. Zhang Y. 2008. I-TASSER server for protein 3D structure prediction. BMC Bioinformatics. 9:40. 70 Table 4.1. Bacterial strains used in this study Strain Genotype (Source) S. praecaptivus WT (Clayton et al., 2012) S. praecaptivus phoP::kan (this study) S. praecaptivus phoP::spc (this study) S. praecaptivus phoQ::spc (this study) S. praecaptivus Sant_4061::gen (this study) S. praecaptivus phoP::kan+Sant_4061::gen (this study) S. praecaptivus phoQ::S. glossinidius phoQ (this study) S. glossinidius WT (Pontes et al., 2011) S. glossinidius phoP::cat (Pontes et al., 2011) Figure 4.1. Phylogeny of S. praecaptivus and related Sodalis-allied endosymbionts and free-living bacteria based on maximum likelihood analyses of the phoQ coding sequence (1.45 kbp) and 16S rRNA (1.46 kbp). Sequences below strain names on the phoQ phylogeny show the amino acids sequences of the Mg2+-binding site within PhoQ, with acidic residues highlighted in bold. The numbers adjacent to nodes indicate maximum likelihood bootstrap values shown for nodes with bootstrap support > 80%. 71 Figure 4.2. Survival rates of WT and phoP mutant S. praecaptivus after 3 hours of growth in high (H: 10 mM) or low (L: 10 µM) Mg2+ and Ca2+ at pH 5 or 7 followed by a onehour challenge with polymyxin B (50 µg/mL). Error bars represent standard errors. 72 Figure 4.3. Number of genes exhibiting significant expression changes (adjusted p-value < 0.05) and log2fold changes > 2 or < -2 after growth in low (L; 10 µM) or high (H; 10 mM) Mg2+/Ca2+ at pH 5 or pH 7. Pairwise comparisons of WT or a phoP mutant are shown below, while comparisons of WT and a phoP mutant grown in the same conditions are shown in the inset box. 73 Figure 4.4. Heatmaps depicting log2fold changes in expression of genes involved in adaptation to changes in Mg2+/Ca2+ concentrations and pH as well as other pathways containing large numbers of genes showing significant differences in expression. Conditions being compared in each column are shown at the top. Log2fold differences are colored as an increase (red) or decrease (green) in expression in the second condition relative to the first. Conditions being compared are abbreviated above each column, L5 = 10 µM Mg2+/Ca2+ pH 5, H5 = 10 mM Mg2+/Ca2+ pH 5 etc. Genes are grouped by broad functional categories that exhibited significant changes in our data. Statistically significant log2fold changes (adjusted p-value < 0.05) are marked with a white asterisk in the top right corner of the box. Pseudogenes are marked by a white "x" in the lower left corner of the box. 74 75 Figure 4.5. Survival of S. praecaptivus following 14-day incubation post microinjection in SZPE. 76 Figure 4.6. Distribution and sequence coverage of Tn5 mutants in the S. praecaptivus genome are depicted as a histogram (A, Upper). Note that mutations affecting Sant_4061 are the most abundant in the library, following growth in LB media. The zoomed in regions of the histogram reveal the distribution and abundance of Tn5 mutants in the genomic regions encoding phoPQ and Sant_4061 (in red), with the mutants recovered in the screen for polymyxin B sensitivity highlighted in orange, with the number of recovered mutants shown above each column. Growth curves for WT S. praecaptivus and Sant_4061 and phoP mutants grown in either LB or LB + Polymyxin B (PB) for 10 hours (B). Standard errors are shown above and below the average of three replicates at each time point. Figure 4.7. Structural prediction of Sant_4061 (left) and MarR (E. coli; right). Structures are colored from N to C termini in red to blue respectively. The DNA-binding helix-turnhelix domain is located at the bottom of each predicted structure. 77 CHAPTER 5 GLOBAL GENE REGULATION CONSTRAINS MICROBIAL ADAPTATION 78 Abstract Bacteria colonize an extraordinary variety of environmental niches, including the living tissues of many plants and animals. The successful colonization of a novel environment depends in part on the ability of an organism to modulate its gene expression in accordance with environmental conditions. However, when bacteria transition from a generalist to specialist lifestyle, they often undergo a process of genome degeneration that is accompanied by the loss of genes encoding transcriptional regulators. In this study we analyze the fate of a population of bacteria that were subjected to genome-wide transposon mutagenesis and then transferred into a range of static, novel environments. By analyzing the frequencies of mutants in the population before and after transfer, we determine the identity of genes that yield positive and negative effects on fitness. Strikingly, we found that the inactivation of genes encoding transcriptional regulators, particularly those with global regulatory functions, often confer an adaptive advantage following transition to a novel, static environment. While global gene regulation is expected to provide an energetically favorable means to facilitate large-scale changes in gene expression, our results show that it can also constrain fitness as a consequence of transcriptional misdirection in novel environments. The loss of genes encoding global regulators is therefore expected to provide substantial fitness advantages following the transition to a novel lifestyle, as occurs during obligate host-association. Introduction Genome sizes vary widely among bacteria, ranging from just over 100 kbp to more than 16 Mbp (NCBI Genome Browse; Bennett and Moran 2013). The size of a 79 bacterial gene inventory determines its metabolic and phenotypic plasticity in that bacteria with larger genomes can persist in more dynamic and diverse environments as a consequence of their ability to utilize different nutrients and adjust to environmental changes (Helmann 2002; Cases et al. 2003; Konstantinidis and Tiedje 2004). In addition, bacteria with larger gene inventories tend to maintain more genes that perform sensory and regulatory functions (Konstantinidis and Tiedje 2004; Hottes et al. 2013), which help to maintain an optimum profile of gene expression in accordance with environmental circumstances (Cases et al. 2003; Ralston 2008; Pérez-Rueda et al. 2009; Rivera-Gómez et al. 2011). Bacteria with smaller genomes, such as obligate intracellular pathogens and mutualists, maintain relatively few regulatory systems (Moran 2002; Dinan et al. 2014), presumably reflecting relaxed selection on the requirement to modulate gene expression in a static symbiotic lifestyle (Merhej et al. 2009; Pérez-Rueda et al. 2009). In bacteria, gene expression is modulated by proteins that sense stimuli and transduce signals through regulatory networks that ultimately yield adaptive changes in gene expression (Ralston 2008; Balleza et al. 2009). Gene expression changes are mediated by the ability of regulatory proteins to modulate the physical transcriptional landscape, either directly or indirectly, in a site-specific manner that is mediated at a level that ranges from local to global (Balleza et al. 2009). Local regulation affects only a single metabolic or biochemical process and is often mediated by a single transcription factor that modulates the transcription of an individual gene or an operon containing genes that contribute a common function. One archetypal example is the lac operon, which is controlled transcriptionally by the Lac repressor, a protein that negatively regulates genes involved in lactose metabolism in the absence of the inducer, allolactose 80 (Lewis 2005). Global regulators often have pleiotropic functions and can modulate the transcription of large numbers of genes involved in diverse processes. This can be achieved through the use of a regulatory protein that interacts directly with the promoter sequences of a large number of genes, in the same manner as in local regulation. For example, the PhoP transcriptional regulator is responsible for activating genes involved in virulence and adaptation to the host environment (Belden and Miller 1994). PhoP modulates gene expression by binding directly to a 17 bp palindromic repeat located in the promoter region of target genes known as the PhoP-box (Navarre et al. 2005; Zwir et al. 2005). However, PhoP is also known to activate the expression of other regulatory proteins, including the global regulator SlyA, and the two component systems RstA-RstB and PmrA-PmrB (Minagawa et al. 2003; Kato and Groisman 2004). By invoking a cascade of transcriptional regulation, the expression of a large number of target genes can be modulated in response to a single stimulus without requiring PhoP to bind at each gene promoter. Using regulatory cascades, information from multiple signals can be integrated to form a collective response of global gene regulation that is optimized to perform specific cellular tasks or facilitate survival in a certain environment where substantial change in bacterial gene expression would be advantageous (Figure 5.1). Global regulation is anticipated to greatly reduce the energetics and complexity of gene regulation relative to the use of myriad local regulators (Martínez-Antonio and Collado-Vides 2003). However, it lacks the flexibility of local regulation because it is typically responsive to only a single signal in the environment. For example, PhoP is controlled by a sensor kinase, PhoQ, which senses levels of Mg2+ in the exterior 81 environment, primarily as a means to control the transcription of genes involved in Mg2+ transport (Soncini et al. 1996; Kato et al. 1999; Moncrief and Maguire 1999; Zhou et al. 2005). However, since levels of Mg2+ are reduced in the intracellular environment, the PhoPQ system has evolved the capability to also regulate genes involved in virulence, including type III secretion and lipid A modification, which provides resistance to antimicrobial peptides (García Véscovi et al. 1996; Groisman 2001; Kato and Groisman 2008). Thus, global regulators can facilitate the expression of myriad distinct traits in a given environment when a certain signal is encountered. However, if a bacterium encounters a novel environment in which an established signal is present, the resulting “pre-ordained” transcriptional response might be maladaptive in that particular environment. In this study, we explore the adaptive potential for gene loss in Sodalis praecaptivus, which is a progenitor of the Sodalis-allied clade of insect endosymbionts. Previous work has shown that bacteria closely related to S. praecaptivus have developed obligate, symbiotic associations in a wide range of insect hosts (Clayton et al. 2012). Here, we used transposon Tn5 mutagenesis and sequencing (Tn-seq) to characterize bacterial mutants that provide adaptive benefits upon transition to novel environments, including an insect host that normally harbors a very closely related and recently derived associate of S. praecaptivus (Oakeson et al. 2014). Tn-seq is an attractive experimental platform because it can be used to classify genes according to their essentiality in a given environment (van Opijnen et al. 2009). However, in the current study our major goal was to use it as a means to identify null (gene inactivating) mutations that increase in frequency in a population because they provide an adaptive benefit (Hottes et al. 2013). 82 Our initial Tn5 mutant library was assessed by high throughput sequencing of PCRenriched transposon-chromosome junctions and provides a qualitative and quantitative measure of the abundance of each mutant in the population. The S. praecaptivus Tn5 mutant library was then passaged in several novel environments and resequenced to determine the impact of the environmental transition on the mutant population. Strikingly, mutants maintaining Tn5 insertions in genes encoding global transcriptional regulators reached high frequencies in the majority of conditions tested, indicating that the loss of global regulators often provides an increase in fitness in a novel, static environment. These results highlight the antagonistic pleiotropy that arises as a consequence of regulatory misdirection, highlighting the fact that global gene regulation presents a trade-off between operational cost and functional optimality. Results Initial sequencing of the Tn5 library Sequence analysis of the Tn5 mutant library was performed by extracting total DNA from a combined population of mutants. Junctions between the transposon ends and the bacterial chromosome were then amplified and sequenced on an Illumina HiSeq platform to assess the abundance and diversity of the initial library of mutants. Based on post hoc analysis of data from all experiments in this study, the library comprises mutants with Tn5 insertions located in at least 34,268 sites throughout the genome, equating to one Tn5 insertion per 141 bases of genomic DNA (Figure 5.2). Many genes involved in replication, transcription and translation contained no Tn5 insertions, consistent with the notion that they are essential for basic cellular functions and survival. Unexpectedly, 83 mutants in Sant_4061, uvrY, wzb, and flhD increased in frequency immediately after the construction of the mutant library (Figure 5.2A). This could be explained as a consequence of either an increased frequency of insertion of Tn5 elements into these particular loci, or as a result of an increase in fitness that is derived from the disruption of these genes. To test this, we performed a fitness assay comparing the growth rates of independently generated mutants in these four loci with the wild-type (WT) strain that the Tn5 library is derived from (Figure 5.3A). This assay revealed that the ∆flhD, ∆uvrY, and ∆Sant_4061 mutants grew at a significantly faster rate than the WT strain (Figure 5.3A). However, no significant difference was observed between the ∆wzb mutant and the WT strain when grown alone in laboratory media. It is possible that the ∆wzb mutant only shows a growth advantage in a mixed population of mutants in the initial library because it derives factors from members of the population that maintain a functional wzb allele. Notably, Wzb is a phosphotyrosine protein phosphatase involved in regulating the production of the exopolysaccharide (EPS) colanic acid (Vincent et al. 2000). In the absence of wzb, production of EPS is inhibited due to constitutively phosphorylated Wzc (Vincent et al. 2000), likely providing a cost savings in terms of reduced EPS production. In the course of our experiments, we observed that the ΔSant_4061 and ∆flhD mutants did not display the typical swarming motility that is apparent in the WT, ∆uvrY, and ∆wzb strains during growth on LB plates containing 1.5% agar (Figure 5.3B). In order to determine the reason for this loss of motility, we stained these strains to characterize their flagella. We observed that rod-shaped WT cells are coated with many lateral flagella filaments that are lacking in the ∆Sant_4061 and ∆flhD mutants, which both have a coccoid morphology. Furthermore, the ∆Sant_4061 mutant produces polar 84 flagellae, whereas the ∆flhD mutant produced no observable flagellae (Figure 5.3C). This fits with the observation that the WT, ∆uvrY, and ∆wzb strains display swarming motility while the ΔSant_4061 mutant displays swimming motility (Figure 5.3D). According to PFAM (Finn et al. 2014) and BLAST (Camacho et al. 2009) analysis, Sant_4061 shares a high level of sequence identity with members of the MarR family of transcriptional regulators (Wilkinson and Grove 2006), consistent with the notion that it plays a role in gene regulation, which includes the switching of flagellar gene expression. In the context of explaining the fitness advantage of the Sant_4061 mutant, we anticipate that the switch from lateral to either polar or no flagellar expression provides a significant cost savings in terms of transcription and translation because lateral flagella filaments account for a large proportion of cellular protein. In addition, it is conceivable that the growth advantage of the ∆Sant_4061 mutant is enhanced by other changes in gene expression. Unlike the ΔSant_4061 mutant, a ΔuvrY mutant retains its ability to engage in swarming motility (Figure 5.3B), indicating that its growth advantage is derived from an independent trait rather than a switch in phenotype with respect to motility. In Escherichia coli, the UvrY/BarA system regulates the expression of genes involved in carbon metabolism and biofilm formation (Suzuki et al. 2002). Interestingly, it has been shown that E. coli lacking UvrY exhibit an increased rate of growth over their WT counterpart in LB medium due to more efficient utilization of carbon in the form of amino acids and peptides (i.e., gluconeogenic growth; Pernestig et al. 2003). 85 In vitro passage in LB media with different supplements In order to identify adaptive mutations in our Tn5 library, we passaged the library in stationary cultures of LB, with and without a range of additives that were selected in order to impose different selection pressures. Not surprisingly, the passage of the library in LB that had only kanamycin added (simply to select for cells carrying Tn5 insertions and therefore prevent growth of any contaminants) yielded the near fixation of mutants containing insertions within and upstream of Sant_4061, which after twenty days were found to comprise 82.6% of all sequence reads obtained from the high throughput Tn5specific sequencing protocol (Figure 5.4). The fixation of mutants in the Sant_4061 locus confirms the potent growth advantage conferred by the loss of this regulator during growth in LB. In order for a bacterial pathogen to survive in a host it must overcome or evade the host’s immune system. Phagocytic immune cells of animals are known to produce and challenge invading pathogens using H2O2 (Baehner et al. 1975). We therefore sought to determine if there were adaptive Tn5-mediated mutations that yielded a fitness advantage in the presence of this stressor. However, under these conditions, we again found that mutants with Tn5 insertions in Sant_4061 provided the largest fitness gain with 94.0% of reads mapping within and upstream of this locus (Figure 5.4). Of course this does not exclude the possibility that there are adaptive advantages associated with the loss of one or more gene functions in the presence of H2O2, but rather that any such advantages are lost in competition with the Sant_4061 mutant. The immune cells of both plants and animals are also known to produce and secrete antimicrobial peptides (AMPs; Brogden 2005). To identify mutants with the 86 greatest fitness advantage in the presence of AMPs, the Tn5 library was passaged in LB + kanamycin supplemented with either polymyxin B or the insect immune peptide, cecropin A. Notably, in both experiments, the Sant_4061 mutants were eliminated from the population, suggesting that Sant_4061 is required for resistance to AMPs. To validate this notion, we tested the abilities of WT and selected mutant strains of S. praecaptivus to grow in the presence of polymyxin B and cecropin A (Figure 5.5). As expected, the ∆Sant_4061 mutant failed to grow in the presence of either of these AMPs, along with ∆phoP and ∆phoQ mutants, which are known to be susceptible to AMPs based on previous work (Miller et al. 1990; Groisman et al. 1992; Pontes et al. 2011). This indicates that the Sant_4061 regulator controls both flagellar motility and antimicrobial peptide resistance. Analysis of the mutant population recovered following growth in polymyxin B revealed that mutants in each of four alleles displayed a significantly increased frequency in the population (Figure 5.4). The most abundant mutant in the polymyxin B passage contains insertions in a gene encoding predicted glycosyltransferase protein, designated Sant_1157. This locus is organized in an operon upstream of Sant_1158, which encodes an O-antigen ligase that may play a role in the modification of bacterial lipopolysaccharide (LPS) thereby increasing resistance to AMPs. This would make sense as the negatively charged lipid A portion of LPS is a canonical site for cationic AMP interaction with the bacterial membrane (Epand and Vogel 1999). Alternatively, the Sant_1157 mutant may inhibit a modification to LPS by Sant_1158 that otherwise increases susceptibility of the bacterial membrane to damage resulting from polymyxin B (Breazeale et al. 2002). Two of the three remaining most prevalent mutant alleles (slyA 87 and Sant_2323) are both predicted to encode transcriptional regulators, one of which, slyA, is known to have global functions (Linehan et al. 2005). Sant_2324 is located in an operon with the transcriptional regulator Sant_2323, however the function of these genes remains unknown. Although polymyxin B and cecropin A are both amphipathic AMPs, a different profile of mutants was observed following passage in LB containing cecropin A (Figure 5.4). The most abundant mutants in the cecropin A passage contained insertions in the genes wza and wzb. Studies in E. coli and Bacillus subtilis show that these mutants are unable to produce EPS and have increased activity of Ugd, an enzyme involved in the production of UDP-Glucuronic acid (Grangeasse et al. 2003), which is converted into UDP-4-amino-4-deoxy-L-arabinose by the enzymes ArnA and ArnB (Breazeale et al. 2003). The addition of L-Ara4N to LPS by ArnT raises the net charge of the lipid A core thereby changing its propensity to bind AMPs (Trent et al. 2001; Breazeale et al. 2003). Based on our results, it seems likely that such a change reduces the efficiency of binding of cecropin A, but may have the opposite effect with polymyxin B, based on the fact that mutants with Tn5 insertions in the wzb locus were absent in the polymyxin B passage. Another highly represented mutant in the cecropin A passage contained insertions in Sant_3474. This locus encodes a putative regulatory protein of unknown function that shares highest sequence identity with the Cro/CI family of transcriptional regulators. Notably, several other mutants that reached high frequency following passage in the presence of cecropin A also contained Tn5 insertions in genes that are anticipated to encode global regulators, namely Sant_2513, Sant_3179, and regC. 88 Weevil passage S. praecaptivus is the only member of the Sodalis-allied clade of insect endosymbionts to be found outside of an insect host. It is clear that close relatives of this bacterium have established mutualistic associations with a wide range of insect hosts (Clayton et al. 2012). One such association that is predicted to be of very recent origin involves grain weevils and Ca. Sodalis pierantonus (Oakeson et al. 2014). To identify mutations in S. praecaptivus that provide an adaptive advantage in an insect host, we microinjected the Tn5 library into newly emerged adult grain weevils (Sitophilus zeamais) that had been treated three generations prior with an antibiotic, rifampicin, which removed their native symbiont. After three days following injection into an aposymbiotic weevil, bacteria were recovered and processed for Tn-seq. The resulting sequence data shows that the number of Sant_4061 mutants was reduced in comparison to the initial library but remained at a relatively high frequency within the population. Notably, several other mutants had increased greatly in abundance. Since greater than 1 million colony forming units were injected into the weevil and greater than 1 million colony forming units were recovered by plating, the increased abundance of certain mutants is explained by fitness benefits rather than bottlenecking of the Tn5 library. The most abundant of these mutants contains insertions within the regulatory locus Sant_3474, making up 12.7% of all Tn5 sequence reads derived from this population. In addition, there was a high frequency of mutants with Tn5 insertions located in Sant_2513, which encodes another putative regulatory protein. It is interesting to note that mutants with Tn5 insertions in both Sant_3474 and Sant_2513 were also found to have high frequencies in the population following passage in media with cecropin A, 89 implying that these mutants have an advantage under conditions involving challenge with insect immune peptides. We also sequenced the Tn5 library following an 11-day passage in weevils and the resulting data shows an almost complete saturation of mutants with Tn5 insertions in Sant_3474, collectively comprising 99.9% of all sequence reads. In order to assess the validity of this result we injected the Tn5 library into five additional weevils and then plated homogenates from these insects at 11 days following injection. Five bacterial colonies were picked at random from each weevil and the Sant_3474 locus was amplified by PCR to determine if it contained a Tn5 insertion. The results show that 24/25 of the mutants from these weevils had a Tn5 insertion in Sant_3474, indicating that our original result was not simply a chance event and that the loss of the Sant_3474 regulatory system does indeed provide a significant fitness advantage in the insect host. Leukocyte passage Since S. praecaptivus was derived from a human infection, we wondered how the mutant library would be affected by exposure to mammalian leukocytes. Thus, we also passaged the mutant library in media containing mouse bone marrow leukocytes, which are predominantly comprised of neutrophils (Swamydas and Lionakis 2013). These antimicrobial cells are capable of engulfing bacteria and unleashing an arsenal of bactericidal toxins including antimicrobial peptides, lysozyme, oxidants, and proteases (Gallo et al. 1997; Segal 2005). However, certain pathogenic bacteria (including S. praecaptivus) are able to persist inside the phagosomes of these cells (Ernst et al. 1999). To identify mutants with an adaptive advantage in this environment, bacteria from our 90 Tn5 library were introduced into a culture of freshly isolated leukocytes and, after 48 hours, the leukocytes were washed with PBS, homogenized to release intracellular bacteria and greater than 1 million of the resulting colonies were recovered for Tn-seq analysis. In this experiment there were no dominant mutants that rose to a frequency of greater than 0.17% in the entire population. Indeed, this experiment yielded a dataset that was more balanced in terms of mutant diversity than any other in the experiment, including the initial library that served as the seed for this experiment. Of the mutants that did show increased frequency in this library, the most abundant was found to contain insertions in ibpA, which encodes a putative heat shock protein (Kitagawa et al. 2002), though it is unclear how the inactivation of this gene provides an adaptive benefit within cells. The next most abundant mutant contains insertions in the wzb gene, which was also the most abundant mutant in the cecropin A passage, suggesting that it may be advantageous in the leucocytes because it enhances resistance to AMPs. Furthermore, another abundant mutant with insertions in Sant_3179 (encoding a transcriptional regulator) was also abundant following cecropin A passage, suggesting that it provides a similar advantage in AMP resistance. However, the major conclusion from this component of the experiment is that there are few highly adaptive options for gene inactivation in this environment. This may be due to the fact that the gene inventory and regulatory systems of S. praecaptivus are attuned towards survival inside mammalian cells, given that S. praecaptivus was isolated from a vertebrate host (Clayton et al. 2012). 91 Collective analysis of genes encoding putative transcriptional regulators Based on the fact that genes encoding putative transcriptional regulators were often identified as the most highly adaptive null mutants following passage of our Tn5 library, we sought to determine if there was a universal skew in abundance of mutants that carry Tn5 insertions in genes encoding regulatory proteins in S. praecaptivus following our experimental passages. After ranking genes in accordance with numbers of Tn5 insertions, a Mann-Whitney test revealed no significant difference between genes that are anticipated to encode transcriptional regulators versus those with an alternative function. However, more detailed inspection of the data revealed that genes predicted to encode certain transcriptional regulators (often predicted to have global regulatory functions) are often highly represented among those with the most Tn5 hits (Figure 5.6). This provides strong evidence that global regulators often present the highest adaptive options for inactivation following transition to a novel environment. Identification of essential genes Tn-Seq is often used as a means to identify genes that are essential under certain environmental conditions such as host association (Sassetti et al. 2003; Gawronski et al. 2009; Khatiwara et al. 2012; Subashchandrabose et al. 2013; Klein et al. 2015). The rationale is that mutant strains carrying transposon insertions in essential genes will be eliminated from the population by selection. Of course, there are a number of genes in the genome that are essential for survival in any environmental setting because they play a role in core processes of replication, transcription, and translation. Thus, we used a subtractive approach to identify genes that are essential only under certain conditions. 92 This was achieved by pairwise comparison of the Tn-seq datasets from the initial and derived libraries. The rationale is that mutants carrying insertions in genes involved in core processes have already been eliminated by selection in the initial library. Subsequent cultivation of the library in a novel environment should then reveal the identities of genes that are conditionally essential for survival in that environment, based on the notion that these genes will not contain Tn5 insertions. As evidenced in the current study, certain mutants tend to increase in frequency as a consequence of enhanced fitness in the population under selection, skewing the representation of mutants in the library and increasing the likelihood of false discovery of essential genes. This effect can be visualized in scatter plots that show the counts of Tn5 insertions for each gene in the initial and derived libraries (Figure 5.7). In the absence of skew, only a small fraction of genes are expected to undergo changes in the number of Tn5 insertions due to conditional selection, and therefore the majority of points on the scatter plots are expected to fall on the line of equality. Notably, only the comparisons involving the cecropin A, weevil day 3, and mouse leucocyte datasets fulfill this criterion, indicating that the remaining libraries have been subject to skew. To address the issue of false discovery of essential genes due to the aforementioned effects, we tracked the incidence and frequencies of Tn5 insertions in 39 loci that are anticipated to have no adaptive value because they encode pseudogenes that are disrupted by at least one nonsense or frameshifting mutation in the first 75% of their putative coding sequences. This data was used to estimate probabilities of false discovery (FDP) of essential genes based on changes in Tn5 counts and sites between the initial and derived libraries, taking into account both sampling bottlenecks and Tn-seq read counts. 93 As expected, only the cecropin A, weevil day 3, and mouse leucocyte datasets maintain sufficient Tn5 diversity in these pseudogenes relative to the initial library to facilitate discovery of essential genes. However, it should be noted that this analysis does not assess the ability of the experiment to provide sufficient selection against cells that contain Tn5 insertions in essential genes, which is another important element of false discovery. Notably, of these three libraries only the cecropin A and mouse leukocyte datasets contains no Tn5 insertions in either the phoP or phoQ loci, which are anticipated to be essential for survival in these environments (Figure 5.7). Analysis of the weevil day 3 data indicates that Tn5 insertions are eliminated entirely from the phoP coding sequence but not from phoQ. Since PhoP and PhoQ are thought to function in synergy as a two-component system (Garcia Véscovi et al. 1994), this may indicate that the threeday incubation in weevils does not provide a sufficient selection pressure to eliminate all mutants with Tn5 insertions in essential genes. For this reason, we refrain from further discussion of the data derived from the weevil day 3 passage and focus only on the data derived from passage of the mutant library in cecropin A and mouse leukocytes. Inspection of the cecropin A dataset indicates that there are many genes that are known (from experimental studies) to be essential for antimicrobial peptide resistance, including Sant_4061 (Figure 5.5), phoP/phoQ (Bader et al. 2005), and the arn genes (Figure 5.7), which are involved in modifying the lipid A molecule (Trent et al. 2001; Breazeale et al. 2003). These all reside at the top of the list of predicted essential genes and have the highest levels of statistical support. In addition, the list of predicted essential genes is replete with candidates that are anticipated to play a role in membrane/cell wall biogenesis and protein secretion, which makes sense given that 94 antimicrobial peptides are known to interact with bacterial cellular structures (Epand and Vogel 1999). At a broad level, this suggests that there are myriad perturbations in the cell wall that can increase susceptibility to cecropin A. One surprising finding in this dataset is the high support for the essentiality of genes encoding a glycine cleavage system (gcvP and gcvT) in cecropin A resistance. These genes have not been demonstrated experimentally to play a role in AMP resistance, although they were recently shown to be transcriptionally upregulated in response to nodule-specific cysteine-rich AMPs in Sinorhizobium meliloti (Tiricz et al. 2013). Similarly, following passage in mouse leukocytes, our analysis provided strong statistical support for the notion that phoP, phoQ, and the arn genes are essential for survival in this environment. In addition, there are many predicted essential genes that are thought to play a role in membrane/cell wall biogenesis and protein secretion. Curiously, these are enriched in genes encoding proteins that function to maintain cell shape (e.g. Mrd/Mre family members, ZipA, and RodC) and likely serve to protect the cell against the myriad stresses that are encountered inside the leukocyte. To this end, it is also interesting to note that many genes involved in the bacterial stress response are also predicted to be essential for survival in mouse leukocytes. We also observed that the holD gene, encoding the psi subunit of DNA polymerase III, is predicted to be essential for survival in mouse leukocytes. It is known that the phagosomal vacuoles of neutrophils employ an electrogenic oxidase, which leads to a compensatory flow of ions, including K+ and Cl-, thereby activating and releasing proteases responsible for microbial killing (Segal, 2005). Experimental studies show that holD is required to maintain efficient replication in environments containing high levels of ions (Kelman et al. 1998). Finally, 95 it is notable that our analysis provides strong support for the essentiality of genes encoding the ribonucleoside-diphosphate reductase subunits (nrdA and nrdB), which play an important role in DNA synthesis under aerobic conditions (Fontecave et al. 1992). Discussion The genomes of bacteria inhabiting dynamic environments have evolved to facilitate survival under changing environmental conditions in the generalist lifestyle (Kitano 2007). The maintenance of a diverse gene inventory mandates the use of regulatory systems to ensure that proteins are expressed and active under conditions in which their functions are adaptive. As such, free-living or facultative host-associated bacteria maintain myriad transcriptional regulators that respond to both intracellular and extracellular signals, to direct the expression of genes and maximize the operational efficiency of the cell. Some of these regulators operate at a local level, controlling singular metabolic processes, whereas others have evolved to orchestrate global, pleiotropic functions such as virulence. For bacteria that participate in generalist lifestyles, the evolution of global gene regulation has likely been driven by the competitive pressure to survive in diverse environments while maintaining a low operational cost of transcriptional regulation. When bacteria adopt obligate associations with plants and animals, they undertake a fundamental switch from a generalist to specialist lifestyle. Many of the gene functions that were required for survival in a dynamic lifestyle are no longer necessary in the static, host-associated lifestyle. In addition, the plant or animal host is often replete with nutrients, reducing the requirement for symbionts to engage in prototrophy. Together, 96 these characteristics facilitate relaxed selection on a large number of genes, resulting in a process of genome degeneration and streamlining, dramatically reducing the size of the bacterial gene inventory (van Ham et al. 2003; Moran et al. 2009; McCutcheon and Moran 2011; Bennett and Moran 2013) and engendering metabolic specialization and host dependence (Delaye and Moya 2010; McCutcheon and von Dohlen 2011; Van Leuven et al. 2014). Notably, genes encoding transcriptional regulators are lost early in the process of genome degeneration, as evidenced by comparative analysis of genes encoding putative regulatory proteins in the Sodalis-allied symbionts (Figure 5.8). In the current study, we used a high throughput, Tn-seq screen to analyze the fate of a population of transposon mutants that were transferred to several novel environmental conditions. This population has a high density of Tn5 insertions (0.007/bp, genome-wide), such that the majority of viable null mutants are represented among its members. This facilitates the identification of adaptive and deleterious mutations when the population is subjected to selection during growth in a novel environment. We are particularly interested in understanding the selection pressures that operate in the early stages of genome degeneration, following transition to a novel, static environment. While it is widely accepted that genetic drift is responsible for the majority of degenerative changes that occur during symbiont genome evolution, it is notable that mutator phenotypes, arising as a consequence of inactivation of DNA repair or recombination genes, often become fixed within populations shortly after transition to novel, static environments (LeClerc et al. 1996; Sniegowski et al. 1997; Giraud et al. 2001; Blount et al. 2008; Clayton et al. 2016). While the mutator phenotype is not expected to provide any intrinsic fitness advantage per se, it is predicted to be advantageous as a consequence 97 of linkage with the beneficial mutations that it generates (Couce et al. 2013). Our primary goal was to determine what types of null mutations might be adaptive following transition of our mutant population to a range of novel, static, nutrient-rich environments. It should be noted that the results of our study are not anticipated to have any special relevance to the evolution of symbiosis simply because we used a symbiont progenitor. Rather, this experiment would be anticipated to yield a similar outcome with any bacterium that has a generalist lifestyle. However, it is important to note that the S. praecaptivus strain used in our study had not been subjected to adaptation in laboratory culture. Such adaptation would be anathema to our scientific objectives, because the mutations that we seek to identify would likely have already occurred. Our results clearly show that there are many highly adaptive options for gene loss following transition to a novel environment. Strikingly, many of these involve inactivation of genes encoding proteins that are predicted to perform regulatory functions, particularly those that are global in nature or exert control over energetically expensive processes such as motility. For example, mutants with Tn5 insertions in the MarR-like transcriptional regulator Sant_4061 rapidly increased in frequency in our experimental population at the outset, simply as a consequence of growth in LB media, approaching fixation after just 20 days. However, at an earlier time point, we detected other advantageous mutants, including two that have Tn5 insertions in other genes encoding transcriptional regulators (uvrY and flhD). Following selection in a number of different environments, both artificial and natural, we found that mutants carrying Tn5 insertions in a number of other genes encoding putative regulators also showed a rapid increase in frequency in the population, often approaching fixation in a relatively short time. 98 Furthermore, a combined analysis of our data revealed that genes with the largest numbers of Tn5 insertions are substantially enriched in global (pleiotropic) regulatory functions. Although our experimental approach does not provide an opportunity to evaluate the fitness effects of multiple mutations in a single cell, since the vast majority of mutants in our population are expected to have only one Tn5 insertion (Veeranagouda et al. 2012). We anticipate that the inactivation of multiple global regulators would yield even greater increases in fitness following transition to a static environment. As an aside, our results highlight the potential dangers associated with maintaining microbes in laboratory culture. In addition to facilitating identification of adaptive null mutations, the Tn-seq procedure is also useful for identification of conditionally essential genes (van Opijnen et al. 2009). Indeed, transposon mutagenesis is a popular forward genetics technique that is used to identify genes that are necessary for survival in a specialized environment (Salama et al. 2004; Vidal et al. 2009; Khatiwara et al. 2012; Klein et al. 2012). The basic premise is that certain mutants will be eliminated from a growing population if the mutations are present in genes that are necessary for survival. Clearly, the advent of the Tn-seq procedure greatly enhances the utility of this technique by providing a rapid, accurate, and high throughput means to determine the frequencies of transposon insertions within a population (van Opijnen et al. 2009; van Opijnen and Camilli 2010; Barquist et al. 2013). However, there are still several challenges associated with the use of this technique. First and foremost, our work highlights the problem of skew resulting from adaptive null mutations, which can clearly reach high frequencies in the population in a short period of time. Such skew effectively reduces the level of diversity in the 99 mutant library and leads to an increased likelihood of false discovery of essential genes. Indeed, our results show that a population of transposon mutants can become significantly skewed simply as a consequence of the laboratory culture steps that are necessary for the preparation and storage of the library. As evidenced in our study, further skew can arise as a consequence of the experimental passage of the library. It is therefore of critical importance to determine if a mutant has been lost from the population as a consequence of its inability to survive, rather than as a consequence of its inability to compete with a highly adaptive variant. To achieve this goal, we performed statistical analyses on changes in the frequencies of transposon insertions in pseudogenes, based on the notion that these neutrally evolving loci would only be subject to transposon loss as a consequence of drift, arising primarily from bottlenecking of the library, or the aforementioned skew. Only two of our datasets yielded statistically robust insight into the identification of conditionally essential genes. These analyses identified many genes shown previously to be involved in modifying membrane and cell wall components to maintain resistance to AMPs, as well as genes that play well-established roles in intracellular survival. Moreover, our results also reveal that intracellular survival and resistance to AMPs depends on a large number of genes involved in membrane and cell wall biogenesis. At a general level, the identification of highly adaptive null mutants in this and other studies supports the role of gene loss, including genes encoding regulatory proteins, in adaptation towards a specialized niche (Hottes et al. 2013). Our findings indicate that the loss of genes encoding global regulators, in particular, present highly adaptive options following transition to a static lifestyle. This makes sense at an intuitive level because 100 the transition to a static lifestyle is accompanied by a substantial loss of environmental dynamism and consequently a relaxed requirement to maintain genes involved in responding to environmental change (Pontes et al. 2011). Furthermore, in the case of a transition to a symbiotic lifestyle, competition is often eliminated, relaxing the selective pressure to maintain a low cost of regulation. However, the selective advantages of reduced (regulatory) costs and elevated phenotypic plasticity in a generalist lifestyle must outweigh any net negative cost associated with a reduction in fitness following transition to a novel or static environment. Therefore, while global gene regulation plays an important role in allowing organisms to compete more efficiently in a generalist lifestyle, it (ironically) also seems to serve as a potential constraint upon fitness that may limit the potential for an organism to expand its range. While the findings reported in this study have the potential to affect any organism that utilizes pleiotropic transcriptional regulation, it is important to note that the selection pressure to evolve this form of regulation in the first place is expected to be most intense in microbes that engage in diverse lifestyles and experience fierce competition for resources. Ultimately, the tradeoff between the operational costs and functional optimality associated with global gene regulation likely represents an important driving force that constrains microbial adaptation. Materials and Methods Bacterial strains and culture conditions WT S. praecaptivus was grown in LB at either 25 or 30°C with or without shaking at 225 rpm. Antibiotics were added at the following concentrations where 101 relevant: kanamycin (30 µg/ml), polymyxin B (50 µg/ml), cecropin A (5 µg/ml). H 2O2 was added to a final concentration of 500 µM. Leukocytes were extracted from 8-weekold C57BL/6 mice using a previously described protocol (Swamydas and Lionakis 2013). Leukocytes were grown for 48 hours at 37°C without shaking in RPMI-1640 with Lglutamine (Cellgro) supplemented with 10% FBS and 2 mM EDTA. Tn5 mutant library construction and culture passages WT S. praecaptivus was mutagenized using the EZ-Tn5 transposome (Epicentre) as follows: 4 ml cultures were grown in LB at 30°C overnight. 25 ml of fresh LB was then added and cultures were grown until the OD600 reached 0.4. Cultures were then placed on ice for 10 minutes followed by centrifugation at 6,700 x g for 10 minutes at 4°C. Cell pellets were then resuspended in 20 ml of ice-cold nuclease free water. Centrifugation was repeated and cells were washed with 10 ml of ice-cold nuclease free water. Centrifugation was repeated and the supernatant was discarded. Cell pellets were resuspended in the residual liquid and placed on ice for 10 minutes. 80 µl aliquots of cells were then mixed with 1 µl of transposon and incubated on ice for 10 minutes. The entire volume was transferred to a chilled 1 mm electroporation cuvette and pulsed with 1.6 kV using an Eppendorf electroporator 2510. Cells were resuspended in 1 ml LB and allowed to recover for 3 hours shaking (225 rpm) at 30°C. Following recovery, cells were spread on LB agar plates containing kanamycin. Mutagenesis was repeated until an estimated 23,000 mutants were obtained. All Tn5 mutants were then combined in LB + kanamycin in a single 50 ml culture and grown overnight at 30°C with shaking (225 rpm). DNA was isolated from a 1 ml aliquot of overnight culture using the DNeasy Blood and Tissue Kit 102 (Qiagen). 1 ml aliquots of the remaining culture were then mixed with 225 µl of sterile 80% glycerol and archived at -80°C for subsequent experiments. For passage experiments, 100 µl of the mutant library (containing > 107 mutant cells) was added to 20 ml of LB + kanamycin, LB + kanamycin + H2O2, LB + kanamycin + polymyxin B, or LB + kanamycin + cecropin A. Cultures were then placed in a 25°C incubator without shaking and OD600 measurements were recorded each day. When the OD600 reached 0.30.4, a sample of each culture was serially diluted and plated on LB + kanamycin at 30°C to enumerate mutant abundance. At the same time, 10 µl of each culture was subcultured into the same media and placed back at 25°C. This process was repeated twice for each condition. Following the third passage, an aliquot of each culture was serially diluted and plated on LB + kanamycin. Colonies from a plate containing > 1 x 106 CFUs were collected using 2 ml of LB and a cell scraper. DNA from the collected colonies was isolated using the DNeasy Blood & Tissue kit (Qiagen) and prepared for sequencing as described previously (Subashchandrabose et al. 2013), using a method that specifically amplifies and sequences the DNA comprising junctions between the bacterial chromosome and the Tn5 transposon. Generation of aposymbiotic maize weevils Aposymbiotic (symbiont-free) Sitophilus zeamais weevils were generated by diluting 100 µl of a 10 mg/ml solution of rifampicin dissolved in N,NDimethylformamide (DMF) into 2.9 ml of nuclease free water and mixing this solution with 100 g of organic whole yellow corn (Purcell Mountain Farms). After the corn had dried for 16 hours approximately 100 weevils were added and allowed to oviposit in the 103 corn for one week at 25°C and 62% relative humidity. 5th instar larvae were confirmed to be lacking bacteriome organs (aposymbiotic) by dissection. Tn5 mutant library microinjection into weevils 100 µl of the S. praecaptivus Tn5 mutant library (containing > 107 mutant cells) was grown in 25 ml of LB overnight shaking (225 rpm) at 30°C. 23 newly emerged aposymbiotic adult weevils were microinjected by dipping the tips of capillary needles in overnight cultures of cells grown in LB and inserting the tip of the needle on the underside of the insect on the left or right side of the insect, between the middle and hind legs. Three weevils were immediately surface sterilized by soaking for 5 minutes in a 10% bleach solution and transferred to individual tubes of 500 µl of sterile nuclease-free water and submerged to remove residual bleach. Water was removed by pipetting and 200 µl of LB was added. Weevils were then homogenized and the homogenate was serially diluted and plated on LB agar plates containing kanamycin. Plates were incubated for 40 hrs at 30°C and colonies were counted. The remaining microinjected weevils were placed individually into 1.5 ml tubes. Three surviving weevils were sterilized, homogenized, serially diluted and plated on day 3 and three more were prepared in the same way on day 11. Following 40 hours of growth at 30°C, colonies were enumerated. Colonies from a plate containing approximately 1 x 106 CFUs were collected and DNA was prepared and submitted for sequencing. 104 Tn_seq data analysis DNA from the entire pool of Tn5 mutants was submitted for library construction and 50-bp single-end sequencing at the Huntsman Cancer Institute sequencing core at the University of Utah. Library construction and sequencing was performed as described previously (Subashchandrabose et al. 2013). Sequence reads were filtered using NGSQCToolkit (Patel and Jain 2012) using optional settings -l 70 -s 20. High quality reads were separated and trimmed using the "separate reads by barcode" function in Geneious version 8.1.7 (Kearse et al. 2012) to include only reads beginning with the last six bases of the Tn5 transposon. This tool also removes the six bases of transposon sequence from each filtered read. Reads were then mapped to the S. praecaptivus genome using the Geneious mapper with optional settings "minimum overlap identity" = 100% and "maximum mismatches per read" = 0%. Alignment files in SAM format were exported from Geneious with the "export padded CIGARs" option enabled. Because the Tn5 transposon duplicates a nine-base insertion sequence, the alignment file was modified to include only the first or last nine bases of forward or reverse sequences, respectively, using custom Perl scripts. Reads were then counted and visualized according to the first base of the insertion site. The abundance of mutants containing intragenic insertions was determined for each gene and comparisons between mutant libraries was performed using custom Perl scripts. Flagellar staining Flagella were visualized by tannic acid staining. Two solutions are prepared before staining. Solution 1 consists of 5 ml of 5% phenol, 1 g tannic acid, and 5 ml 105 saturated KAl(SO4)2, and solution 2 consists of 12% crystal violet in ethanol. Cells were picked from colonies grown on an LB plate containing 1.5% agar plate and were mounted on glass slides with liquid LB. Cover slips were placed over cells and a 10:1 mix of solutions 1 and 2 was infused under the cover slip on one side. Cells were visualized using a Nikon Optiphot microscope with a Nikon Plan 100 objective and COHU CCD camera. Transcriptional regulator identification Transcriptional regulators in S. praecaptivus and related symbionts were identified by searching intact protein-coding gene product annotations for “DNAbinding,” “regulator,” “transcriptional repressor,” or “transcriptional activator.” All hypothetical genes were then analyzed using the conserved domains database (MarchlerBauer et al. 2015) and putative transcriptional regulators were identified as genes containing domains belonging to the helix-turn-helix (HTH) or transcriptional regulator super families. Orthologs of S. praecaptivus transcriptional regulators were identified in symbiont genomes using an all versus all blastp alignment (Camacho et al. 2009) with optional settings –evalue 0.001 and –max_target_seqs 1. Alignments were manually inspected for false positive matches. Any protein coding sequences from transcriptional regulators in symbiont genomes not shared with S. praecaptivus were used to query other symbiont genomes for potential orthologs. 106 Acknowledgements We thank David Blair for his assistance with flagellar staining and imaging and Josh Daugherty and Tom Lane for generously providing mouse bone marrow leukocytes and growth media. We thank Jon Seger and Fred Adler for helpful comments relating to data analysis and preparation of the manuscript. References Bader MW, Sanowar S, Daley ME, Schneider AR, Cho U, Xu W, et al. 2005. Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell. 122:46172. Baehner RL, Murrmann SK, Davis J, Johnston RB Jr. 1975. The role of superoxide anion and hydrogen peroxide in phagocytosis-associated oxidative metabolic reactions. J Clin Invest. 56:571-6. Balleza E, López-Bojorquez LN, Martínez-Antonio A, Resendis-Antonio O, LozadaChávez I, Balderas-Martínez YI, et al. 2009. Regulation by transcription factors in bacteria: beyond description. FEMS Microbiol Rev. 33:133-51. Barquist L, Boinett CJ, Cain AK. 2013. Approaches to querying bacterial genomes with transposon-insertion sequencing. RNA Biol. 10:1161-9. Belden WJ, Miller SI. 1994. Further characterization of the PhoP regulon: identification of new PhoP-activated virulence loci. Infect Immun. 62:5095-101. Bennett GM, Moran NA. 2013. Small, smaller, smallest: the origins and evolution of ancient dual symbioses in a Phloem-feeding insect. Genome Biol Evol. 5:1675-88. Blount ZD, Borland CZ, Lenski RE. 2008. Historical contingency and the evolution of a key innovation in an experimental population of Escherichia coli. Proc Natl Acad Sci U S A. 105:7899-906. Breazeale SD, Ribeiro AA, Raetz CR. 2002. Oxidative decarboxylation of UDPglucuronic acid in extracts of polymyxin-resistant Escherichia coli. Origin of lipid A species modified with 4-amino-4-deoxy-L-arabinose. J Biol Chem. 277:288696. Breazeale SD, Ribeiro AA, Raetz CR. 2003. Origin of lipid A species modified with 4- 107 amino-4-deoxy-L-arabinose in polymyxin-resistant mutants of Escherichia coli. An aminotransferase (ArnB) that generates UDP-4-deoxyl-L-arabinose. J Biol Chem. 278:24731-9. Brogden KA. 2005. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat Rev Microbiol. 3:238-50. Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, et al. 2009. BLAST+: architecture and applications. BMC Bioinformatics. 10:421. Cases I, de Lorenzo V, Ouzounis CA. 2003. Transcription regulation and environmental adaptation in bacteria. Trends Microbiol. 11:248-53. Clayton AL, Jackson DG, Weiss RB, Dale C. 2016. Adaptation by deletogenic replication slippage in a nascent symbiont. Mol Biol Evol. 33:1957-66. Clayton AL, Oakeson KF, Gutin M, Pontes A, Dunn DM, von Niederhausern AC, et al. 2012. A novel human-infection-derived bacterium provides insights into the evolutionary origins of mutualistic insect-bacterial symbioses. PLoS Genet. 8:e1002990. Couce A, Guelfo JR, Blázquez J. 2013. Mutational spectrum drives the rise of mutator bacteria. PLoS Genet. 9:e1003167. Delaye L, Moya A. 2010. Evolution of reduced prokaryotic genomes and the minimal cell concept: variations on a theme. Bioessays. 32:281-7. Dinan AM, Tong P, Lohan AJ, Conlon KM, Miranda-CasoLuengo AA, Malone KM, et al. 2014. Relaxed selection drives a noisy noncoding transcriptome in members of the Mycobacterium tuberculosis complex. MBio. 5:e01169-14. Epand RM, Vogel HJ. 1999. Diversity of antimicrobial peptides and their mechanisms of action. Biochim Biophys Acta. 1462:11-28. Ernst RK, Guina T, Miller SI. 1999. How intracellular bacteria survive: surface modifications that promote resistance to host innate immune responses. J Infect Dis. 179:S326-30. Finn RD, Bateman A, Clements J, Coggill P, Eberhardt RY, Eddy SR, et al. 2014. Pfam: the protein families database. Nucleic Acids Res. 42:D222-30. Fontecave M, Nordlund P, Eklund H, Reichard P. 1992. The redox centers of ribonucleotide reductase of Escherichia coli. Adv Enzymol Relat Areas Mol Biol. 65:147-83. 108 Gallo RL, Kim KJ, Bernfield M, Kozak CA, Zanetti M, Merluzzi L, et al. 1997. Identification of CRAMP, a cathelin-related antimicrobial peptide expressed in the embryonic and adult mouse. J Biol Chem. 272:13088-93. Garcia Véscovi E, Soncini FC, Groisman EA. 1994. The role of the PhoP/PhoQ regulon in Salmonella virulence. Res Microbiol. 145:473-80. García Véscovi E, Soncini FC, Groisman EA. 1996. Mg2+ as an extracellular signal: environmental regulation of Salmonella virulence. Cell. 84:165-74. Gawronski JD, Wong SM, Giannoukos G, Ward DV, Akerley BJ. 2009. Tracking insertion mutants within libraries by deep sequencing and a genome-wide screen for Haemophilus genes required in the lung. Proc Natl Acad Sci U S A. 106:16422-7. Giraud A, Radman M, Matic I, Taddei F. 2001. The rise and fall of mutator bacteria. Curr Opin Microbiol. 4:582-5. Grangeasse C, Obadia B, Mijakovic I, Deutscher J, Cozzone AJ, Doublet P. 2003. Autophosphorylation of the Escherichia coli protein kinase Wzc regulates tyrosine phosphorylation of Ugd, a UDP-glucose dehydrogenase. J Biol Chem. 278:39323-9. Groisman EA, Parra-Lopez C, Salcedo M, Lipps CJ, Heffron F. 1992. Resistance to host antimicrobial peptides is necessary for Salmonella virulence. Proc Natl Acad Sci U S A. 89:11939-43. Groisman EA. 2001. The pleiotropic two-component regulatory system PhoP-PhoQ. J Bacteriol. 183:1835-42. Helmann JD. 2002. The extracytoplasmic function (ECF) sigma factors. Adv Microb Physiol. 46:47-110. Hottes AK, Freddolino PL, Khare A, Donnell ZN, Liu JC, Tavazoie S. 2013. Bacterial adaptation through loss of function. PLoS Genet. 9:e1003617. Kato A, Groisman EA. 2004. Connecting two-component regulatory systems by a protein that protects a response regulator from dephosphorylation by its cognate sensor. Genes Dev. 18:2302-13. Kato A, Groisman EA. 2008. The PhoQ/PhoP regulatory network of Salmonella enterica. Adv Exp Med Biol. 631:7-21. Kato A, Tanabe H, Utsumi R. 1999. Molecular characterization of the PhoP-PhoQ twocomponent system in Escherichia coli K-12: identification of extracellular Mg2+- 109 responsive promoters. J Bacteriol. 181:5516-20. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 28:1647-9. Kelman Z, Yuzhakov A, Andjelkovic J, O'Donnell M. 1998. Devoted to the lagging strand-the subunit of DNA polymerase III holoenzyme contacts SSB to promote processive elongation and sliding clamp assembly. EMBO J. 17:2436-49. Khatiwara A, Jiang T, Sung SS, Dawoud T, Kim JN, Bhattacharya D, et al. 2012. Genome scanning for conditionally essential genes in Salmonella enterica Serotype Typhimurium. Appl Environ Microbiol. 78:3098-107. Kitagawa M, Miyakawa M, Matsumura Y, Tsuchido T. 2002. Escherichia coli small heat shock proteins, IbpA and IbpB, protect enzymes from inactivation by heat and oxidants. Eur J Biochem. 269:2907-17. Kitano H. 2007. Towards a theory of biological robustness. Mol Syst Biol. 3:137. Klein BA, Duncan MJ, Hu LT. 2015. Defining essential genes and identifying virulence factors of Porphyromonas gingivalis by massively parallel sequencing of transposon libraries (Tn-seq). Methods Mol Biol. 1279:25-43. Klein BA, Tenorio EL, Lazinski DW, Camilli A, Duncan MJ, Hu LT. 2012. Identification of essential genes of the periodontal pathogen Porphyromonas gingivalis. BMC Genomics. 13:578. Konstantinidis KT, Tiedje JM. 2004. Trends between gene content and genome size in prokaryotic species with larger genomes. Proc Natl Acad Sci U S A. 101:3160-5. LeClerc JE, Li B, Payne WL, Cebula TA. 1996. High mutation frequencies among Escherichia coli and Salmonella pathogens. Science. 274:1208-11. Lewis M. 2005. The lac repressor. C R Biol. 328:521-48. Linehan SA, Rytkönen A, Yu XJ, Liu M, Holden DW. 2005. SlyA regulates function of Salmonella pathogenicity island 2 (SPI-2) and expression of SPI-2-associated genes. Infect Immun. 73:4354-62. Marchler-Bauer A, Derbyshire MK, Gonzales NR, Lu S, Chitsaz F, Geer LY, et al. 2015. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43:D222-6. Martínez-Antonio A, Collado-Vides J. 2003. Identifying global regulators in transcriptional regulatory networks in bacteria. Curr Opin Microbiol. 6:482-9. 110 McCutcheon JP, Moran NA. 2011. Extreme genome reduction in symbiotic bacteria. Nat Rev Microbiol. 10:13-26. McCutcheon JP, von Dohlen CD. 2011. An interdependent metabolic patchwork in the nested symbiosis of mealybugs. Curr Biol. 21:1366-72. Merhej V, Royer-Carenzi M, Pontarotti P, Raoult D. 2009. Massive comparative genomic analysis reveals convergent evolution of specialized bacteria. Biol Direct. 4:13. Miller SI, Pulkkinen WS, Selsted ME, Mekalanos JJ. 1990. Characterization of defensin resistance phenotypes associated with mutations in the phoP virulence regulon of Salmonella typhimurium. Infect Immun. 58:3706-10. Minagawa S, Ogasawara H, Kato A, Yamamoto K, Eguchi Y, Oshima T, et al. 2003. Identification and molecular characterization of the Mg2+ stimulon of Escherichia coli. J Bacteriol. 185:3696-702. Moncrief MB, Maguire ME. 1999. Magnesium transport in prokaryotes. J Biol Inorg Chem. 4:523-7. Moran NA, McLaughlin HJ, Sorek R. 2009. The dynamics and time scale of ongoing genomic erosion in symbiotic bacteria. Science. 323:379-82. Moran NA. 2002. Microbial minimalism: genome reduction in bacterial pathogens. Cell. 108:583-6. Navarre WW, Halsey TA, Walthers D, Frye J, McClelland M, Potter JL, et al. 2005. Coregulation of Salmonella enterica genes required for virulence and resistance to antimicrobial peptides by SlyA and PhoP/PhoQ. Mol Microbiol. 56:492-508. NCBI Genome Browse. Accessed: http://www.ncbi.nlm.nih.gov/genome/browse/. Oakeson KF, Gil R, Clayton AL, Dunn DM, von Niederhausern AC, Hamil C, et al. 2014. Genome degeneration and adaptation in a nascent stage of symbiosis. Genome Biol Evol. 6:76-93. Patel RK, Jain M. 2012. NGS QC Toolkit: a toolkit for quality control of next generation sequencing data. PLoS One. 7:e30619. Pérez-Rueda E, Janga SC, Martínez-Antonio A. 2009. Scaling relationship in the gene content of transcriptional machinery in bacteria. Mol Biosyst. 5:1494-501. Pernestig AK, Georgellis D, Romeo T, Suzuki K, Tomenius H, Normark S, et al. 2003. The Escherichia coli BarA-UvrY two-component system is needed for efficient switching between glycolytic and gluconeogenic carbon sources. J Bacteriol. 111 185:843-53. Pontes MH, Smith KL, De Vooght L, Van Den Abbeele J, Dale C. 2011. Attenuation of the sensing capabilities of PhoQ in transition to obligate insect-bacterial association. PLoS Genet. 7:e1002349. Ralston, A. 2008. Operons and prokaryotic gene regulation. Nature Education. 1:216. Rivera-Gómez N, Segovia L, Pérez-Rueda E. 2011. Diversity and distribution of transcription factors: their partner domains play an important role in regulatory plasticity in bacteria. Microbiology. 157:2308-18. Salama NR, Shepherd B, Falkow S. 2004. Global transposon mutagenesis and essential gene analysis of Helicobacter pylori. J Bacteriol. 186:7926-35. Sassetti CM, Boyd DH, Rubin EJ. 2003. Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol. 48:77-84. Segal AW. 2005. How neutrophils kill microbes. Annu Rev Immunol. 23:197-223. Sniegowski PD, Gerrish PJ, Lenski RE. 1997. Evolution of high mutation rates in experimental populations of E. coli. Nature. 387:703-5. Soncini FC, García Véscovi E, Solomon F, Groisman EA. 1996. Molecular basis of the magnesium deprivation response in Salmonella typhimurium: identification of PhoP-regulated genes. J Bacteriol. 178:5092-9. Subashchandrabose S, Smith SN, Spurbeck RR, Kole MM, Mobley HL. 2013. Genomewide detection of fitness genes in uropathogenic Escherichia coli during systemic infection. PLoS Pathog. 9:e1003788. Suzuki K, Wang X, Weilbacher T, Pernestig AK, Melefors O, Georgellis D, et al. 2002. Regulatory circuitry of the CsrA/CsrB and BarA/UvrY systems of Escherichia coli. J Bacteriol. 184:5130-40. Swamydas M, Lionakis MS. 2013. Isolation, purification and labeling of mouse bone marrow neutrophils for functional studies and adoptive transfer experiments. J Vis Exp. 77:e50586. Tiricz H, Szucs A, Farkas A, Pap B, Lima RM, Maróti G, et al. 2013. Antimicrobial nodule-specific cysteine-rich peptides induce membrane depolarization-associated changes in the transcriptome of Sinorhizobium meliloti. Appl Environ Microbiol. 79:6737-46. Trent MS, Ribeiro AA, Lin S, Cotter RJ, Raetz CR. 2001. An inner membrane enzyme in 112 Salmonella and Escherichia coli that transfers 4-amino-4-deoxy-L-arabinose to lipid A: induction on polymyxin-resistant mutants and role of a novel lipid-linked donor. J Biol Chem. 276:43122-31. van Ham RC, Kamerbeek J, Palacios C, Rausell C, Abascal F, Bastolla U, et al. 2003. Reductive genome evolution in Buchnera aphidicola. Proc Natl Acad Sci U S A. 100:581-6. Van Leuven JT, Meister RC, Simon C, McCutcheon JP. 2014. Sympatric speciation in a bacterial endosymbiont results in two genomes with the functionality of one. Cell. 158:1270-80. van Opijnen T, Bodi KL, Camilli A. 2009. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat Methods. 6:76772. van Opijnen T, Lazinski DW, Camilli A. 2014. Genome-wide fitness and genetic interactions determined by Tn-seq, a high-throughput massively parallel sequencing method for microorganisms. Curr Protoc Mol Biol. 106:7.16.1-24. Veeranagouda Y, Husain F, Wexler HM. 2012. Transposon mutagenesis of the anaerobic commensal, Bacteroides fragilis, using the EZ::TN5 transposome. FEMS Microbiol Lett. 333:94-100. Vidal JE, Chen J, Li J, McClane BA. 2009. Use of an EZ-Tn5-based random mutagenesis system to identify a novel toxin regulatory locus in Clostridium perfringens strain 13. PLoS One. 4:e6232. Vincent C, Duclos B, Grangeasse C, Vaganay E, Riberty M, Cozzone AJ. 2000. Relationship between exopolysaccharide production and protein-tyrosine phosphorylation in gram-negative bacteria. J Mol Biol. 304:311-21. Wilkinson SP, Grove A. 2006. Ligand-responsive transcriptional regulation by members of the MarR family of winged helix proteins. Curr Issues Mol Biol. 8:51-62. Zhou D, Han Y, Qin L, Chen Z, Qiu J, Song Y, et al. 2005. Transcriptome analysis of the Mg2+-responsive PhoP regulator in Yersinia pestis. FEMS Microbiol Lett. 250:8595. Zwir I, Shin D, Kato A, Nishino K, Latifi T, Solomon F, et al. 2005. Dissecting the PhoP regulatory network of Escherichia coli and Salmonella enterica. Proc Natl Acad Sci U S A. 102:2862-7. 113 Figure 5.1. Hypothetical transcriptional network. Global and local transcriptional regulators provide efficiency by modulating the expression of many different genes including other local regulators in response to a single signal. Local regulators modulate the expression of a small number of genes that usually function in a single metabolic process. 114 Figure 5.2. Histogram showing the abundance of Tn5 mutants in the whole genome sequence of S. praecaptivus in the initial library (top). The data is processed and rendered so that each individual peak shows the number of Tn5 insertions/kb in a single gene. The peaks with the highest numbers of Tn5 insertions/kb are annotated with gene names, which are shown in bold face if the gene is predicted to have a regulatory function. The zoomed in fraction (bottom) shows the frequencies of Tn5 insertions in individual sites in a region of the genome containing many genes encoding proteins involved in translation, which are essential for survival and therefore do not contain Tn5 insertions. 115 Figure 5.3. Plate A shows a growth curve obtained from stationary cultures of wild type and ∆Sant_4061, ∆flhD, ∆uvrY, and ∆wzb mutant strains of S. praecaptivus. Plates B and D show the same strains following growth on swarm and swim agar plates, respectively. Plate C shows micrographs of the cells following staining for flagellae. 116 Figure 5.4. Histograms showing the abundance of Tn5 mutants in the whole genome sequence of S. praecaptivus in the initial library and each of the derived libraries. The data were processed and rendered so that each individual peak shows the number of Tn5 insertions/kb in a single gene. The peaks with the highest numbers of Tn5 insertions/kb are annotated with gene names, which are shown in bold face if the gene is predicted to have a regulatory function. 117 Figure 5.5. Comparison of turbidities of wild type and selected mutant strains of S. praecaptivus following overnight stationary growth in LB with and without polymyxin B or cecropin A. 118 Figure 5.6. Matrix showing the presence (green) or absence (grey) of genes encoding proteins with predicted regulatory functions in the top 25 most abundant mutants in each passage experiment. 119 Figure 5.7. Plots showing the counts of Tn5 insertions in all genes in the initial and derived libraries. Genes that are known to function in providing resistance to antimicrobial peptides are labeled. 120 Figure 5.8. Status of transcriptional regulators in S. praecaptivus and related symbionts. Intact and disrupted orthologs of putative transcriptional regulators are shown in green and red respectively. Gray indicates that the ortholog is absent from the gene inventory. 121 CHAPTER 6 CONCLUSIONS AND FUTURE DIRECTIONS 122 The comparative analyses between Sodalis praecaptivus and the derived insect symbionts Sodalis glossinidius and Candidatus Sodalis pierantonius have provided valuable insight into the mechanisms driving symbiont genome degeneration as well as the impact that this degenerative process has on symbiont gene inventories and functions. While this work illustrates that genome degeneration occurs through repeated replication slippage events that create abundant inactivating insertions and deletions (indels) in recently established symbiont genomes, it remains unclear how this degenerative process is limited. We suggested that the observed A+T mutational bias, frequently seen in symbiont genomes, is one method whereby slippage events might be prevented. However, the reasons for this mutational bias remain unclear. Furthermore, not all symbiont genomes become A+T-rich, suggesting that other mechanisms driving genome degeneration, outside of those identified in this work, must exist. This work also identified inactivating mutations in specific DNA repair and recombination genes in the Ca. S. pierantonius genome that are likely contributing to the increased mutation rates in this symbiont. Comparative analyses of most genes shared between Ca. S. pierantonius and S. praecaptivus reveal the presence of countless missense mutations. Some of these changes within core replication proteins may also contribute to the degeneration of the symbiont genome as observed in other laboratory studies (Saveson and Lovett 1997). It would be interesting to assess the functional consequences of symbiont replication proteins within the S. praecaptivus genome by replacing its native genes with the symbiont orthologs. The availability of symbiont genomes that vary in their length of host association could enable the identification of specific mutations that may be contributing to genome degeneration. 123 This work also provided further support that individual genes, especially regulatory pathways, such as PhoP-PhoQ, undergo functional changes that optimize these pathways for symbiotic life. While many regulatory genes are lost as a consequence of symbiosis, the modifications to regulatory networks that enable the persistence of symbionts within the host environment remain poorly understood. Through the use of transposon Tn5 mutagenesis and sequencing (Tn-seq), this work showed that significant fitness advantages could be realized through the disruption of existing regulatory networks, especially those involving global regulatory proteins. This observation prompted the discovery of a previously uncharacterized transcriptional regulator involved in mediating resistance to antimicrobial peptides (AMPs). The analyses of the Tn5 mutant library also identified many other uncharacterized genes, whose inactivation mediates increased fitness in various novel environments. All of the environments tested in this work were chosen on the basis of their containing specific challenges likely encountered by a recently established symbiont. Some of the genes identified in these experiments may play important roles in the establishment of symbiotic interactions. It would be worthwhile to follow up this work with additional analyses of these genes and their role, if any, in maintaining symbioses. For those genes with predicted regulatory functions, it would be worthwhile to assess their transcriptional profiles to better understand what pathways fall under their control. This would likely explain the reasons for the significant fitness benefits gained by their inactivation. As a whole, this work illustrates some of the mechanisms of symbiont genome degeneration as well as a few of the modifications that have occurred in specific pathways as a consequence of persistent host association. This work also provides a 124 framework whereby other important adaptations in symbiosis could be identified and explored. References Saveson CJ, Lovett ST. 1997. Enhanced deletion formation by aberrant DNA replication in Escherichia coli. Genetics. 146:457-70. 125 APPENDIX LIST OF PUBLICATIONS Clayton AL, Jackson DG, Weiss RB, Dale C. 2016. Adaptation by deletogenic replication slippage in a nascent symbiont. Mol Biol Evol. 33:1957-66. Clayton AL, Oakeson KF, Gutin M, Pontes A, Dunn DM, et al. 2012. A novel humaninfection-derived bacterium provides insights into the evolutionary origins of mutualistic insect-bacterial symbioses. PLoS Genet. 8:e1002990. Oakeson KF, Gil R, Clayton AL, Dunn DM, von Niederhausern AC, et al. 2014. Genome degeneration and adaptation in a nascent stage of symbiosis. Genome Biol Evol. 6:76-93.