Surviving irreparable dna damage: genetic mechanisms to escape programmed cell death

A cell with an irreparably damaged genome is genetically programmed to undergo cell death, called apoptosis. This is to make sure that such cells are not propagating the damaged DNA to their daughter cells, because it will lead to accumulation of genetic instability and is thus detrimental to the tissue or the organ, and to the organism as a whole. In spite of the highly efficient genetic programming to get succumbed to apoptosis, it has been sometimes found that some cells can escape from the fate of apoptosis and continue to survive and proliferate. Accumulation of such cells forms one of the first steps towards the development of cancer. For my dissertation, I have tried to identify the genetic mechanisms that aid a cell to survive DNA damage beyond repair. Thus, this study will help us understand the genetic routes to predisposition towards carcinogenesis and possibly identify new drug targets for cancer therapeutics. Using a highly tractable genetic model organism, the fruitfly, Drosophila melanogaster, I first modeled irreparable DNA damage in the form of a single telomere loss - a mode of DNA damage that cannot be repaired by the DNA repair machinery. This served us as a system to assay the fate of cells following the DNA damage. In this background, I carried out a genetic screen to identify genes that help survival of cells withstanding telomere loss. Here I identified a singular gene, corp, that inhibits P53-dependent cell death by negatively regulating the tumor suppressor, P53. I characterized Corp as the functional analog of vertebrate Mdm2 in the Drosophila system. I identified another gene through the screen - fs(1)Yb, that reduces cell survival following telomere loss possibly by inducing the DDR pathway following telomere loss. Overall, my findings indicate that there are distinct genetic pathways that negatively or positively regulate cell survival following irreparable DNA damage. A tilt towards or away from them causes abnormal proliferation of cells containing damaged genome, thus predisposing an organism to cancer development.

SURVIVING IRREPARABLE DNA DAMAGE: GENETIC MECHANISMS TO ESCAPE PROGRAMMED CELL DEATH by Riddhita Chakraborty A dissertation submitted to the faculty of The University of Utah in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Biology The University of Utah December 2014 Copyright © Riddhita Chakraborty 2014 All Rights Reserved The University of Utah Graduate School STATEMENT OF DISSERTATION APPROVAL The dissertation of Riddhita Chakraborty has been approved by the following supervisory committee members: and by Kent G. Golic , Chair 10/21/2014 Markus Babst , Member 10/22/2014 Mark M. Metzstein , Member 10/22/2014 Michael D. Shapiro , Member 10/27/2014 Leslie E. Sieburth , Member 10/23/2014 M. Denise Dearing the Department/College/School of and by David B. Kieda, Dean of The Graduate School. Date Approved Date Approved Date Approved Date Approved Date Approved , Chair/Dean of Biology ABSTRACT A cell with an irreparably damaged genome is genetically programmed to undergo cell death, called apoptosis. This is to make sure that such cells are not propagating the damaged DNA to their daughter cells, because it will lead to accumulation of genetic instability and is thus detrimental to the tissue or the organ, and to the organism as a whole. In spite of the highly efficient genetic programming to get succumbed to apoptosis, it has been sometimes found that some cells can escape from the fate of apoptosis and continue to survive and proliferate. Accumulation of such cells forms one of the first steps towards the development of cancer. For my dissertation, I have tried to identify the genetic mechanisms that aid a cell to survive DNA damage beyond repair. Thus, this study will help us understand the genetic routes to predisposition towards carcinogenesis and possibly identify new drug targets for cancer therapeutics. Using a highly tractable genetic model organism, the fruitfly, Drosophila melanogaster, I first modeled irreparable DNA damage in the form of a single telomere loss - a mode of DNA damage that cannot be repaired by the DNA repair machinery. This served us as a system to assay the fate of cells following the DNA damage. In this background, I carried out a genetic screen to identify genes that help survival of cells withstanding telomere loss. Here I identified a singular gene, corp, that inhibits P53-dependent cell death by negatively regulating the tumor suppressor, P53. I characterized Corp as the functional analog of vertebrate Mdm2 in the Drosophila system. I identified another gene through the screen - fs(1)Yb, that reduces cell survival following telomere loss possibly by inducing the DDR pathway following telomere loss. Overall, my findings indicate that there are distinct genetic pathways that negatively or positively regulate cell survival following irreparable DNA damage. A tilt towards or away from them causes abnormal proliferation of cells containing damaged genome, thus predisposing an organism to cancer development. iv I dedicate my thesis to my parents, Krishna Chakraborty and Biplab Chakraborty, for their constant love and support to help me stand where I am today. v TABLE OF CONTENTS ABSTRACT……...………………………………………………………………………iii LIST OF TABLES……………………………………………………………..............viii LIST OF GENE NAMES AND FUNCTIONS…………………………………………ix ACKNOWLEDGEMENTS……………………………………………………………...xi Chapters 1. INTRODUCTION………………………………………………………………..1 Cellular response to DNA damage……………………………………...........2 DNA damage beyond repair…………………………………….....................6 Surviving irreparable DNA damage…………………………………………...7 Dissertation outline……………………………………...................................8 References…………………………………….............................................12 2. IDENTIFYING NOVEL GENES THAT MODULATE CELL SURVIVAL FOLLOWING IRREPARABLE DNA DAMAGE IN DROSOPHILA MELANOGASTER………………………………………………...…………..17 Abstract……………………………………...................................................18 Introduction…………………………………….............................................18 Materials and methods……………………………………...........................20 Results and discussion……………………………………...........................22 References…………………………………….............................................45 3. IDENTIFICATION OF CORP AS A FUNCTIONAL ANALOG OF MDM2: NEGATIVE REGULATION OF P53 IN DROSOPHILA MELANOGASTER……………….….………………………………………...47 Abstract……………………………………...................................................48 Introduction…………………………………….............................................48 Results……………………………………....................................................50 Discussion……………………………………..............................................58 Materials and methods……………………………………...........................62 Acknowledgements……………………………………………………………72 References…………………………………….............................................96 4. ROLE OF FS(1)YB AS AN INDUCER OF CELL DEATH FOLLOWING IRREPARABLE DNA DAMAGE………………………………………….…102 Abstract…………………………………….................................................103 Introduction……………………………………...........................................103 Results……………………………………..................................................106 Discussion and future direction………………………………....................109 Materials and methods…………………………………….........................111 References……………………………………............................................119 5. MODULATORS OF IRRADIATION SURVIVAL IN DROSOPHILA MELANOGASTER……………………………………………………….......121 Abstract…………………………………….................................................122 Introduction……………………………………...........................................122 Results and discussion………………………….…………........................124 Future experiments….……………………………………………………….128 Materials and methods…………………………………….........................129 References……………………………………............................................143 6. DEFINED GENETIC PATHWAYS TO SURVIVE IRREPARABLE DNA DAMAGE: MAKING SENSE OF IT………………………………...………145 Cell fate decisions: an important juncture…………………………………150 References……………………………………………………………………154 APPENDICES A. EP SCREEN DATASHEET………………………………………………..157 B. CONSTRUCTED STOCKS…………………………………………………187 vii LIST OF TABLES TABLE PAGE 1. Strength of FLP expression tested by their ability to flip-out w+ gene when crossed to P[>w+>]………………………………………………………...41 2. EPgy2 lines identified as modifiers of BARTL phenotype induced by y w/H1; eGUF4.8JD1/+…………………………………………………………..42 3. Effect of screened EPgy2 lines on BS or wildtype eyes………………………43 4. Effect of candidate gene knockdowns or amorphic alleles on BARTL phenotype………………………………………………………………………….44 5. Effect of corp on transmission of broken-and-healed chromosomes through the male germline………………………………………………….…...95 6. Effect of fs(1)Yb on transmission of broken-and-healed chromosomes through the male germline……………………………………………………..117 7. Effect of piwi and armi knockdowns/amorphic alleles on BARTL phenotype and on BS eye phenotype without telomere loss……………….118 8. Statistical significance of corp mutant or corp+ overexpressionmediated variation of irradiation survival………………………………………142 viii LIST OF GENE NAMES AND FUNCTIONS GENE PROTEIN CELLULAR MECHANISM chk1/grp Chk1 DNA damage response chk2/loki/mnk Chk1 DNA damage response p53 P53 brca1 BRCA1 cdc25 Cdc25 nbs1 Nbs1 DNA DSB response cdc2 Cdc2 cell cycle control 14-3-3σ 14-3-3σ p21 P21 G2 arrest atm/tefu ATM DNA damage response atr/mei-41 ATR DNA damage response Ku70/Ku80 Ku70/Ku80 mre11 Mre11 DNA DSB response rad50 Rad50 DNA DSB response bax Bax pro-apoptotic noxa Noxa pro-apoptotic puma Puma pro-apoptotic transcription, DNA repair, apoptosis DNA damage response cell cycle control adapter protein, DNA damage responsive NHEJ, telomere maintenance ix apaf-1 APAF-1 pro-apoptotic bad Bad pro-apoptotic fas Fas death-receptor, pro-apoptotic dr5 Dr5 death-receptor, pro-apoptotic bcl-2 BcL-2 corp Corp P53 negative regulator mdm2 Mdm2 P53 negative regulator hid Hid pro-apoptotic reaper Reaper pro-apoptotic pavarotti Pavarotti kinesin motor function CG1632 CG1632 LDL receptor, proteolysis pdcd4 Pdcd4 CG8924 CG8924 med18 MED18 CG2701 CG2701 fs(1)Yb Fs(1)Yb piwi Piwi piRNA synthesis armi Armi piRNA synthesis hiphop Hiphop CG14814 CG14814 crebB17A CrebB-17A SmG SmG mthl1 Mthl1 anti-apoptotic stem cell differentiation transcriptional proliferation RNA pol II transcriptional mediator Ubiquitin system component (?) germline stem cell maintenance telomere maintenance not known c-AMP regulated transcription mitotic spindle organization early development function, morphogenesis x ACKNOWLEDGEMENTS As I stand now, a stone's throw from the finish line of my graduate career, I would like to take the time to look back and extend my heartiest acknowledgements to all those who inspired me, extended their supportive hands, and put their belief in me to endure to the end of this journey that I started six years back. First and foremost, I would thank my doctoral adviser, my guru, Dr. Kent Golic. A naïve as I was, he taught me to appreciate genetics in the truest essence and the art of doing scientific research. His invaluable guidance and patience through my mistakes tremendously helped me to develop my skills over years to start practicing logical hypothesis-driven research. Besides, he has been an exceedingly supportive and understanding mentor and I truly consider myself very fortunate to have secured a position as a graduate student in his laboratory years ago. Next I would acknowledge Mary Golic. She always made me see the Golic lab as my most comfortable and safest nook. Her warmth and kindheartedness made me not only able to survive but also to stand straight in some of the most stressful periods of my life. I think, I would always fall short of words in trying to thank Kent and Mary. In a nutshell, without them I wouldn't be standing where I am today. xi Next, I would like to thank my committee members, Dr. Leslie Sieburth, Dr. Markus Babst, Dr. Mark Metzstein, and Dr. Mike Shapiro. I have been very lucky to have these wonderful scientists on my committee who made my yearly committee meetings such an enjoyable and great learning experience, which always made me look forward to the next year's meeting. I particularly thank Mark for prompting me to attend my first Drosophila conference and for kindly giving me the various fly stocks I needed. I thank Markus for allowing me to carry out my Western blot experiments in his lab. I would next thank the present and some of the past Golic lab members, Dr. Simon Titen, Dr. Rebeccah Kurzhals, Dr. Heng Xie, Adam Lin, Jayaram Bhandari, Jenny Wilson, Zachary Lee, Arun Kannanganat, and Hunter Hill. Simon, Rebeccah, and Heng never grew tired of answering my zillion questions, be it on labwork or on coursework. I thank them for their contribution towards my education as a scientist. Even outside science, they became an integral part of my life in the new continent: from getting acquainted with the lifestyle in the States to solving nitty-gritties of daily life. Adam and Jay have always extended their helping hands whenever I needed them. All these people have always made me see the Golic lab as a part of my family. I thank Dr. Julie Hollien for helping me with learning the cell culture techniques and her important input in troubleshooting with qPCR. My heartful thanks to my buddies from the Hollien lab, Jinny Li, Kristin Moore, and Deepika Goddam, for cell culture and qPCR troubleshooting. Thanks to Shrawan Mageswaran and Matthew Curtiss from the Babst lab for troubleshooting during xii Western blot experiments. My thanks to Dr. Colin Dale for letting me use the qPCR facility in his lab. I thank our collaborators, Dr. Lei Zhou and Dr. Ying Li, University of Florida, for their supportive work. I thank Dr. Tin Tin Su and Dr. Andreas Bergmann for sharing their unpublished data with us and Dr. Haifan Lin for kindly gifting us the fs(1)Yb mutants. I thank the University of Utah Core facilities for DNA sequencing and primer facilities. I thank the Drosophila Stock Centers of Bloomington and Vienna and all the scientific vendors for all their reagents to make my research smoother. I highly express my gratitude toward our graduate coordinator, Shannon Nielsen, for her help and support with all administrative paperwork and truthfully reminding me of all the deadlines throughout the period of my doctoral work. I would thank Dr. Gordon Lark for sharing with me his scientific philosophies and experiences that have highly influenced me and made me feel a part of the global scientific fraternity, instead of taking science as a mere rat race. I would also like to mention here and acknowledge some of my scientific forefathers whose biographies and works have always inspired and influenced me into doing and enjoying the extraordinary art of Drosophila genetics: Dr. Thomas Hunt Morgan, Dr. Alfred Sturtevant, Dr. Edward Novitski, Dr. Seymour Benzer, and Dr. Larry Sandler. I thank my teachers and supervisors in India, Dr. Debashis Banerjee, Dr. Asok Mukherjee, Dr. Rathindranath Baral, Dr. Chanchal Dasgupta, and Dr. Uma Dasgupta, who have always instigated my scientific xiii inquisitiveness and encouraged me to do good science. I would also thank my biology tutor during my high school days, Gopal Chandra Paul, who planted in me the initial interests in biology, particularly in genetics. Thank you all for making me dream high. Finally, I thank my parents for their love, protection, support, and encouragement all through my life to stand where I stand today. Last but not the least, I acknowledge those without whom my research could not have been conducted, those who bore all the pain to direct us onto our path of scientific discoveries: my tiny friends, the fruitflies. xiv CHAPTER 1 INTRODUCTION 2 The survival and evolution of life depends on the faithful inheritance of information through DNA from mother to daughter cells both in the soma and through the germline, with not only accurate DNA replication and distribution of genetic material, but also keeping the mutation load in cells to a minimum. The beauty of the living system lies in that it has a highly evolved intrinsic surveillance system by which it can sense damage to its DNA and respond accordingly, thereby maintaining the fidelity of its genome. Cellular response to DNA damage Cellular metabolites, intracellular accumulated ROS, or external environmental factors like X-ray, UV irradiation, and toxic mutagenic chemicals are constantly inflicting damage to the genome of an organism. Cells are, however, well-armed to combat such constant insults. There are primarily three branches of this multifaceted damage response pathway that the cells exhibit in response to DNA damage: cell cycle arrest, DNA repair, and programmed cell death or apoptosis (Jackson and Bartek, 2009). A detailed study has been made on the signal transducers following DNA damage that triggers the damage response pathways at their downstream. One of the classes of signal transducers comprises phospho-inositide kinase (PIK)related proteins that include ATM and ATR. Downstream of ATM and ATR are two structurally unrelated proteins with overlapping substrate specificity: checkpoint serine/threonine kinases CHK2 and CHK1 activate a cascade of downstream effector proteins, like p53, BRCA1, Cdc25, Nbs1, etc. that execute 3 the functions of DNA damage responses (Figure 1). Initially, the term checkpoint referred to the ‘control mechanism enforcing dependency in the cell cycle' (Hartwell and Weinert, 1989) but later, it was also found to control DNA repair and apoptotic induction as well. These pathways are, to a large extent, conserved from mammals to lower invertebrates like Drosophila and single-celled eukaryotes, such as yeast. Several of the checkpoint genes are essential for organismal survival, implying that this pathway has important roles to play in functions that are tightly linked to normal cellular physiology. Inactivation of the checkpoint pathways leads to cancer development in mammals. Cell cycle arrest ensures that the damaged DNA is not replicated and that the cells with damaged DNA are not proliferating. In mammals, Chk1 and Chk2 both play a role in preventing mitotic entry following DNA damage. Evidence shows that Chk2 and Chk1 induce inhibitory phosphorylation of Cdc25, which then fails to dephosphorylate Cdc2. Arrest at the G2 phase of cell cycle is primarily maintained and regulated by phosphorylated Cdc2 (Brown et al., 1999; Chaturvedi et al., 1999; Matsuoka et al., 1998; Nurse, 1997; Sanchez et al., 1997). Further, Chk2-activated p53 induces 14-3-3σ and p21 that play important roles in maintaining G2 arrest in response to DNA damage (Bunz et al., 1998; Chan et al., 1999). ATR phosphorylates Chk1 at Ser 345 in response to UV light both in vivo and in vitro and mice lacking chk1 die in early embryogenesis like ATR-/- mice (Kim et al., 1999; Liu et al., 2000; Takai et al., 2000). chk1 mutant embryonic stem cells are incapable of preventing mitotic entry after irradiation, implying that Chk1 is required for G2/M phase transition checkpoint in response 4 to DNA damage (Liu et al., 2000). Similarly, in Drosophila, ATR/mei-41 induces Chk1/grp, which are essential to induce cell cycle arrest in response to DNA damage (de Vries, 2005; Song, 2005; Song et al., 2004). grp mutants fail to delay anaphase onset following I-CreI-induced double-strand breaks (Royou et al., 2005). The ATM/tefu and Chk2/mnk pathway also play a role in cell cycle arrest, but is not absolutely indispensable (Bi, 2005; de Vries, 2005; Song et al., 2004; Xu et al., 2001). The wide variety of DNA lesions necessitates multiple DNA repair mechanisms (Jackson and Bartek, 2009). For DNA single-strand lesions, the mismatched base or region of missing base pairs is recognized and several mismatch-repair methods are applied to fix it: (1) Following detection of mismatches, the insertion-deletion loop triggers a single-strand incision that is worked upon by nuclease, polymerase, and ligase enzymes to repair the damage (Jiricny, 2006). (2) Base-excision repair: Here, the DNA glycosylase enzyme recognizes the damaged base and mediates its removal (David et al., 2007). (3) Nucleotide excision repair: After recognition of the DNA helix-distorting lesions, the damage is excised as a 20-30 base-pair long oligonucleotide, thus producing a single-stranded DNA, which is then acted upon by DNA polymerase, associated factors, and finally ligase for fixing the damage (Hoeijmakers, 2001). For DNA double-strand break (DSB) repair, two principle methods are used: (1) non-homologous end joining (NHEJ) and (2) homologous recombination (HR). NHEJ is error-prone and can occur at any phase of the cell cycle. Here, the DSB is recognized by Ku proteins, which then activate DNA protein kinases, leading to 5 recruitment of end-processing enzymes, polymerases and DNA ligase IV to join any two double-strand breaks without sequence specificity (Hefferin and Tomkinson, 2005; Lieber, 2008). Ku70 and Ku80 deficient mice showed profound deficiency in DNA DSB repair and exhibited dwarfism, also indicating their roles in growth control (Nussenzweig et al., 1996; Ouyang et al., 1997). HR, which is confined to S and G2 phase of cell cycle, is a comparatively faithful mode of repair as it uses the sister chromatid to mediate the repair process. ssDNA, generated by the Mre11-Rad50-Nbs1 (MRN complex), invades the undamaged template strand, is extended by polymerase, and following nuclease, helicase, and ligase activity, strand resolution occurs (San Filippo et al., 2008). The DNA repair pathway components are highly conserved in Drosophila (Sekelsky et al., 2000). Loss-of-function mutations of mre11, rad50, and nbs in Drosophila failed to repair irradiation-induced DNA damage (Mukherjee et al., 2009). Chk2mediated P53 activation induces the transcription of a wide array of DNA repair pathway components in single- or double-strand repair, like, Mre11, Rad50, and Ku70/Ku80 (Brodsky et al., 2004). Interestingly, a mei-41-mediated, Chk1/Chk2independent DNA repair mechanism through HR has been also reported (LaRocque et al., 2007). The role of P53 in DNA repair has been widely studied (Sengupta and Harris, 2005). Isogenic matched cell lines exposure to a chemical DNA damaging agent showed slower base excision repair when they lacked p53 and the repair mechanism involves binding to specific transcription factors (Seo et al., 2002; Wang et al., 1995). Disruption of the components of the MRN complex also 6 causes failure to repair DNA double-strand breaks (D'Amours and Jackson, 2002; Tauchi et al., 2002; Williams et al., 2007; Yuan and Chen, 2010). Thus, to summarize so far, upon being sensed, DNA damage triggers checkpoint mechanisms that arrest cell cycle progression and repair the damaged DNA before entering into the next mitotic cycle. However, if the DNA damage is beyond repair, the cells may succumb to apoptosis and are thus eliminated in order to stem the spread of genetic aberrations and thereby maintain genomic stability. DNA damage beyond repair The inability to repair damage usually leads to various types of disorders and predisposition towards tumor development. Programmed cell death is a last line of defense against the development of cancer. P53 is extremely essential for induction of apoptosis following irreparable DNA damage (Fridman and Lowe, 2003; Vousden and Lu, 2002; Yoshida and Miki, 2010). Humans lacking one copy of p53 are predisposed to develop cancers and p53 knockout mice also develop cancers at a higher rate (Donehower et al., 1992; Jackson and Bartek, 2009; Sancar et al., 2004; Zhou and Elledge, 2000). Irradiation-induced chk2-/thymocytes do not have stabilized and activated p53 and have no induction of its downstream genes in the apoptotic pathway (Hirao, 2000). In mammals, P53 positively regulates both intrinsic (mitochrondrially-regulated) and extrinsic (cellsurface receptor-mediated) apoptotic pathways by transcriptional activation of multiple genes and also by transcriptional independent mechanisms (Chipuk and 7 Green, 2006; Haupt, 2003; Yoshida and Miki, 2010). For example, P53 induces the pro-apoptotic genes Bax, Noxa, Puma, and Apaf-1 and counteracts the antiapoptotic Bad in the intrinsic pathway (Li et al., 2008; Miyashita and Reed, 1995; Nakano and Vousden, 2001; Oda et al., 2000; Robles et al., 2001) and the death receptors Fas and DR5 (Haupt, 2003) in the extrinsic pathway. P53 also binds to the anti-apoptotic BcL-2 and compromises the latter's ability to stabilize the mitochondrial membrane (Wolff et al., 2008), resulting in cytochrome C release - that promotes the pro-apoptotic cascade activation. Most of the DDR pathways, including cell cycle arrest, DNA repair, and apoptosis, are conserved in the Drosophila model. However, in flies, P53 does not participate in cell cycle arrest (Sogame et al., 2003); following activation by Chk2 in response to DNA damage, it induces DNA repair or apoptosis (Brodsky et al., 2004; Kurzhals et al., 2011; Peters et al., 2002; Titen and Golic, 2008). Besides, the existence of P53-independent apoptotic pathways have also been reported (McNamee and Brodsky, 2009; Titen and Golic, 2008; van Bergeijk et al., 2012; Wichmann et al., 2006). Surviving irreparable DNA damage In spite of the multistep checkpoints, a fraction of cells may still continue to survive with irreparable DNA damage (Ahmad and Golic, 1999; Kurzhals et al., 2011; Titen and Golic, 2008). One way by which this can happen is if the DDR pathway genes are mutated. There may also be some more defined genetic pathways that allow the survival of such cells. It will be very interesting to identify 8 and characterize such pathways, as they will help us elucidate pathways to carcinogenesis or other complex human diseases. Dissertation outline In my dissertation, I have made an attempt to understand the genetic mechanisms that regulate a cell's life or death decision in response to irreparable DNA damage. In Chapter 2, I will start by describing a genetic method that I have used to assay the fate of somatic cells with respect to surviving or succumbing to cell death following induction of nonrepairable DNA damage in the form of a single telomere loss. In this background of telomere loss, I will present the putative genes that I have identified as enhancers and suppressors of cell death, using a highly efficient genetic misexpression (EP) screen. In Chapter 3, I will describe the characterization of one of the candidate genes from the screen, called corp. I will show how Corp functions in a negative feedback loop on the tumor suppressor P53 and functions as the functional analog of the vertebrate Mdm2. In Chapter 4, I will show my work on the characterization of another candidate gene, fs(1)Yb, identified as a inducer of apoptotic phenotype in the screen. In Chapter 5, I will address the roles played by p53 and corp on the viability of the animals when they are exposed to DNA damaged, caused by ionizing radiation. Finally in Chapter 6, I perform a critical analysis of all my findings and discuss how they contribute to answering the bigger question addressed at the beginning of this dissertation, that is, how a cell survives irreparable DNA damage. In the Appendices, I present the entire data sheet of 9 EP screen results and a list of the Drosophila stocks that I have constructed, for future reference and use. 10 Figure 1. DNA damage response pathways. Insult to the DNA triggers a damage response through signal transducers (like ATM, ATR, and checkpoint kinases) and effectors (like p53, Cdc25, nbs1 and BRCA1) that activate multiple downstream pathways to combat the damage - cell cycle arrest, DNA repair, and apoptosis. Apoptotic response occurs particularly in response to irreparable damage. These pathways are mostly conserved from mammals to lower invertebrates. 11 12 References Ahmad, K.K., and Golic, K.G.K. (1999). Telomere loss in somatic cells of Drosophila causes cell cycle arrest and apoptosis. Genetics 151, 1041-1051. Bi, X. (2005). Drosophila ATM and Mre11 Are Essential for the G2/M Checkpoint Induced by Low-Dose Irradiation. Genetics 171, 845-847. Brodsky, M.H., Weinert, B.T., Tsang, G., Rong, Y.S., McGinnis, N.M., Golic, K.G., Rio, D.C., and Rubin, G.M. (2004). Drosophila melanogaster MNK/Chk2 and p53 Regulate Multiple DNA Repair and Apoptotic Pathways following DNA Damage. Molecular and Cellular Biology 24, 1219-1231. Brown, A.L., Lee, C.H., Schwarz, J.K., Mitiku, N., Piwnica-Worms, H., and Chung, J.H. (1999). A human Cds1-related kinase that functions downstream of ATM protein in the cellular response to DNA damage. Proc. Natl. Acad. Sci. U.S.a. 96, 3745-3750. Bunz, F., Dutriaux, A., Lengauer, C., Waldman, T., Zhou, S., Brown, J.P., Sedivy, J.M., Kinzler, K.W., and Vogelstein, B. (1998). Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science 282, 1497-1501. Chan, T.A., Hermeking, H., Lengauer, C., Kinzler, K.W., and Vogelstein, B. (1999). 14-3-3|[sigma]| is required to prevent mitotic catastrophe after DNA damage. Nature 401, 616-620. Chaturvedi, P.P., Eng, W.K.W., Zhu, Y.Y., Mattern, M.R.M., Mishra, R.R., Hurle, M.R.M., Zhang, X.X., Annan, R.S.R., Lu, Q.Q., Faucette, L.F.L., et al. (1999). Mammalian Chk2 is a downstream effector of the ATM-dependent DNA damage checkpoint pathway. Oncogene 18, 4047-4054. Chipuk, J.E., and Green, D.R. (2006). Dissecting p53-dependent apoptosis. Cell Death Differ 13, 994-1002. D'Amours, D., and Jackson, S.P. (2002). The mre11 complex: at the crossroads of dna repair and checkpoint signalling. Nat. Rev. Mol. Cell Biol. 3, 317-327. David, S.S., O'Shea, V.L., and Kundu, S. (2007). Base-excision repair of oxidative DNA damage. Nature 447, 941-950. de Vries, H.I. (2005). Grp/DChk1 is required for G2-M checkpoint activation in Drosophila S2 cells, whereas Dmnk/DChk2 is dispensable. Journal of Cell Science 118, 1833-1842. Donehower, L.A.L., Harvey, M.M., Slagle, B.L.B., McArthur, M.J.M., Montgomery, C.A.C., Butel, J.S.J., and Bradley, A.A. (1992). Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356, 215-221. 13 Fridman, J.S., and Lowe, S.W. (2003). Control of apoptosis by p53. Oncogene 22, 9030-9040. Hartwell, L.H., and Weinert, T.A. (1989). Checkpoints: controls that ensure the order of cell cycle events. Science 246, 629-634. Haupt, S. (2003). Apoptosis - the p53 network. Journal of Cell Science 116, 4077-4085. Hefferin, M.L., and Tomkinson, A.E. (2005). Mechanism of DNA double-strand break repair by non-homologous end joining. DNA Repair (Amst) 4, 639-648. Hirao, A. (2000). DNA Damage-Induced Activation of p53 by the Checkpoint Kinase Chk2. Science 287, 1824-1827. Hoeijmakers, J.H. (2001). Genome maintenance mechanisms for preventing cancer. Nature 411, 366-374. Jackson, S.P., and Bartek, J. (2009). The DNA-damage response in human biology and disease. Nature 461, 1071-1078. Jiricny, J. (2006). The multifaceted mismatch-repair system. Nat. Rev. Mol. Cell Biol. 7, 335-346. Kim, S.T., Lim, D.S., Canman, C.E., and Kastan, M.B. (1999). Substrate Specificities and Identification of Putative Substrates of ATM Kinase Family Members. Journal of Biological Chemistry 274, 37538-37543. Kurzhals, R.L., Titen, S.W.A., Xie, H.B., and Golic, K.G. (2011). Chk2 and p53 are haploinsufficient with dependent and independent functions to eliminate cells after telomere loss. PLoS Genet 7, e1002103-e1002103. LaRocque, J.R., Jaklevic, B., Su, T.T., and Sekelsky, J. (2007). Drosophila ATR in double-strand break repair. Genetics 175, 1023-1033. Li, Y.-Z., Lu, D.-Y., Tan, W.-Q., Wang, J.-X., and Li, P.-F. (2008). p53 initiates apoptosis by transcriptionally targeting the antiapoptotic protein ARC. Molecular and Cellular Biology 28, 564-574. Lieber, M.R. (2008). The mechanism of human nonhomologous DNA end joining. J. Biol. Chem. 283, 1-5. Liu, Q., Guntuku, S., Cui, X.S., Matsuoka, S., Cortez, D., Tamai, K., Luo, G., Carattini-Rivera, S., DeMayo, F., Bradley, A., et al. (2000). Chk1 is an essential kinase that is regulated by Atr and required for the G(2)/M DNA damage checkpoint. Genes & Development 14, 1448-1459. Matsuoka, S., Huang, M., and Elledge, S.J. (1998). Linkage of ATM to cell cycle 14 regulation by the Chk2 protein kinase. Science 282, 1893-1897. McNamee, L.M., and Brodsky, M.H. (2009). p53-Independent Apoptosis Limits DNA Damage-Induced Aneuploidy. Genetics 182, 423-435. Miyashita, T., and Reed, J.C. (1995). Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80, 293-299. Mukherjee, S., LaFave, M.C., and Sekelsky, J. (2009). DNA damage responses in Drosophila nbs mutants with reduced or altered NBS function. DNA Repair (Amst). Nakano, K., and Vousden, K.H. (2001). PUMA, a novel proapoptotic gene, is induced by p53. Mol. Cell 7, 683-694. Nurse, P. (1997). Checkpoint pathways come of age. Cell 91, 865-867. Nussenzweig, A., Chen, C., da Costa Soares, V., Sanchez, M., Sokol, K., Nussenzweig, M.C., and Li, G.C. (1996). Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature 382, 551-555. Oda, E., Ohki, R., Murasawa, H., Nemoto, J., Shibue, T., Yamashita, T., Tokino, T., Taniguchi, T., and Tanaka, N. (2000). Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science 288, 1053- 1058. Ouyang, H., Nussenzweig, A., Kurimasa, A., Soares, V.D.C., Li, X., CordonCardo, C., Li, W.H., Cheong, N., Nussenzweig, M., Iliakis, G., et al. (1997). Ku70 Is Required for DNA Repair but Not for T Cell Antigen Receptor Gene Recombination In Vivo. Journal of Experimental Medicine 186, 921-929. Peters, M., DeLuca, C., Hirao, A., Stambolic, V., Potter, J., Zhou, L., Liepa, J., Snow, B., Arya, S., Wong, J., et al. (2002). Chk2 regulates irradiation-induced, p53-mediated apoptosis in Drosophila. Proc Natl Acad Sci USA 99, 11305- 11310. Robles, A.I., Bemmels, N.A., Foraker, A.B., and Harris, C.C. (2001). APAF-1 is a transcriptional target of p53 in DNA damage-induced apoptosis. Cancer Res. 61, 6660-6664. Royou, A., Macias, H., and Sullivan, W. (2005). The Drosophila Grp/Chk1 DNA Damage Checkpoint Controls Entry into Anaphase. Current Biology. San Filippo, J., Sung, P., and Klein, H. (2008). Mechanism of Eukaryotic Homologous Recombination. Annu. Rev. Biochem. 77, 229-257. Sancar, A.A., Lindsey-Boltz, L.A.L., Unsal-Kaçmaz, K.K., and Linn, S.S. (2004). Molecular mechanisms of mammalian DNA repair and the DNA damage 15 checkpoints. Biochemistry 73, 39-85. Sanchez, Y., Wong, C., Thoma, R.S., Richman, R., Wu, Z., Piwnica-Worms, H., and Elledge, S.J. (1997). Conservation of the Chk1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science 277, 1497-1501. Sekelsky, J.J., Brodsky, M.H., and Burtis, K.C. (2000). DNA Repair in Drosophila. The Journal of Cell Biology. Sengupta, S., and Harris, C.C. (2005). p53: traffic cop at the crossroads of DNA repair and recombination. Nat. Rev. Mol. Cell Biol. 6, 44-55. Seo, Y.R., Fishel, M.L., Amundson, S., Kelley, M.R., and Smith, M.L. (2002). Implication of p53 in base excision DNA repair: in vivo evidence. Oncogene 21, 731-737. Sogame, N., Kim, M., and Abrams, J.M. (2003). Drosophila p53 preserves genomic stability by regulating cell death. Proc. Natl. Acad. Sci. U.S.a. 100, 4696-4701. Song, Y.-H. (2005). Drosophila melanogaster: a Model for the Study of DNA Damage Checkpoint Response. Mol. Cells 19, 3651-3660. Song, Y.-H., Mirey, G., Betson, M., Haber, D.A., and Settleman, J. (2004). The Drosophila ATM ortholog, dATM, mediates the response to ionizing radiation and to spontaneous DNA damage during development. Curr. Biol. 14, 1354-1359. Takai, H., Tominaga, K., Motoyama, N., Minamishima, Y.A., Nagahama, H., Tsukiyama, T., Ikeda, K., Nakayama, K., Nakanishi, M., and Nakayama, K. (2000). Aberrant cell cycle checkpoint function and early embryonic death in Chk1(-/-) mice. Genes & Development 14, 1439-1447. Tauchi, H., Kobayashi, J., Morishima, K.-I., van Gent, D.C., Shiraishi, T., Verkaik, N.S., vanHeems, D., Ito, E., Nakamura, A., Sonoda, E., et al. (2002). Nbs1 is essential for DNA repair by homologous recombination in higher vertebrate cells. Nature 420, 93-98. Titen, S.W.A., and Golic, K.G. (2008). Telomere Loss Provokes Multiple Pathways to Apoptosis and Produces Genomic Instability in Drosophila melanogaster. Genetics 180, 1821-1832. van Bergeijk, P., Heimiller, J., Uyetake, L., and Su, T.T. (2012). Genome-Wide Expression Analysis Identifies a Modulator of Ionizing Radiation-Induced p53Independent Apoptosis in Drosophila melanogaster. PLoS ONE 7, e36539. Vousden, K.H., and Lu, X. (2002). Live or let die: the cell's response to p53. Nat. Rev. Cancer. 2, 594-604. 16 Wang, X.W., Yeh, H., Schaeffer, L., Roy, R., Moncollin, V., Egly, J.M., Wang, Z., Friedberg, E.C., Evans, M.K., Taffe, B.G., et al. (1995). p53 modulation of TFIIH- associated nucleotide excision repair activity. Nat Genet 10, 188-195. Wichmann, A., Jaklevic, B., and Su, T.T. (2006). Ionizing radiation induces caspase-dependent but Chk2- and p53-independent cell death in Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.a. 103, 9952-9957. Williams, R.S., Williams, J.S., and Tainer, J.A. (2007). Mre11-Rad50-Nbs1 is a keystone complex connecting DNA repair machinery, double-strand break signaling, and the chromatin template. Biochem. Cell Biol. 85, 509-520. Wolff, S., Erster, S., Palacios, G., and Moll, U.M. (2008). p53's mitochondrial translocation and MOMP action is independent of Puma and Bax and severely disrupts mitochondrial membrane integrity. Cell Res 18, 733-744. Xu, J., Xin, S., and Du, W. (2001). Drosophila Chk2 is required for DNA damagemediated cell cycle arrest and apoptosis. FEBS Letters 508, 394-398. Yoshida, K.K., and Miki, Y.Y. (2010). The cell death machinery governed by the p53 tumor suppressor in response to DNA damage. Cancer Sci 101, 831-835. Yuan, J., and Chen, J. (2010). MRE11-RAD50-NBS1 Complex Dictates DNA Repair Independent of H2AX. Journal of Biological Chemistry 285, 1097-1104. Zhou, B.-B.S., and Elledge, S.J. (2000). The DNA damage response: putting checkpoints in perspective. Nature 408, 433-439. 17 CHAPTER 2 IDENTIFYING NOVEL GENES THAT MODULATE CELL SURVIVAL FOLLOWING IRREPARABLE DNA DAMAGE IN DROSOPHILA MELANOGASTER 18 Abstract The DNA damage response machinery responds to irreparably damaged or broken DNA by activating the apoptotic pathway so that such cells are eliminated, to help maintain the fidelity of the genome. A chromosome lacking a single telomere represents irreparable DNA damage and triggers apoptotic response. However, there is evidence that some cells can survive telomere loss and continue to proliferate. This is detrimental to the health of the organism as it induces genomic instability, genetic imbalance, and predisposes cells towards carcinogenesis. So, it is essential to understand the underlying mechanisms by which a cell can survive telomere loss. To do that, we first built a tractable genetic model of a single telomere loss in somatic cells. We found that some cells do survive after a single telomere loss. Then I used this system to carry out a genetic misexpression screen to identify genes that behave as inducers or suppressors cell death after telomere loss. I identified four suppressors and three inducers through this screen. Introduction The normal ends of chromosomes are protected and do not participate in chromosomal rearrangements. However, when broken ends are created by ionizing radiation, they cannot substitute for normal ends (Muller, 1940). This formed the earliest definition of telomere. Telomeres were rediscovered later structurally as nucleic acid-protein complexes that protect the end of linear chromosomes from end-to-end fusions and solve the end replication problem 19 (Blackburn, 2001). They consist of repetitive sequences at the chromosome termini that are bound by proteins, which can recognize the terminal repeats. Such a protein is telomerase, which plays a role in extending the repeat sequences at the chromosome ends. Most dipterans, however, do not have telomerase; instead, the ends are maintained by repeated transposition of retrotransposons (Biessmann and Mason, 2003). Despite this difference, the telomere capping proteins that protect the chromosome from end-to-end fusion events are mostly conserved between the eukaryotes (Cenci et al., 2005) and loss of the telomere triggers the similar instability response, suggesting that telomere maintenance is an essential phenomenon in a general biological perspective. A missing telomere poses a unique challenge to the repair machinery. It cannot be repaired by methods that reattach two broken ends. In the 1930s, while Barbara McClintock was using cytogenetics to follow the fate of broken chromosomes in maize, she demonstrated that chromosomes that have lost their normal ends undergo end-to-end fusion, forming anaphase bridges that subsequently break, and a breakage-fusion-bridge (BFB) cycle follows (McClintock, 1939). A single missing telomere is capable of inducing persistent genomic instability in the cells. This genomic instability cannot be repaired and forms a hallmark of cancer (Al-Mulla et al., 1999; Artandi and DePinho, 2010; Murnane, 2010; Ong et al., 1998; Schneider and Kulesz-Martin, 2004). There is evidence of aberrant karyotypes including fusion events involving other chromosomes, polyploidy, and chromosomal rearrangements in cells that 20 originally had a single telomere loss (Hackett and Greider, 2003; Sabatier et al., 2005; Sandell, 1993; Titen and Golic, 2008). Such cells usually undergo apoptosis to stem the spread of the unstable genome to the daughter cells; however, cancer cells exemplify instances where they escape apoptosis and continue to survive and proliferate. In Drosophila, a fraction of somatic cells have been found to survive after telomere loss (Ahmad and Golic, 1999; Kurzhals et al., 2011; Titen and Golic, 2008). It is important to understand how they can survive, because that can help us understand the development of cancer. Here, I induce irreparable DNA damage in the form of a single telomere loss specifically in the developing eye to build a tractable system for quantitatively assaying the fate of cells: that is, to find out if they can survive or succumb to cell death. We call this the BARTL (Bar + Telomere Loss) assay and found that some cells can survive and reconstitute a partial eye after telomere loss. In this background, I carried out a genetic misexpression screening to identify genes that help cells to survive better or incline them to die faster. My screen uncovered four suppressors and three enhancers of the cell death phenotype following telomere loss. Materials and methods Drosophila stock collections: (1) UAS-FLP stocks used: P{UAS-FLP1.1D}JD1 (BL 4539), P{UASFLP1.1D}JD2 (BL 4540), P{UAS-FLP.Exel}3 (BL 8209) and P{UASFLP}2B and P{UAS-FLP, ry+}SB3 were from our lab stock collection. 21 (2) eyGal4 stocks used: P{Gal4-ey.H}3-8 (BL 5534), P{Gal4-ey.H}4-8 (BL 5535), P{ey3.5Gal4.Exel}2 (BL 8220), and P{ey3.5Gal4.Exel}3 (BL 8219). (3) P{EPgy2}: All available EPgy2 stocks on chromosome X (total # 600) were obtained from Bloomington Drosophila Stock Center. For a detailed list, refer to Appendix A. (3) RNAi stocks used are as follows: RNAi-corp: v102751, v16130 RNAi-CG1632: v106107, v5478 RNAi-Pdcd4: v16160, v16162, BL 38445 RNAi-CG8924: v48041, v48042, BL 35705 RNAi-Med18: v48490, v48491, v28265, v28264, v106760 RNAi-CG2701: v106635, v25433 RNAi-fs(1)Yb: BL 35181, BL35301 RNAi-CG14814: v41553 RNAi-CrebB17A: v6103 RNAi-SmG: BL 26617 RNAi-mthl1: v33136, BL 15318 (4) Other stocks used: y w/DcY(H1) or simply H1 (Kurzhals et al., 2011), [>w+]89A (laboratory stock), P{eyFLP.N}5 (BL5576). Crosses: All crosses were maintained at 25°C on standard cornmeal food. 22 Results and discussion Irreparable DNA damage is modeled in the form of a single telomere loss in the proliferating cells of the eye. To build a tractable model system where the fate of cells following irreparable DNA damage can be observed, we induced telomere loss on a single chromosome - a loss that cannot be repaired by the DNA repair machinery. The basic blueprint of this method is to induce recombination between inverted FRT sites on sister chromatids of the chromosome by FLP induction (Golic and Lindquist, 1989), so that a dicentric chromosome is produced. When this dicentric chromosome is pulled towards two opposite poles during the anaphase of the next mitotic cycle, it will break, delivering a chromosome with a broken end/ lost telomere to each of the daughter cells. For our system, we used flies that carry FRTs on the Y chromosome. This chromosome is referred to as the H1 chromosome (Figure 2A), after Heng Xie who constructed it. It has inverted FRTs inserted on its long arm, marked by whs. Distal to the FRTs is the dominant BS mutation (Fristrom, 1969; Michinomae and Kaji, 1973). A y+ gene is located at the tip of its short arm. FLP expression, for inducing recombination between the FRT sites, was produced specifically in proliferating cells of the eye by the UAS-Gal4 system (Brand and Perrimon, 1993). On induction of FLP-mediated recombination between the inverted FRTs on the H1 chromosome, a dicentric chromosome and a reciprocal acentric chromosome are formed and BS is located on the acentric. This acentric fragment is frequently lost (Titen and Golic, 2008). Thus, the telomere loss is 23 marked by the loss of BS mutation (Figure 3). Hence this method of inducing irreparable DNA damage in the form of a single telomere loss, marked by the loss of BS, is called BARTL (BARStone Telomere Loss) (Kurzhals et al., 2011). We chose to induce telomere loss specifically in the eye because onset of severe apoptosis in the eye due to telomere loss may deplete the eye but should not affect the organismal viability, such that even the worst apoptotic phenotype can be reliably scored. As we shall see, this assumption is not entirely true, primarily because eyeless expression was not completely limited to the eye. We chose the Y chromosome for inducing the single telomere loss because it is dispensable for the viability of the fly only. Thus, if cells die en masse following telomere loss, it can be argued that the effect is solely in response to irreparable DNA damage, not due to aneuploidy. Somatic cells can survive following irreparable DNA damage. Now that telomere loss is induced, the question is, what fate does this incur to the cells: do they all die or do some of them survive? If they all die, we would expect to see the ablation of the eye. If some survive in spite of the incurred telomere loss, we might see a larger eye owing to survival and proliferation of cells that have lost BS. I tested different combinations of UAS-FLP and eyelessGal4 (eyGal4) transgenic insertion (on chromosome 2 or 3) lines from the Bloomington Stock Center in the BARTL assay to check which combination gives the strongest and most consistent phenotype. The outcome of each combination is presented in Figure 2C-T. The different combinations of UAS-FLP and eyGal4 with H1 gave a 24 variety of eye phenotypes, from no change to a wide range of eye sizes - from no eye or tiny eye to wildtype-like eyes, categorized from 1 to 5 (small to large) (Figure 2B). As a control, all the UAS-FLP and eyGal4 transgenic lines were individually crossed to H1 males to test if they can modify the BS phenotype by themselves. They had no effect on BS. For our future experiments, we chose the two best combinations for generating telomere loss on H1: P{UAS-FLP1.D}JD1, P{Gal4-ey.H}4-8 and P{UAS-FLP}2B, P{Gal4-ey.H}4-8. When tested for their ability to flip-out a FRTflanked w+ gene, they both produced maximum yellowish orange eye or mosaic eye phenotypes (yellowish orange base pigmentation due to the w+ marker of the FLP transgene) with a few dark red ommatidia (Table 1). Besides, the P{UASFLP1.D}JD1, P{Gal4-ey.H}4-8 combination mostly produces a consistent moderate-sized eye phenotype (Figure 2K), bigger than BS, suggesting that some cells do survive following telomere loss and proliferate to reconstitute the eye, at least partially. This proved useful because the window of moderate-sized eye phenotype could be shifted either to be made worse, to produce tiny eyes as an inducer of cell-death phenotype, or to be made better, i.e., wildtype-like eyes as a suppressor of cell-death phenotype under different genetic misexpression conditions that would modify the cell fate to produce such shifted eye phenotypes. I recombined P{UAS-FLP1.D}JD1 and P{Gal4-ey.H}4-8 on chromosome 2 over the SM1 balancer chromosome and abbreviated it as the eGUF4.8JD1 recombinant. Similarly, I constructed the recombinant for the other combination and called it eGUF4.82B. 25 A genetic misexpression screen identifies novel genes that regulate somatic cell survival phenotype following irreparable DNA damage. In control y w/H1; eGUF4.82B/+ flies, the BARTL phenotype distribution was localized between eye size categories 2 and 3 (Figure 2D). To identify genes that regulate DNA damage-induced apoptosis, I carried out a genetic misexpression screen using EP elements (Rørth, 1996) in the eGUF4.82B/+-mediated BARTL background and screened for those EP lines that significantly modified this BARTL phenotype. For the screen, I crossed y w/H1; eGUF4.82B/SM1, Cy males individually to the females of each of the EP stocks in such a way that eyGal4 drives telomere loss and EP element-induced misexpression of a random endogenous gene in all the proliferating cells of a developing eye (Figure 4). This allowed me to assess whether this alteration of gene expression had any effect on eye size. I screened ~600 X-chromosome P{EPgy2} lines available at Bloomington Drosophila Stock Center. The detailed screening datasheet is presented in Appendix I. From this screen, I identified seven elements that significantly altered eye size (Figures 5, 6; Table 2) when tested with eGUF4.82B and eGUF4.8JD1. The identified EP lines' effects are limited to eyes with telomere loss. Next, we wanted to find out if these screened EP lines, induced or uninduced, have any modifying effect on BS or wildtype eyes without telomere loss. In order to investigate this, I crossed the EP lines with (1) y w/H1; (2) y w/H1 eyGal44.8/SM1, Cy; (3) y w/Y; eGUF4.8JD1. None of the seven lines have a significant modifying effect on BS or wildtype eyes in absence of telomere loss (Table 3). 26 Then, we wanted to determine if the modifying effect of EP on telomere loss requires Gal4 (i.e., EP/H1; eyFLP/+). My results show that EP stock # 17674 produces large eyes after telomere loss without Gal4 dependence (Table 3). However, this does not exclude this line from consideration, but it possibly indicates that the change in phenotype is due to insertional mutagenesis. In support, some of the RNAi lines tested against the candidate gene of this stock, MED18, produced large eye phenotype too (Table 4). RNAi-mediated knockdown confirms the efficacy of candidate genes as a potent modifier of BARTL phenotype. In order to verify that EP drives the BARTL phenotype, I tested RNAi-mediated knockdown of candidate genes for reversal of phenotype in the BARTL assay. Of the seven candidates, only knockdown of corp (the candidate gene of EP stock #15650) produced a phenotype radically opposite to that of EP-mediated overexpression and the knockdown of fs(1)Yb (the candidate gene of EP stock #15778) produced a somewhat opposite phenotype to that of EP-mediated overexpression (Table 4). P{EPgy2} insertion-induced overexpression of corp+ (EP-corp+) modifies the BARTL phenotype to produce wildtype eyes following telomere loss, while RNAimediated corp knockdown (RNAi-corp) eliminates the eyes entirely. One possibility was that corp might not be the effected gene in the EP line # 15650. corp is contained entirely in the intron of a gene, CG1632, which is transcribed in the opposite direction and the EP insertion might interfere with CG1632 expression (Figure 7). However, since the RNAi-mediated knockdown of CG1632 27 did not modify the BARTL phenotype (Table 4), this indicated that corp is likely the affected gene in EP line # 15650. The fact that RNAi against the rest of the candidate genes failed to produce an opposite effect to that of their EP-mediated overexpression, however, did not rule out their candidacy as enhancers or suppressors of cell-death phenotype following telomere loss. It is possible that the basal level of these genes is already quite low in normal conditions and that the knockdown could not take the levels down significantly lower beyond their basally low levels to produce any observably different phenotype in the BARTL assay. On the other hand, overexpression of these genes could increase their levels well above the threshold needed to produce a very significant modification of the BARTL phenotype. An important implication of the uncovering of these candidate genes is that when cells survive irreparable DNA damage, it may not be only from deleterious mutations in the apoptotic pathway components, but it is also possible that there are some defined genetic pathways that control it. Characterization of putative genes identified through our screen may shed more light into these pathways. Since corp and fs(1)Yb were identified as the two most interesting genes in the EP screen as modifiers of cell fate following irreparable DNA damage, we chose to further characterize these two genes. 28 Figure 2. BARTL phenotype produced by different combinations of UASFLP and eyGal4. (A) Graphical representation of the DcY(H1) chromosome used in the BARTL assay. The DcY(H1) chromosome is a Y chromosome that carries y+ on the short arm and BS on the long arm. Inverted FRTs are inserted proximal to BS. The centromere is represented as a solid black circle, the telomeres as green rectangles, and the BS gene as a red rectangle. The halfarrows indicate the inverted FRTs. (B) The eye phenotype distribution observed in the BARTL assay. The BS phenotype of H1 control males is shown at the left. When FLP is expressed (ey>FLP), the phenotypes can either remain unchanged (BS) or range from headless pharates (category 1) to adults with a fully developed wildtype eye (category 5). (C-T) The distribution of BARTL eye phenotype produced by males carrying the H1 chromosome and different combinations of various UAS-FLP and eyGal4 stocks tested. N, number of fly eyes scored. 29 FRT A. y+ BS B. 5 4 4 5 5 3 4 3 2 2 5 2 3 2 1 3 4 5 y w/H1; {eyGal4.Exel}2/+; {UAS-FLP}SB3/+ N= 34 5 5 4 4 3 3 2 2 1 1 S BS 4 5 3 4 2 3 1 2 BS 1 y w/H1; {UAS-FLP}JD1 {eyGal4}3.8/+ N= 228 S 4 100 100 80 80 60 60 40 40 20 20 00 1 BS B J. 1 S B 100 100 80 80 60 60 40 40 20 20 00 1 y w/H1; {eyGal4}3.8/+; {UAS-FLP}SB3/+ N= 126 B 5 5 3 4 2 3 2 1 BS % of eyes 4 y w/H1; {eyGal4.Exel}3 {UAS-FLP}SB3/+ N= 58 BS 100 100 80 80 60 60 40 40 20 20 00 5 y w/H1; {UAS-FLP}2B {eyGal4}4.8/+ N= 286 S 5 5 3 4 2 F. H. 3 2 1 100 100 80 80 60 60 40 40 20 20 00 4 B 4 % of eyes 5 5 3 4 3 2 D. % of eyes 4 3 5 3 4 3 2 2 1 1 BS S 100 100 80 80 60 60 40 40 20 20 00 2 y w/H1; {eyGal4}4.8/+; {UAS-FLP}SB3/+ N= 42 B % of eyes I. 1 BS S 100 100 80 80 60 60 40 40 20 20 00 1 y w/H1; {UAS-FLP}2B {eyGal4.Exel}2/+ N= 62 B % of eyes G. 1 B S BS 1 100 100 80 80 60 60 40 40 20 20 00 2 y w/H1; {UAS-FLP}2B {eyGal4}3.8/+ N= 96 S % of eyes 100 100 80 80 60 60 40 40 20 20 00 B E. % of eyes C. 1 % of eyes BS 5 30 Figure 2 continued. 5 4 3 2 1 5 B 5 5 4 4 3 3 2 2 1 1 5 4 3 2 1 y w/H1; {eyGal4.Exel}2/+ {UAS-FLP}JD2/+; N= 38 5 4 3 2 1 S B 2 3 4 5 1 4 BS 3 y w/H1; {eyGal4.Exel}2/+; {UAS-FLP.Exel}3/+; N= 66 2 100 100 80 80 60 60 40 40 20 20 00 1 5 T. B 4 5 3 4 2 3 2 1 S B 1 4 % of eyes 5 5 4 y w/H1; {eyGal4}4.8/+; {UAS-FLP.Exel}3/+; N= 56 BS 100 100 80 80 60 60 40 40 20 20 00 3 y w/H1; {eyGal4}3.8/+; {UAS-FLP.Exel}3/+; 100 100 N= 116 80 80 60 60 40 40 20 20 00 BS 1 2 3 4 5 R. 4 3 3 2 2 1 BS S B S BS 2 B 5 y w/H1; {eyGal4.Exel}3 {UAS-FLP}JD2/+; N= 72 1 y w/H1; {eyGal4}3.8/+ {UAS-FLP}JD2/+; N= 86 S 5 4 % of eyes P. 4 3 BS S 5 5 4 3 4 100 100 80 80 60 60 40 40 20 20 00 y w/H1; {UAS-FLP}JD1 {eyGal4.Exel}2/+ N= 106 % of eyes N. 100 100 80 80 60 60 40 40 20 20 00 B S 5 5 4 3 2 2 2 100 % of eyes 3 3 1 S. 100 80 80 60 60 40 40 20 20 00 4 % of eyes 100 % of eyes 2 2 BS Q. 100 80 80 60 60 40 40 20 20 00 3 y w/H1; {eyGal4}4.8/+ {UAS-FLP}JD2/+; N= 102 B S % of eyes 100 1 1 BS O. 100 80 80 60 60 40 40 20 20 00 2 y w/H1; {UAS-FLP}JD1/+; {eyGal4.Exel}3/+ N= 196 1 80 80 60 60 40 40 20 20 00 B % of eyes 100 S M. 100 1 1 BS L. % of eyes y w/H1; {UAS-FLP}JD1 {eyGal4}4.8/+ N= 1053 1 80 80 60 60 40 40 20 20 00 B % of eyes 100 S K. 100 5 31 Figure 3. The DcY(H1) chromosome and BARTL assay. Chromosome breakage and telomere loss in the BARTL assay. The DcY(H1) chromosome (drawn as sister chromatids in G2) is a Y chromosome that carries y+ on the short arm and BS on the long arm. Inverted FRTs are inserted proximal to BS. The centromere is represented as a solid black circle, the telomeres as green rectangles, BS gene as a red rectangle, and inverted FRTs as half-arrows. When FLP mediates unequal sister chromatid exchange between inverted FRTs, a dicentric and an acentric chromosome are produced. In the subsequent mitotic anaphase, the dicentric chromosome is pulled to opposite poles and usually breaks. Each daughter cell receives a chromosome with a single broken end and one or both daughter cells lose the BS-containing acentric fragment. 32 33 Figure 4. Schematic of the EP screen. The EP screen is designed such that telomere loss and an endogenous gene is overexpressed at the same time in the developing eye. The eyeless promoter (yellow oval) drives Gal4 (blue rectangle) expression specifically in the proliferating cells of the developing eye, where the Gal4 protein (blue oval) then binds to the UAS sequence (brown rectangle) upstream of FLP gene (red rectangle) and in the EP-element to simultaneously overexpress FLP and a random endogenous gene (magenta rectangle) at the downstream of the EP insertion. FLP (red oval) induces recombination of the FRTs and eventual telomere loss on the H1 chromosome in these cells. 34 Gal4 Activation UAS sequence eyeless FLP FLP s B FRT Gal4 Bs Gal4 UAS sequence EP element Activation endogeneous gene 35 Figure 5. EP screen identifies seven lines that suppresses or enhances the BARTL phenotype, produced by the y w/H1; eGUF4.8JD1. The distribution of BARTL eye phenotype produced by males of (A) in control males following dicentric induction by eGUF4.8JD1; (B) in males carrying P{EPgy2}EY03495 (BL 15650); (C) in males carrying P{EPgy2}EY09634 (BL 16945); (D) in males carrying P{EPgy2}EY00245 (BL 14821); (E) in males carrying P{EPgy2}EY10359 (BL 17674); (F) in males carrying P{EPgy2}EY04983 (BL 15778); (G) in males carrying P{EPgy2}EY04780 (BL 16617); (H) in males carrying P{EPgy2}EY16157 (BL 21192). For the eye phenotype distribution, refer to Figure 2B. N, number of fly eyes scored. 36 % of eyes 2 3 4 5 100 G. 100 80 80 60 60 40 40 20 20 00 100 100 80 80 60 60 40 40 20 20 00 4 5 100 H. 100 80 80 60 60 40 40 20 20 00 4 5 3 4 2 3 2 S 1 5 3 4 5 22 3 4 5 BL 16617 N= 36 BBSS 11 2 33 4 4 5 55 BL 21192 N= 40 % of eyes BL 14821 N= 178 BS 1 1 5 3 4 2 3 1 2 B S BS BBSS % of eyes BL 16945 N= 244 2 BL 15778 N= 38 S 1 100 100 80 80 60 60 40 40 20 20 00 1 5 F. BS 4 5 3 4 BL 17674 N= 197 2 % of eyes 3 100 80 80 60 60 40 40 20 20 0 0 100 B BS B D. 100 100 80 80 60 60 40 40 20 20 00 2 BL 15650 N= 256 % of eyes % of eyes C. 1 1 100 100 80 80 60 60 40 40 20 20 00 BS % of eyes B. E. Control N= 1053 1 100 100 80 80 60 60 40 40 20 20 00 % of eyes A. BS 1 2 3 37 Figure 6. The seven EP strains identified in the screen suppresses or enhances the BARTL phenotype, produced by the y w/H1; eGUF4.82B. The distribution of BARTL eye phenotype produced by males of (A) controls following dicentric induction by eGUF4.82B; (B) BL 15650; (C) BL 16945; (D) BL 14821; (E) BL 17674; (F) BL 15778; (G) BL 16617; (H) BL 21192. For the eye phenotype distribution, refer to Figure 2B. N, number of fly eyes scored. 38 5 5 5 4 4 4 3 1 B S 2 3 2 2 3 4 5 5 5 5 4 4 4 3 3 2 1 2 BL 21192 N= 34 BS 1 2 100 100 80 80 60 60 40 40 20 20 00 1 1 % of eyes 5 5 4 4 3 3 2 2 1 S B 1 BS S H. 3 BL 16617 N= 58 B 5 BL 14821 N= 76 BS 1 % of eyes 4 5 3 4 2 3 2 1 1 BS S B S BS 2 2 3 100 G. 100 80 80 60 60 40 40 20 20 00 BL 16945 N= 68 1 BL 15778 N= 98 B 5 BS 1 % of eyes 4 5 3 4 2 3 1 2 1 B S BS 100 100 80 80 60 60 40 40 20 20 00 BL 17674 N= 98 S % of eyes 5 5 4 4 3 2 1 3 F. % of eyes D. 100 100 80 80 60 60 40 40 20 20 00 2 BL 15650 N= 106 % of eyes 100 C. 100 80 80 60 60 40 40 20 20 00 1 100 100 80 80 60 60 40 40 20 20 00 B B S BS % of eyes B. 100 100 80 80 60 60 40 40 20 20 00 E. y w/H1; eyGal4-4.8 UASFLP2B/Cy Control N= 286 % of eyes A. 100 100 80 80 60 60 40 40 20 20 00 3 4 5 39 Figure 7. EP-element insertion map at corp genomic region. The corp genomic region on the X chromosome (blue), corp transcripts (corp-RA), and corp cDNA sequence (CDS, color coded magenta); adapted from FlyBase: http://flybase.org/reports/FBgn0030028.html). Orange shading denotes the protein coding regions and grey shading denotes the 5' and 3' UTR regions on the corp transcript. The blue arrowhead indicates the site of the EY03495 EPgy2 insertion, marked by a black empty rectangle. Directionality of EP-mediated induction: to the left if arrowhead points up, to the right if arrowhead points down. 40 41 Table 1. Strength of FLP expression tested by their ability to flip-out w+ gene when crossed to P[>w+>]. Stocks tested Eye phenotype of progenies P{UAS-FLP2B} P(eyGal4}4.8 70% have orange eyes, 30% have mosaic eyes with a few w+ (red) ommatidia. 100% have yellowish orange eyes. P{UAS-FLP1.D}JD1 P(eyGal4}4.8 P(eyGal4}3.8; P{UAS-FLP }SB3 71% have orange eyes, 29% have mosaic eyes with a few w+ (red) ommatidia. 42 Table 2. EPgy2 lines identified as modifiers of BARTL phenotype induced by y w/H1; eGUF4.8JD1/+. P{EPgy2} stocksa Target gene Cytogenetic map Nb BARTL phenotypec Functional annotationd 15650 corp 7E1-7E1 256 100% cat. 5 16945 Pdcd4 12B4-12B10 244 98% cat. 4, 2% BS p53-dependent, irradiationinduced, apoptosis-related stem cell differentiation 14821 CG8924 14A1-14A1 178 99% cat. 4, 1% cat. 2 17674 Med18 2B13-2B13 197 100% cat. 5 15778 fs(1)Yb 3B3-3B3 38 16617 CrebB-17A 17A7-17A8 36 98% cat. 1, 2% cat. 4 cAMP-regulated transcription 21192 SmG/mthl1 14F4-14F4 40 100% cat. 1 mitotic spindle organization a transcriptional regulation during cell proliferation RNA pol II transcriptional mediator 100% cat. 1 germline stem cell maintenance P{EPgy2} stocks numbers mentioned are according to the Bloomington Drosophila Stock numbers. b Numbers of flies scored. c BARTL phenotypes are categorized according to that depicted in Figure 2B. d Functional annotations are adapted from the information in FlyBase summary of individual genes. 43 Table 3. Control results for EPgy2 lines on BS or wildtype eyes. Eye phenotypes for genotypes testedb P{EPgy2} stocksa y w/H1; eyGal4-4.8 y w/Y; y w/H1; eGUF4.8JD1/SM1, {eyFLP.N}5/SM1, Cy Cy 100% cat. 5 1% BS, 1% cat. 2, 47% cat. 3, 45% cat. 4, 6% cat. 5 100% cat. 5 5% BS, 24% cat. 2, 71% cat. 3 15650 100% BS 100% BS 16945 100% BS 100% BS 14821 100% BS 100% BS 100% cat. 5 5% BS, 24% cat. 2, 71% cat. 3 17674 100% BS 100% BS 100% cat. 5 22% cat. 4, 78% cat. 5 15778 100% BS 98% BS, 2% cat. 5 100% cat. 5 4% BS, 17% cat. 2, 50% cat. 3, 29% cat. 4 16617 98% BS, 2% 90% BS, cat. 5 10% cat. 2 100% cat. 5 63% cat. 3, 37% cat. 5 21192 a y w /H1 - 100% BS - - P{EPgy2} stocks numbers mentioned are according to the Bloomington Drosophila Stock numbers. b Eye phenotypes are categorized within the range BARTL eye phenotype, depicted in Figure 2B. 44 Table 4. Effect of candidate gene knockdowns or amorphic alleles on BARTL phenotype. Candidate genes in EP stocks corp CG1632 Pdcd4 CG8924 MED18 CG2701 fs(1)Yb CG14814 CrebB-17A mthl1 SmG a RNAi linesa Nb v102751 v16130 v106107 v5478 v16160 v16162 BL 38445 v48041 v48042 BL 35705 v48490 v48491 v28265 v28264 v106760 v106635 v25433 BL 35181 BL 35301 v41553 v6103 v33136 BL 15318 BL 26617 32 48 184 42 49 114 38 96 98 32 126 18 28 24 30 192 162 52 38 8 38 46 116 60 B S 0 0 4 5 0 4 13 4 7 0 0 0 7 0 10 11 0 15 5 0 0 4 2 50 BARTL eye phenotype (%)c 1 2 3 4 5 100 88 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 0 0 0 0 0 0 0 0 0 0 0 0 0 11 1 39 0 0 0 0 1 25 24 0 0 0 6 0 0 12 23 24 0 23 42 28 21 25 18 0 29 0 13 20 14 12 21 12 100 39 0 27 0 0 73 71 100 73 42 68 72 53 29 0 25 100 77 12 62 29 39 38 0 57 33 23 0 0 0 0 0 0 3 0 0 11 52 61 39 0 0 57 23 19 11 0 0 0 59 0 RNAi lines are obtained from Bloomington Stock Center (BL) and Vienna Drosophila Resource Center (v). b Numbers of flies scored. c The range of BARTL phenotype is categorized according to that depicted in Figure 2B. 45 References Ahmad, K.K., and Golic, K.G.K. (1999). Telomere loss in somatic cells of Drosophila causes cell cycle arrest and apoptosis. Genetics 151, 1041-1051. Al-Mulla, F.F., Keith, W.N.W., Pickford, I.R.I., Going, J.J.J., and Birnie, G.D.G. (1999). Comparative genomic hybridization analysis of primary colorectal carcinomas and their synchronous metastases. Genes Chromosomes Cancer 24, 306-314. Artandi, S.E., and DePinho, R.A. (2010). Telomeres and telomerase in cancer. Carcinogenesis. Biessmann, H., and Mason, J.M. (2003). Telomerase-independent mechanisms of telomere elongation. 60, 2325-2333. Blackburn, E.H. (2001). Switching and Signaling at the Telomere. Cell 106, 661- 673. Brand, A.H., and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401- 415. Cenci, G., Ciapponi, L., and Gatti, M. (2005). The mechanism of telomere protection: a comparison between Drosophila and humans. Chromosoma 114, 135-145. Fristrom, D. (1969). Cellular degeneration in the production of some mutant phenotypes in Drosophila melanogaster. Mol. Gen. Genet. 103, 363-379. Golic, K.G., and Lindquist, S. (1989). The FLP recombinase of yeast catalyzes site-specific recombination in the Drosophila genome. Cell 59, 499-509. Hackett, J.A., and Greider, C.W. (2003). End resection initiates genomic instability in the absence of telomerase. Molecular and Cellular Biology 23, 8450-8461. Kurzhals, R.L., Titen, S.W.A., Xie, H.B., and Golic, K.G. (2011). Chk2 and p53 are haploinsufficient with dependent and independent functions to eliminate cells after telomere loss. PLoS Genet 7, e1002103-e1002103. McClintock, B. (1939). The Behavior in Successive Nuclear Divisions of a Chromosome Broken at Meiosis. pp. 405-416. Michinomae, M., and Kaji, S. (1973). Cell death during the development of the bar eye discs in Drosophila melanogaster. Jap J Genet 48, 307-310. Muller, H.J. (1940). An analysis of the process of structural change in 46 chromosomes of Drosophila. Journ. of Genetics 40, 1-66. Murnane, J.P. (2010). Telomere loss as a mechanism for chromosome instability in human cancer. Cancer Res. 70, 4255-4259. Ong, T.M.T., Song, B.B., Qian, H.W.H., Wu, Z.L.Z., and Whong, W.Z.W. (1998). Detection of genomic instability in lung cancer tissues by random amplified polymorphic DNA analysis. Carcinogenesis 19, 233-235. Rørth, P.P. (1996). A modular misexpression screen in Drosophila detecting tissue-specific phenotypes. Proc. Natl. Acad. Sci. U.S.a. 93, 12418-12422. Sabatier, L., Ricoul, M., Pottier, G., and Murnane, J.P. (2005). The Loss of a Single Telomere Can Result in Instability of Multiple Chromosomes in a Human Tumor Cell Line. Molecular Cancer Research. Sandell, L. (1993). Loss of a yeast telomere: Arrest, recovery, and chromosome loss. Cell 75, 729-739. Schneider, B.L., and Kulesz-Martin, M. (2004). Destructive cycles: the role of genomic instability and adaptation in carcinogenesis. Carcinogenesis 25, 2033- 2044. Titen, S.W.A., and Golic, K.G. (2008). Telomere Loss Provokes Multiple Pathways to Apoptosis and Produces Genomic Instability in Drosophila melanogaster. Genetics 180, 1821-1832. CHAPTER 3 IDENTIFICATION OF CORP AS A FUNCTIONAL ANALOG OF MDM2: NEGATIVE REGULATION OF P53 IN DRSOPHILA MELANOGASTER 48 Abstract We identified the corp gene of Drosophila melanogaster as a negative regulator of P53. Its overexpression promotes survival of cells with DNA damage in the soma but eliminates such cells in the germline, similar to the effects of a p53 null mutation in these tissues. Corp is also a transcriptional target of P53, thus constituting a negative feedback loop. We find that Corp shares conserved protein motifs with Mdm2, the major negative regulator of P53 in vertebrates, and physically interacts with Drosophila P53. Our findings show that Drosophila Corp is a functional analog of vertebrate Mdm2. Introduction Cells frequently encounter damage to their DNA as the result of intrinsic insults, such as replication stress, oxidative stress, and telomere shortening, or from exposure to environmental stressors such as mutagenic chemicals or radiation. In response to DNA double-strand breaks (DSBs), DNA damage response (DDR) pathways are triggered. The ensuing signaling cascades result in cell cycle arrest, induction of DNA repair genes, and in some cases, apoptosis. It is generally thought that if damage cannot be repaired, cells will undergo apoptosis rather than continue to divide and propagate a damaged genome. If cells with irreparable damage do survive and proliferate, it can result in widespread genomic instability, creating an early state in the progress towards cancer 1-3. In Drosophila melanogaster, most cells undergo apoptosis in response to irreparable DNA damage, but a few cells escape, continue to divide and 49 exhibit genomic instability 4-6. In our current study, we aimed to investigate the genetic mechanisms that allow cells to survive in the presence of irreparably damaged DNA. One of the key players that controls the fate of a cell following DNA damage is the tumor-suppressor encoded by the p53 gene, which has been found to be mutated in most forms of human cancers 7. In response to DNA damage, the ATM kinase (encoded by tefu in Drosophila) phosphorylates Chk2 (encoded by lok), which in turn phosphorylates and activates P53 8-10. ATM may also phosphorylate P53 directly 11-14. Activated P53 is primarily a transcriptional regulator that promotes or inhibits the expression of a large number of target genes 15-21. These genes encode a variety of cellular functions such as DNA repair, cell cycle arrest, and apoptosis. A cell that detects damage and engages the P53 damage response pathway may either repair the damage or experience senescence or death 22. Humans that lack one copy of p53 are prone to develop cancers, and p53 knockout mice develop cancers at an increased rate 1-3,23,24. Similarly, p53-null Drosophila fail to eliminate cells with a DSB in their genome 5,24,25-27 . The Mdm2 gene is a prominent target of P53 in mammals. It encodes a ubiquitin ligase that negatively regulates P53 and promotes its degradation, constituting a negative feedback loop 28,29. Mediation of apoptosis by P53 is highly conserved throughout metazoa, including Drosophila melanogaster 21,22,2527,30 . However, apart from DNA repair genes, targets of p53 that antagonize 50 apoptosis have yet to be reported in flies and no homolog of Mdm2 has been identified. Here, we report the identification of a gene, companion of reaper (corp), whose overexpression mimics the effects of p53 mutants in the soma and the germline. Our experiments indicate that Corp is a negative regulator of P53. Furthermore, corp has been previously identified as a positively-regulated transcriptional target of P53 18,19,31. We also identified protein motif similarity between Corp and Mdm2, and found that Corp physically interacts with Drosophila P53. Although BLAST searches have failed to identify an Mdm2 homolog in Drosophila, our results indicate that corp encodes a functional equivalent. These findings further strengthen the functional conservation of the P53 pathways between Drosophila and mammals. Results Corp suppresses tissue ablation resulting from DNA damage. The previously described BARTL (Bar and Telomere Loss) assay 24 was used to screen for insertions of a P-element misexpression element 32 that modify the eye phenotype resulting from the production of an irreparable DNA DSB. In brief, a combination of eyeless-Gal4 (eyGal4) and UAS-FLP is used to drive FLP recombinase expression in proliferating cells of the eye throughout development 33-35 . These flies also carry a Y chromosome with inverted FRT repeats (DcY(H1), or simply H1). Recombination between FRTs in inverted orientation on sister chromatids produces dicentric chromosomes which break in the subsequent 51 mitotic division, delivering a chromosome with a single broken end to each of the two daughter cells (Figure 3). This results in substantial P53-mediated apoptosis and produces flies with characteristic small and rough eyes (Figure 8B). By introducing an EP transposon insertion, which carries UAS elements that can drive expression of a neighboring gene, the flies' eyes may become larger or smaller, indicating that the EP element in question modifies the fate of cells in these eyes. We identified one such EP insertion (P{EPgy2}CG1632EY03495) that produced nearly wildtype eyes in the BARTL assay (Figure 8C). This insertion was ideally placed to drive expression of the corp+ gene (CG10965). By qRTPCR we confirmed that when Gal4 induces the P{EPgy2}CG1632EY03495 element (hereafter referred to as EP-corp+), it drives overexpression of corp+ (Figure 9). We also constructed a UAS-corp+ transgene, and found that its effect was nearly identical to that produced by EP-corp+ (Figure 8D). When we tested RNAi-mediated knockdown of corp in the BARTL assay, the opposite result was obtained: the eye was completely ablated (Figure 8E; n. b., ey expression extends beyond the eye proper, accounting for, in some cases, nearly complete ablation of the head). A corp mutant was also generated by imprecise excision of a P element located in the 5' region of the gene. This mutant, corp95B (Figure 10), is viable in homozygous condition and without obvious phenotype on its own. However, like RNAi-mediated corp knockdown, corp95B completely ablates the eye in the BARTL assay (Figure 8F). This effect can be rescued by the UAS-corp+ transgene (Figure 8G). If EP-corp+ was not induced by Gal4, and eyFLP was instead used to 52 produce dicentric chromosomes in the eye, we found that the EP-corp+ insertion, by itself, had no effect (Figure 11B). This further confirms that corp+ overexpression is necessary to generate the large eye phenotype in the BARTL assay. To determine whether corp has any influence in the absence of DNA, damage we examined wildtype or BS flies carrying EP-corp+, induced or uninduced, and flies carrying the corp95B mutant, but without the induction of dicentric chromosomes. There was no change in eye phenotype in any of these cases, indicating that the effects of altered corp+ expression are seen only after DNA damage (Figure 11C-G). EP-corp+-mediated rescue of the eye is not confined to males, or to effects produced by the Y chromosome. We generated XXY females carrying eyGal4, UAS-FLP and the DcY(H1) chromosome and found that EP-corp+ produced almost wildtype eyes, similar to its effect in males (Figure 11H-I). Additionally, we found that corp+ overexpression ameliorated the reduction in eye size produced by dicentric induction on chromosome 3 (Figure 11J-K). Therefore, the effect of corp+ overexpression is independent of the sex of the fly or the particular chromosome experiencing damage. Extant corp polymorphisms are functionally indistinguishable. We sequenced the corp genomic regions from five laboratory strains and found two allelic variants of corp that differed by 7 nucleotide changes. Four nucleotide changes were found in the second exon: two of them are silent mutations (C840T and C891T) and two (T725A and T873G) encode different amino acids (L96H 53 and L145M). These alternate amino acids are also present as polymorphisms in wildtype isolates of D. melanogaster and other Drosophila species (http://www.dpgp.org). There were also three single nucleotide differences (C277T, A398C, and A407T) in introns. The UAS-corp+ transgene that we constructed and tested (as mentioned previously) carries the canonical version, as found in CantonS. The EP-corp+, y w, and w1118 strains all carry the variant allele that differs from the reference CantonS strain. Because the overexpression of either allele produces a similar large eye phenotype in the BARTL assay (Figure 2D), we conclude that both alleles function similarly, and that the two amino acid differences have, at most, minor effects. corp+ overexpression inhibits DNA damage-induced apoptosis in the soma. Overexpression of corp+ might produce larger eyes in the BARTL assay by blocking the apoptotic response, thereby allowing survival and proliferation of cells that would normally die. To test this, we examined wing imaginal discs for apoptotic cells in wildtype and EP-corp+ larvae following exposure to ionizing radiation (IR). We induced corp+ overexpression in the posterior compartment of wing discs using an engrailed-Gal4 driver 36 and marked this compartment by coinduction of UAS-GFP. Apoptosis was significantly reduced by corp+ overexpression (Figure 12A, C). We then found that IR-induced apoptosis was significantly enhanced in wing discs from corp95B mutants relative to wildtype (Figure 12B, D). The results show that corp+ is a potent negative regulator of apoptosis. 54 Overexpression of corp+ restricts the transmission of healed chromosomes through the germline. In the male germline, broken dicentric chromosomes may be healed by de novo telomere addition 37,38. With DcY(H1), these healed chromosomes (denoted FrY) may be detected in testcrosses to y w females by the loss of the dominant BS marker that lies distal to the inverted FRTs (i.e., by the generation of Bar+ sons). To assess the effect of corp on the transmission of broken-and-healed chromosomes, we induced expression of FLP by heat shock (70FLP10) during the first 24 hours of development and used nanosGal4 to drive germ cell-specific overexpression of corp+. Overexpression of corp+ blocked transmission of FrY chromosomes (Table 5). We also drove corp+ and FLP expression specifically in the germline using nanosGal4 (EP-corp+; UAS-FLP nanosGal4) and again observed a large decrease in FrY transmission relative to males with unaltered corp expression (Table 5), confirming that corp+ inhibits transmission of broken-and-healed chromosomes through the male germline. The relationship between corp and p53. Though it seems surprising that corp+ overexpression produces dissimilar phenotypes in the soma (survival and proliferation of cells with broken chromosomes) vs. the germline (elimination of cells with broken chromosomes), there is precedent: the p535A-1-4 loss of function mutation acts similarly. The p535A-1-4 homozygotes have almost wildtype eyes in the BARTL assay 24, but strongly reduced transmission of broken-andhealed chromosomes through the male germline 39. This similarity suggests a functional relationship between corp and p53. 55 To explore this relationship, we generated corp95B; p535A-1-4 double mutants and examined them using the BARTL assay. We found that p53 is epistatic to corp, with the double mutant producing almost wildtype eyes (Figure 13A). In a complementary experiment, we tested the effect of simultaneously overexpressing corp+ and p53+. When GMR-Gal4 drives p53+ overexpression in the developing eye, the adults that eclose have very small eyes, owing to an elevated frequency of cell death. We found that if corp+ was simultaneously overexpressed, the eyes became significantly larger. Furthermore, when we combined the corp95B mutant with GMR>p53+, the eyes were much smaller than produced by GMR>p53+ alone (Figure 13B). The mutant and overexpression results may both be accommodated under the hypothesis that Corp antagonizes P53, either by suppressing its apoptotic effects or by negatively regulating P53 itself. P53 level is elevated in corp mutant or knockdown cells. To determine how Corp might affect P53, we examined P53 levels in eye discs by immunostaining. The GMR promoter was used to overexpress p53+ behind the morphogenetic furrow, providing an easily detected level of expression. The corp95B mutant eye discs exhibited a significantly higher level of P53 while EPcorp+ overexpression driven by GMR-Gal4 reduced the level of P53 (Figure 14A, B). To verify these results, we knocked down corp in S2 cells by treating with double-stranded RNA (dsRNA) against corp and measured P53 protein levels by Western blot. We found that the quantity of P53 was significantly elevated following corp knockdown (Figure 14C, D). Thus, we conclude that Corp is a 56 negative regulator of p53. Since it has been previously shown that corp is a transcriptional target of P53, our data indicate that Corp acts in a negative feedback loop on p53+. We used qRTPCR to measure p53 transcript levels in corp mutant flies, or flies with corp+ overexpression, to determine whether corp regulates the level of p53 mRNA. We find that there are no significant or consistent changes in p53 mRNA levels between these genotypes (Figure 15). We conclude that Corp regulation of P53 occurs primarily at the level of translation or protein stability. Overexpression of corp+ suppresses Hid- and Reaper- mediated cell death. P53 is well known as a positive regulator of the hid and reaper proapoptotic genes. Recently it was shown that these genes act recursively to increase p53 expression and contribute to the apoptotic program 40. Given that Corp overexpression results in downregulation of P53, we expect that it should also suppress the apoptotic phenotype caused by hid and reaper overexpression by attenuating this feedback loop. In order to test this prediction, we overexpressed hid or reaper in the eye under control of the GMR-Gal4 driver. This produced adults with small eyes owing to cell death in the eye discs. When corp+ was overexpressed at the same time, the eyes became significantly larger, confirming that Corp interferes with the hid- and reaper-mediated apoptotic programs (Figure 13C). Corp shares protein motif similarity with the P53-interacting regions of Mdm2. Mdm2 is the major negative regulator of P53 in vertebrates. However, no homolog of Mdm2 has been found in Drosophila. Given that Corp acts in a 57 negative feedback loop on P53, we looked more closely at Corp to see whether any similarities to Mdm2 might be identified. We used the domain analysis tool MEME 41,42 to search for shared motifs. When the software was presented with four Mdm2 orthologs (H. sapiens, M. musculus, G. gallus, and D. rerio) and Corp from two Drosophila species (D. melanogaster and D. virilis) and was instructed that each protein sequence may or may not contain similar motifs, it identified seven similar motifs, with motifs 4 and 5 shared by Mdm2 and Corp (Figure 16A). Interestingly, motif 4 appears to correspond to the N-terminal region of Mdm2 that interacts with the transactivation domain of P53 and motif 5 appears to correspond to the central P53-binding site on Mdm2 44,45. Corp physically interacts with P53. Motivated by the finding of similarities between Corp and Mdm2 in regions of Mdm2 that bind P53, we asked whether Drosophila Corp and P53 physically interacted in cells. To probe whether Corp can directly interact with Drosophila P53 (DmP53), we purified GST-DmP53 using a bacterial expression system. C-terminal-tagged CorpGFPFlag was then expressed via transient transfection of HeLa or 293 cells. Cell lysates extracted from these cells were incubated with either GST or GSTDmP53. Corp-GFPFlag was pulled-down specifically by GST-DmP53 but not by GST (Figure 17A), indicating that Corp expressed in mammalian cells interacts with DmP53. This result suggests either that Corp can interact directly with DmP53, or that the complex required for their interaction is conserved in mammalian cells. To further probe this, we tested the interaction between GSTDmP53 and in vitro synthesized Corp. We found that, similar to what we 58 observed with cellular lysates, GST-DmP53 strongly interacts with in vitro synthesized Corp (Figure 17B). Together, these results strongly suggest that Corp can interact directly with DmP53. Discussion Several studies have identified transcriptional targets of P53 in Drosophila. Some of these play important roles in DNA damage repair or in triggering apoptosis 18-21,46,47. However, the functions of most P53 target genes have yet to be determined. Our discovery that corp+ antagonizes apoptosis by negatively regulating P53 is the first demonstration in Drosophila that a P53-regulated gene (apart from DNA repair genes) is not solely devoted to apoptosis, and shows that P53 target genes act in competing pathways: the hid- and reaper-mediated proapoptotic pathway, and the corp-mediated anti-apoptotic pathway (Figure 16B). By increasing or decreasing the expression of corp+, the balance is shifted in favor of survival or death, respectively. In vertebrates, the major negative regulator of P53 is Mdm2. It binds to P53 and ubiquitinates it, leading to its degradation, and is responsible for restraining P53 activity in unstressed cells. Furthermore, Mdm2 is also a transcriptional target of P53, and is utilized to turn down the P53 response so that cells that have recovered from the initiating stress, for instance DNA damage, may survive. Though no strict Mdm2 homolog is known in Drosophila, our experiments indicate that Corp provides that function. Similar to Mdm2, the corp gene is a transcriptional target of P53, Corp antagonizes the P53-mediated 59 apoptotic program, P53 levels are inversely correlated with corp+ expression, and Corp physically interacts with P53. Additionally, Corp shares protein motifs with vertebrate Mdm2 and these correspond to regions of Mdm2 that physically interact with P53. These similarities lead us to propose that Corp is the functional analog of mammalian Mdm2. There are, nonetheless, significant differences between Corp and Mdm2. Mdm2 is an E3 ubiquitin ligase containing a RING domain 48. Corp shows no evidence of such a domain. But, recent work 49 established that subunits of the proteasome are the predominant physical interactors of Corp (Figure 18). We suggest that Corp, like Mdm2, promotes degradation of P53. In contrast to Mdm2, Corp may achieve this by recruiting P53 to the proteasome, rather than by ubiquitination. In the mouse, many Mdm2 mutations cause recessive lethality, though they can be rescued by the additional mutation of p53 50, indicating that lethality results from unrestrained P53 activity. In contrast, the corp95B null mutation is not lethal and exhibits no obvious phenotype in the unstressed condition. Corp appears to function only when DNA damage is detected. The normal level of P53 expression is insufficient to cause lethality in the absence of Corp, unless P53 is activated by upstream kinases. However, these differences between Corp and Mdm2 may not be as significant as they appear. First, recent findings in mice indicate that the constitutive and induced levels of Mdm2 can be functionally separated. When the P53 Response Element was mutated in the promoter of Mdm2, so that Mdm2 60 was still expressed at a basal level but could no longer be induced to high levels by P53, the resulting mice were viable 51. Furthermore, when the RING domain of Mdm2 was mutated, so that it no longer functioned as a ubiquitin ligase, but could still interact with its partner Mdmx, the mice were also viable 52. In both cases, the mice were still highly sensitive to induced DNA damage, indicating that higher levels of Mdm2 activity are required to recover from DNA damage. Moreover, the latter experiments show that Mdm2 is capable of repressing P53 function without its ubiquitin ligase activity 52. This may indicate that P53-Mdm2 binding is a more ancient mode of regulation, with the ubiquitin ligase activity acquired as a later adaptation in vertebrates. There is still room for alternative or additional explanations for Corp's phenotypes. If Corp targeted downstream components of the apoptotic pathway for degradation, it might also lead to the phenotypes we observed. Given the existence of a positive feedback loop between downstream pro-apoptotic genes and p53 40, Corp might indirectly affect P53 levels by promoting degradation of components of the pro-apoptotic pathway. However, detection of a physical interaction between Corp and P53 strongly suggests that Corp directly regulates P53, regardless of whether it may also regulate downstream apoptotic components. Corp is the first reported negative regulator of P53 in Drosophila that is also a transcriptional target of P53. Although Bonus and Rad6 have been identified as negative regulators of P53 in Drosophila 53,54, neither of them are transcriptional targets of P53, and are thus less similar to Mdm2 than is Corp. 61 Recent experimental findings from others 19,30,40,55, and as reported here, indicate that regulation of P53 is complex, involving activation by upstream factors, with both positive and negative feedback loops affecting its activity. Further investigation of how these pathways are regulated and how they affect these outcomes should greatly improve our understanding of the many functions of P53. It remains to be understood what benefit might be provided by Corp. If it is normally beneficial to eliminate a cell with unrepaired DNA damage, preventing its proliferation, then what purpose could be served by saving such cells from death? Previous experiments have shown that in wildtype larvae, many cells with damaged genomes are not eliminated by apoptosis immediately, but rather over a period of a few days 5. Since corp mutants show increased cell death after irradiation, Corp is clearly one factor that restrains the immediate death of cells with damaged genomes. We have often thought it surprising that flies can survive when dicentric chromosomes are formed, and break, in >90% of their cells during development 5,6. Perhaps if all cells with broken chromosomes immediately succumbed to apoptosis, such flies would not survive. In fact, corp mutants survive very poorly after widespread induction of Y chromosome dicentrics. Corp, then, may be advantageous to modulate the rate at which cells are eliminated following DNA damage. If >90% of cells in a developing imaginal disc were eliminated at the same time, it is easy to imagine that the few remaining survivors, adrift in a sea of dead cells, might not be capable of regenerating a complete disc. If, instead, the cells with damaged genomes could be eliminated gradually, it might give the surviving cells a suitable matrix to regenerate an entire disc. This 62 could be the vital function fulfilled by Corp. Bilak et al., (2014) 56 recently showed that dying cells signal their neighbors to become resistant to damage-induced death. We would not be surprised to find that this pathway acts through Corp. Material and methods Drosophila stocks. All flies were maintained at 25°C on standard cornmeal food. Construction of the DcY(H1) and Dc3(FrTr61A5)1A chromosomes have been described previously by Kurzhals et al. (2011) 24 and p535-A-1-4 by Xie et al. (2004) 57. We obtained the following stocks from the Bloomington, IN (USA) Drosophila Stock Center: P{UAS-FLP1.D}JD1 (BL 4539), P{Gal4-ey.H}4-8 (BL 5535), P{EPgy2}CG1632EY03495 (BL 15650), P{eyFLP.N}5 (BL5576), M{3xP3-RFP.attP}ZH-86Fb; M{vas-int.B}ZH-102D (BL 23648), P{UAS2xeGFP}AH2 (BL 6874), nanos-Gal4 58, P{GMR-p53.Ex}3/TM3, Sb, Ser (BL 8417), GMR-Gal4 59, P{GMR-hid}G1/CyO (BL 5771), P{GMR-rpr.H}S/TM6B, Tb (BL 5773), and P{Act5C-Gal4}17F01/TM6B, Tb (BL 3954). Two corp-RNAi stocks were obtained from VDRC: v102751 and v16130. The following stocks were obtained from Golic lab collections: heat-shock inducible FLP, P{70FLP}10, P{UAS-GFP} P{Act-Gal4}/CyO, and y w; Sp/CyO; nanosGal4 UAS-FLP(95%). The engrailed-Gal4 stock was kindly gifted by Mark Metzstein. Plasmids and transgenic constructions. The coding region of corp from CantonS flies was amplified by PCR with 5' NotI and 3' XbaI overhangs (primers used: Fwd-5'CATATTCGCGGCCGCATGGCCGATATCAGGAGCAG3' and Rev- 5'CCGCGGGTCTAGACTAGATGCGAATCGAGCGCA3') and cloned 63 into the pUAST-w+-attB transgenic fly vector 60. Vector plasmid was injected in embryos carrying attP docking sites on chromosome 3 and vasa-ΦC31 integrase on chromosome 4 (BL 23648). w+ flies were selected for establishing stable transgenic stocks. The corp95B deletion mutation was generated via imprecise excision of the EY03495 P-element insertion (Baylor College of Medicine Genome Disruption Project). The DNA break points were identified by PCR amplification (primer sets used: Fwd 1: 5'CCAAGCGAACGCATCGCTG3', Fwd 2: 5'GAAGAGGTCATCTCCCAAGG3', Rev1: 5'CTTAGGAACAATGGTTCAACC3', and Rev2: 5'GCAGCCGAGGTATGGAAATC3' and sequencing of genomic DNA obtained from the homozygous mutant. DNA sequencing. Sequencing of corp+ from the genomic region in five different genotypes, y w, w1118, EP-corp+, CantonS, and v; Sco/Cy; ry, was carried out by the Core Facilities, University of Utah. Eye photographs. Eye photographs were taken using a Nikon D200 digital camera and processed in Adobe Photoshop. Quantitative reverse transcriptase PCR. Total RNA was extracted from 12-15 adults or third instar larvae using Trizol Reagent (Sigma Aldrich, MO), treated with DNaseI (Fermentas, PA), and cDNA was synthesized using RevertAidTM First Strand cDNA synthesis kit (Thermo Scientific, PA) according to manufacturer's protocol. 1µl of cDNA was used per reaction in triplicates for performing qRT-PCR experiment using MaximaTM SYBR green/Fluorescein qPCR Master Mix (Fermentas, PA) or PerfeCTa SYBR Green FastMix (Quanta 64 Biosciences, MD) in an iQ-PCR machine (Bio-Rad, CA). Relative quantification of mRNA levels was calculated using the standard curve method. Relative copy numbers of each gene of interest (X) was calculated by normalizing cDNA levels of X over cDNA levels of Ribosomal Protein L32. Primers that were used are: Fwd-corp: 5' GCAGCCGAGGTATGGAAATC 3'; Rev-corp: 5'AAGCCGAGGGTCAGAAGG 3'; Fwd-p53: 5' GCCGCCTCCTTAATCATGCC 3'; Rev-p53: 5' GCCGAGACTGCGACGACTC 3'; Fwd-rpl: 5' CCGCTTCAAGGGACAGTATC3'; Fwd-rpl: 5' ATCTCGCCGCAGTAAACG 3'. Irradiation. 15-18 wandering third instar larvae were collected in clean 10 mm petri plates and irradiated at 4000 rads in a TORREX120D X-ray generator (Astrophysics Research Corp, CA), set at 110kV and 5mA. These larvae were returned to fresh food and incubated at 25°C until further experimental treatments. Eye size measurement. For determining eye sizes, the left eye of each fly was measured along the anterio-posterior axis (A) and the dorso-ventral axis (B), using a digital filar micrometer (Lasico, CA). Then these two measurements were used to calculate the area of an ellipse (i.e., Π x A/2 x B/2), as the area of the eye. Then this area was normalized over mean of the area of wildtype (w1118 or y w) eyes and was represented as a fraction of wildtype eye size. Germline fragment chromosome transmission assay. Flies were allowed to lay eggs and transferred to fresh vials every day. Embryos were collected for 24 hrs, heat-shocked at 38°C for 1 hour in a circulating water bath 65 and then immediately returned to 25°C. After eclosion, the males were collected and singly mated to 2-3 y w females and their progeny were scored. Alternatively, nosGal4 was used to drive UASFLP in the male germline. Imaginal disc staining procedures and fluorescence microscopy. Wing and eye imaginal discs were dissected from third instar larvae and stained with TUNEL, acridine orange, or P53 antibody. TUNEL staining: TUNEL staining was performed using Apoptag Red In Situ Apoptosis Detection Kit (#S7165, Chemicon International). Briefly, dissected imaginal discs were fixed in 4% paraformaldehyde, rinsed twice in PBTW (0.3% Tween-20 in 1X PBS) for 5 minutes/rinse, post-fixed in 2:1 EtOH/1X PBS, rinsed again as before, and then incubated with equilibration buffer, TdT enzyme, and anti-digoxigenin Rhodamine congujate antibody in subsequent steps, according to manufacturer's protocol. Finally, the discs were mounted in Vectashield (Vector Laboratories Inc., CA) and photographed. All images were at taken at 500 ms shutter speed and at neutral density 3. The minimum and maximum intensity ranges for TUNEL staining were set at 200 and 2000, respectively, for all captured images. TUNEL fluorescence intensity was measured individually in the posterior and anterior compartments of each disc, normalized to the area of that compartment and expressed as integrated density of fluorescence intensity/area (InDen/area) in posterior compartment to that in the anterior compartment. Acridine orange staining: Acridine orange staining was performed on freshly dissected imaginal discs. The discs were then incubated in a 1.6 x 10-6 M 66 solution of acridine orange (1.6 µl of 1mM solution of AO in 1 ml. Ringer's solution) for 5 minutes, then mounted in Ringer's solution and photographed immediately. All images were taken at 100 ms shutter speed and at neutral density 4. Minimum and maximum intensity range: 200-600. AO intensity is expressed as InD/area of the whole disc. P53 immunostaining: Third instar larvae were dissected in 1X PBS and fixed in 4% paraformaldehyde for 15 minutes at room temperature. They were washed in PBTX (0.3% Triton-X in 1X PBS) twice for 30 minutes each, followed by 1 hour blocking in 5% BSA in PBTX. Next, they were incubated overnight at 4°C in primary antibody, p53-7A4 (DSHB, University of Iowa, IA) at 1:10 concentration in 5% BSA. The discs were then rinsed twice with PBTX, 30 minutes each and once in blocking buffer for 1 hour and finally incubated with Alexa Fluor® 568 goat anti-mouse secondary antibody (Invitrogen, OR) at 1: 1000 concentration for 2 hours. Finally, they were washed twice with PBTX as before and mounted in Vectashield (Vector Laboratories Inc., CA). All images were taken at 100 ms shutter speed and at neutral density 3. Minimum and maximum intensity range: 200-550. P53 staining intensity is expressed as InD/area where the area of only the region behind the morphogenetic furrow is considered. All fluorescent images were z stacks taken using an inverted Olympus IX2-DSU spinning disc confocal microscope, a Hamamatsu Orca-ER digital camera, and SLIDEBOOK software (Intelligent Imaging Innovations, CA). 67 dsRNA synthesis. To synthesize double-stranded RNA for RNA interference experiments with cultured cells, PCR products not more than 700 base pairs were made of the cDNA of interest flanked by T7 RNA polymerase sites at both ends. After gel purification of the PCR product, it was used as template for in vitro transcription for 6 hours at 37°C in a circulating water bath in 5-6 replicates of 20 µl reaction each for better yield using Ambion Megascript® T7 Transcription Kit (Life Technologies), according to manufacturer's protocol. Then, the reactions were pooled together in a microcentrifuge tube and extracted with phenol-chloroform and chloroform. Finally, dsRNA was precipitated with ispropanol, dissolved in DEPC-treated H2O, and quantified in a Nanodrop 1000 spectrophotometer (Thermo Scientific). Primers used for obtaining PCR products were: Fwd_T7corp: 5'TTAATACGACTCACTATAGGGAGAATGGCCGATATCAGGAGCAG3'; Rev_T7corp: 5'TTAATACGACTCACTATAGGGAGACTAGATGCGAATCGAGCGCA3'; Fwd_T7p53: 5'TTAATACGACTCACTATAGGGAGAAGATCCAGGCGAACACGCTG3'; Rev_T7p53: 5'TTAATACGACTCACTATAGGGAGAGGCTTCCGGCACGGACTTG3'; Fwd_T7Pav: 5'TTAATACGACTCACTATAGGGAGAACAACTGCTCTTGGCAGATACC3'; Rev_T7Pav: 5'TTAATACGACTCACTATAGGGAGAAAATCCGTAACGAAACTAACCG3'. 68 Detection of P53 levels in S2 cells. Cell culture and dsRNA treatment. S2 cells were cultured at 25°C in Schneider's Drosophila Medium (Invitrogen) with 10% heat inactivated fetal bovine serum (HyClone) and 1X Antibiotic-Antimycotic (Invitrogen). Cells were passaged into fresh medium every 3-4 days and were discarded after passage 25 (P25). The dsRNA treatment protocol was performed as described 61. Cells were passaged on day 0 at the rate of 2 x 106 cells/ml. On day 1, they were washed and seeded in 24-well plates at 800 µl/well. 15 µg of dsRNA was added to each well. The plates were then returned to the 25°C incubator. On day 4-5, cells were re-seeded in 6-well plates at 2 ml/well and retreated with 30 µg of dsRNA. As a control of dsRNA uptake rate, cells were treated with Pavarotti dsRNA, which makes them large and multinucleate 62,63. On day 6-7, cells were collected, lysed, and processed for Western blot. S2 cells, with or without dsRNA treatment, were irradiated at 4000 rads to observe any elevation/change in P53 levels from unirradiated cells, with or without dsRNA treatment. No significant changes in P53 levels were observed following irradiation, so treated cells were grouped and categorized as (I) no dsRNA control group and (II) + dsRNA experimental group for quantification. Western blotting. Cells were collected and lysed in RIPA buffer containing protease inhibitor (Thermo Scientific, IL) to a final concentration of 1X. Protein concentration was measured by BCA assay (Thermo Scientific, IL) and cell lysates were mixed with sample buffer and β-mercaptoethanol to a final 69 concentration of 1X before loading onto a 10% SDS gel at equal concentrations. Western blotting was carried out following standard procedure. Antibodies used: mouse monoclonal anti-Drosophila P53 (# sc-74573, Santa Cruz Biotechnology; as used by Chen et al.54) at 1:1000 concentration and mouse monoclonal antiDrosophila β-tubulin (E7, Developmental Studies Hybridoma Bank, University of Iowa, IA) at 1:10,000 concentration. After incubation with fluorescent goat antimouse secondary antibody (# 926-68020, Li-COR Biosciences) at 1:10,000, the membranes were scanned on an infrared Odyssey scanner (LI-COR Biosciences). The Western signals were quantified on the Li-COR scanner and the results from 6 independent experiments were averaged. Of these 6 experiments, 2 were following irradiation at 4000 rads and allowing 4 hours recovery before cell lysis. Relative P53 levels in each experiment were calculated by normalizing total P53 protein level to total β-tubulin level. Protein interaction assays. Purification of GST and GST-DmP53. The open reading frame of DmP53 was cloned into pGEX and transformed to BL21 DE3 cells. The expression was induced by addition of IPTG to a final concentration of 0.1mM in LB/Ampicillin media. Bacterial cells were harvested 4 hours following the induction and resuspended in ice-cold STE buffer (10mM Tris-HCl pH8.0, 150mM NaCl, 1mM EDTA, and protease inhibitors) with 1.5% Sarcosyl. Cells were then lysed with sonication and subsequently incubated with STE containing 1% Triton X-100 for 30 minutes. Insoluble proteins were removed by centrifugation at 16,000g for 5 minutes. Supernatant was then incubated 70 overnight with 50% slurry of glutathione-agarose beads at 4°C. The beads were pelleted by centrifuge at 100g and washed 4 more times with 10 ml of ice-cold PBTP (PBS with 0.1% Triton X-100 and protease inhibitors). Washed beads were then resuspended in PBTP with 0.01% sodium azide. Expression of Corp-GFPFlag in HeLa cells. 15ug of pRK5-corp-gfp-flag plasmid DNA was transfected to 2 million HeLa cells with calcium phosphate. Cells were lysed on plate with 1ml RIPA buffer at 48 hours following transfection. In vitro synthesis of Corp-HA6His. Corp-HA6His was cloned into pCDNA3. In vitro synthesis were carried out using the TnT® Coupled Reticulocyte Lysate Systems (Promega, Catalog number L4611) following manufacturer's instructions. GST pull-down assays. For in vitro synthesized protein, 1 ug GST or GST-DmP53 bound to Glutathione-agarose beads was incubated with 5 ul of synthesized protein in 500ul Binding buffer (50mM Tris-HCl, pH 8.0; 2mM EDTA; 150mM NaCl; 0.1% NP40; 20uM ZnCl2; 10mM MgCl2; protease inhibitors) containing BSA (0.2ug/ul). Following 1 hour incubation at RT and 1 hour incubation at 4oC, the beads were washed 4 times with Binding buffer. Beads were then pelleted at 100g, re-suspended and boiled in 30 ul sampling buffer, and resolved on SDS-PAGE gel. Following electrophoresis, the gel was fixed in (Isopropenol:dH2O:Acitic acid=25:65:10) for 30 minutes and incubated in the Amplify Fluorographic Reagent (GE Healthcare, NAMP100) for 1 hour. The gel was then vacuum dried and processed for autoradiography with an intensify screen at -80oC. 71 For cellular extract, 1 ug GST or GST-DmP53 bound to Glutathioneagarose beads was first incubated for 30 minutes in 500ul binding buffer with 0.2ug/ul BSA. 500 ul cell lysate was then added and incubated at 4oC for overnight. Following incubation, the beads were washed 4 times with 1 ml of RIPA buffer and pelleted by centrifugation at 100g for 5 minutes. Beads were then resuspended in 30ul sampling buffer and resolved on SDS-PAGE gel. Western analysis was performed with anti-Flag M2 antibody (Sigma, F1804). Co-immunoprecipitation. 10ug of pRK5-corp-gfp-flag plasmid DNA and 10ug of pEX-3B-hsp53-ha was transfected to 2 million HeLa cells with calcium phosphate. At 48 hours post transfection, cells were lysed with RIPA buffer, precleared with protein G-Sepharose beads, and then incubated with antiFlag(M2) mouse monoclonal antibody for overnight at 4oC. The immunocomplex was then precipitated with protein G- Sepharose beads, followed by SDS-PAGE and Western blot analysis. Graphical methods and statistical analyses. Construction of graphs and calculations of statistical significance were performed using Prism 5.0 (Graphpad). In box-and-whisker plots, the ends of whiskers represent 5th and 95th percentiles, top and bottom of the boxes represent 25th and 75th percentile, and the horizontal line in the box represents the median, i.e., 50th percentile. The Mann-Whitney test was used in all cases except for Figure 5D, where a paired ttest was used. Software. The MEME tool used for searching motif similarity is publicly available software (http://meme.nbcr.net/meme/). Images were quantitatively 72 analyzed using IMAGE J software from National Institutes of Health (http://imagej.nih.gov/ij/index.html) and images were processed using Adobe Photoshop. All line diagrams were composed using Adobe Illustrator. Acknowledgements A part of this work is done in the laboratory of our collaborator, Dr. Lei Zhou, Department of Molecular Genetics and Microbiology, College of Medicine, University of Florida. The corp95B mutant was constructed by Dr. Zhou's lab. The Corp-P53 interaction assays were performed by a postdoc, Dr. Ying Li at the Zhou lab. We thank Mark Metzstein for fly stocks, Colin Dale for qRT-PCR facilities, Markus Babst and Julie Hollien for Western blot and cell culture facilities, and Changwang Deng and Suming Huang of Zhou lab for technical assistance. Two of our antibodies were obtained from Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA. We thank Tin Tin Su and Andreas Bergmann for sharing unpublished results. R.C. was partially supported by University of Utah Graduate School Research Fellowship. The project was supported by NIH grant R01-GM065604 to K.G.G. and R01-GM106174 to L.Z. 73 Figure 8. Overexpression of corp+ suppresses the BARTL phenotype. (A) The range of eye phenotypes observed in the assay. The BS phenotype of H1 control males is shown at the left. When FLP is expressed (ey>FLP), the phenotypes can range from headless pharates (category 1) to adults with a fully developed wildtype eye (category 5). The distribution produced (B) in control males; (C) in males carrying P{EPgy2}EY03495, referred to as EP-corp+; (D) by inclusion of a UAS-corp+ transgene; (E) with RNAi-mediated knockdown of corp; (F) in corp95B mutants; and, (G) with rescue of the corp95B phenotype by expression from the UAS-corp+ transgene. N represents number of eyes scored for each genotype. Genotypes used are as follows: (B) y w/H1; eyGal4 UASFLP/+; (C) y w EP-corp+/H1; eyGal4 UAS-FLP/+; (D) y w/H1; eyGal4 UASFLP/+; UAS-corp+/+; (E) y w/H1; eyGal4 UAS-FLP/RNAi-corp; (F) y w corp95B/H1; eyGal4 UAS-FLP/+; (G) y w corp95B/H1; eyGal4 UAS-FLP/+; UAScorp+/+. 74 75 Figure 9. EP-corp+ induces corp+ overexpression. corp mRNA levels were measured by qRTPCR on total cDNA extracts from Actin-Gal4 EP-corp+ or y w control adults. The Y-axis indicates corp transcript levels normalized to the Rpl32 transcript. Data are represented as mean +SEM. N represents the number of biological replicates of each experiment. Statistical significance was calculated by the Mann-Whitney test. Although corp expression was ~15X higher when the EP-corp+ was driven, the difference was not significant at the 5% level. 76 77 Figure 10. Deletion mapping in the corp95B mutant. (A) The corp genomic region on the X chromosome and corp transcripts (RA and RB; adapted from FlyBase: http://flybase.org/reports/FBgn0030028.html). Orange shading denotes the protein coding regions. The blue arrowhead indicates the site of the EY03495 EPgy2. Imprecise excision of the EY03495 element produced the corp95B allele. The black line indicates the region of the genome that is deleted in corp95B mutant. Two sets of primers, Fwd1, Rev1 and Fwd2, Rev2 were used for PCR amplification of corp genomic region. (B,C) Visualization of PCR results. The corp genomic region was amplified either by Fwd1, Rev1 or by Fwd 2, Rev2 primer pairs in four different genotypes, run in the four lanes on the gel, marked 1 through 4: (1) y w; (2) corp mutant 1; (3) corp95B; and (4) corp mutant 2. M1 is a 1 kb ladder and M2 is the 100 bp ladder. The vertical red arrow indicates the lane 3, which lacks any PCR product and corresponds to the corp95B template. The horizontal red arrowhead points to the size expected in the y w control. Only the corp95B mutant was used in this work. The extent of the corp95B deletion allele was determined by DNA sequencing of genomic DNA. 78 79 Figure 11. Altered corp function only affects eyes after dicentric chromosome induction. The distribution of eye sizes when (B) H1 dicentrics are produced in the presence of uninduced EP-corp+; (C) EP-corp+ is induced in B+ flies without dicentric induction; (D, E) EP-corp+ is introduced, uninduced (D), and induced (E) into BS flies without dicentric induction; (F) corp95B is introduced into BS background without dicentric induction; (G) corp95B is introduced into B+ flies without dicentric induction; (H) H1 dicentrics are produced in XXY(H1) females; (I) EP-corp+ is overexpressed following dicentric induction in XXY(H1) females; (J) dicentric chromosome formation is induced on chromosome 3 (Dc3); and (K) EP-corp+ is overexpressed with chromosome 3 dicentric induction (K). N represents the number of fly eyes scored for each genotype. 80 81 Figure 12. corp+ inhibits DNA damage-induced apoptosis in somatic tissue. (A) The effect of corp+ overexpression assayed by TUNEL staining of third instar wing discs 3 hours after exposure to 4000 rads of IR. The white broken line marks the boundary between the anterior (ant) and posterior (post) compartments of the disc, based on engrailed-driven GFP fluorescence that marks the posterior compartment (i and iii). (i, ii) The staining pattern in wildtype control. (iii, iv) Staining in discs where engrailed is driving EP-corp+ overexpression in posterior compartment. TUNEL staining is very dense in wildtype larvae in the posterior segment (ii), but is greatly reduced with corp+ overexpression (iv). All images were taken with a 20X objective. (B) The effect of the corp95B mutant assayed by acridine orange (AO) staining of wing discs from irradiated third instar larvae. Larvae were exposed to 4000 rads of X-ray and dissected 5-6 hours later. Staining is greatly increased in corp95B mutants compared to the y w control. Images were captured with a 10X objective. Representative discs are shown here as negative images for ease of visualization. (C) Quantitation of TUNEL staining. The ratio of posterior:anterior fluorescence intensity in each disc was used as a measure of how corp+ overexpression alters apoptosis. Genotypes tested are indicated on the X-axis. N represents total number of discs used for quantification. (D) Quantitation of AO staining. Staining intensity per unit area for y w control and corp95B mutant. N represents total number of discs used for quantification. 82 83 Figure 13. Interaction of corp and p53. (A) The p535A-1-4 mutation is epistatic to corp in the BARTL assay. The corp95B mutation produces headless flies in the BARTL assay (reproduced from Figure 2), while p535A-1-4 has the opposite effect, producing flies with wildtype eyes. The double mutant is indistinguishable from the p535A-1-4 single mutant. N represents the number of eyes or headless pharates scored. Genotypes used were y w corp95B/H1; eyGal4 UAS-FLP; y w/H1; eyGal4 UAS-FLP/+; p535A-1-4 ; y w corp95B/H1; eyGal4 UAS-FLP/+; p535A-1-. (B) Overexpression of corp+ suppresses the apoptotic phenotype caused by overexpression of p53+. Eye sizes were measured from flies that overexpressed p53+, and that also overexpressed corp+ or were corp95B mutants. The Y-axis represents fraction of wildtype eye size. N is the number of eyes measured. (C) corp+ overexpression suppresses the cell-death phenotypes mediated by hid+ or reaper+ overexpression. GMR drives corp+, hid+, and reaper+ overexpression. The Y-axis represents eye size, normalized to wildtype, for each genotype. N is the number of eyes. 84 85 Figure 14. Corp negatively regulates P53 protein levels. (A) Immunostaining of eye discs of flies expressing p53+ under control of the GMR promoter (shown here as negative images). Red arrowheads indicate approximate position of the morphogenetic furrow. Posterior is to the right. Genotypes are as indicated. All images were taken with a 40X objective. (B) Quantitation of P53 immunostaining. N represents the number of eye discs scored. (C, D) P53 protein level increases in corp knockdown cells. (C) Western blot of protein extracts from S2 cells. The first lane represents untreated cells (WT), and the second lane after treatment with dsRNA directed against corp. β-tubulin is the loading control. Blots are cropped to display only the desired sizes for clarity and conciseness of data presentation. (D) Quantitation of P53 protein levels. P53 protein levels are represented as the P53 protein level normalized to β-tubulin. N represents the number of experimental repetitions. Data are represented as mean +SEM. 86 87 Figure 15. corp+ does not affect p53 transcript levels. p53 mRNA levels were measured by qRTPCR on total cDNA extracts of irradiated and nonirradiated third instar larvae. The graphs represent p53 mRNA levels with no irradiation and at different time points after irradiation, in control (light blue bars) corp+ overexpressing (yellow bars) and corp95B mutant (pink bars) larvae (as indicated). The larvae were irradiated at 4000 rads and allowed to recover for 1, 2, and 3 hours before cDNA extraction. Three biological replicates were carried out for each experiment. Data are represented as mean +/- SEM. 88 89 Figure 16. Relationships between Corp, Mdm2, and P53. (A) Conserved protein motifs between Mdm2 and Corp identified by MEME. Seven similar protein motifs between 4 vertebrate Mdm2 orthologs (H. sapiens, M. musculus, D. rerio, G. gallus) and 2 Corp orthologs (D. melanogaster, D. virlis). Two motifs are conserved between Mdm2 and Corp in all six species. (i) A complete map of the 6 proteins indicating 7 shared motifs, represented by colored rectangles. A scale below indicates length of the individual proteins. Motifs 4 and 5 are found in Corp. (ii) The amino acid sequence of motif 4. Start site indicates the first amino acid residue in that motif. Amino acids of conserved motifs are color-coded 64. P-values that indicate the significance of conservation of each motif were produced by MEME. (iii) The amino acid sequence of the motif 5 region. (B) A model of the pro-apoptotic and anti-apoptotic pathways under P53 control in Drosophila melanogaster. A DNA double-strand break activates the DNA damage response leading to P53 activation. The well-known pro-apoptotic genes hid and reaper are indicated in one pathway downstream from P53, while the anti-apoptotic gene corp is diagrammed in a second branch of the pathway. Hid and Reaper inhibit the inhibitor of apoptosis Diap1, thus triggering the downstream initiator and effector caspases, Dronc and Drice, respectively, to induce apoptosis. A positive feedback loop acting on p53 exists downstream of hid and reaper. Corp constitutes a second feedback loop, in this case acting negatively on P53. 90 91 Figure 17. Corp physically interacts with Drosophila P53. (A) The results of pull-down from HeLa cells expressing Corp-GFPFlag. Cell lysate was incubated with GST or GST-DmP53 bound to glutathione-agarose beads. Captured proteins were resolved with SDS-PAGE and probed with antiFlag antibody. The predicted molecular weight of Corp-GFPFlag is about 55 KDa. The smaller (~33KDa) band on the input lane likely reflects the C-terminal fragment of the fusion protein, which does not interact with GST-DmP53. (B) In vitro synthesized Corp-HA6His (~28KDa) interacts with GST-DmP53. The smaller band likely reflects an N-terminal 35S-Methionine containing fragment of Corp, which does interact with DmP53. 92 93 Figure 18. Protein interactions of Corp in Drosophila melanogaster. This figure, taken from FlyBase (http://flybase.org/cgibin/get_interactions.html?items=FBgn0030028&mode=ppi), shows proteins that have been identified as physically interacting with Corp 1. Nine of these 19 interactors are proteasome subunits. 94 95 Table 5. Effect of corp on transmission of broken-and-healed chromosomes through the male germline. FrY sons Y sons 317 55 6401 14411 0.31 25011 y w EP-corp+/H1; 70FLP10/+; nosGal4/+ 247 51 7 9801 0.001 (P<0.000 1) 11611 y w/H1; UAS-FLP nosGal4/+ 247 14 11998 2425 0.83 16675 y w EP-corp+/H1; UAS-FLP nosGal4/+ 174 30 2180 7573 0.22 (P<0.000 1) 11386 b N y w/H1; 70FLP10/+ a Sterility b (%) a Genotype Fragment Daughters c Ratio (P value) N, number of males testcrossed. Percentage of tested males that were sterile. c Fragment ratio is calculated as FrY sons/total sons. P values were determined with the Mann-Whitney test using Fragment Ratios of individual males. Each P value represents comparison with the row immediately above in this table. 96 References 1. Elledge, S. J. & Zhou, B.-B. S. The DNA damage response: putting checkpoints in perspective. Nature 408, 433-439 (2000). 2. Sancar, A. A., Lindsey-Boltz, L. A. L., Unsal-Kaçmaz, K. K. & Linn, S. S. Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Biochemistry 73, 39-85 (2004). 3. Jackson, S. P. & Bartek, J. The DNA-damage response in human biology and disease. Nature 461, 1071-1078 (2009). 4. Ahmad, K. K. & Golic, K. G. K. Telomere loss in somatic cells of Drosophila causes cell cycle arrest and apoptosis. Genetics 151, 1041-1051 (1999). 5. Titen, S. W. A. & Golic, K. G. Telomere Loss Provokes Multiple Pathways to Apoptosis and Produces Genomic Instability in Drosophila melanogaster. Genetics 180, 1821-1832 (2008). 6. Golic, K. G. Local Transposition of P Elements in Drosophila Melanogaster and Recombination between Duplicated Elements Using a Site-Specific Recombinase. Genetics 137, 551 (1994). 7. Hollstein, M., Sidransky, D., Vogelstein, B. & Harris, C. C. p53 mutations in human cancers. Science 253, 49-53 (1991). 8. Hirao, A. DNA Damage-Induced Activation of p53 by the Checkpoint Kinase Chk2. Science 287, 1824-1827 (2000). 9. Matsuoka, S., Huang, M. & Elledge, S. J. Linkage of ATM to cell cycle regulation by the Chk2 protein kinase. Science 282, 1893-1897 (1998). 10. Chaturvedi, P. P. et al. Mammalian Chk2 is a downstream effector of the ATM-dependent DNA damage checkpoint pathway. Oncogene 18, 4047- 4054 (1999). 11. Saito, S. et al. ATM Mediates Phosphorylation at Multiple p53 Sites, Including Ser46, in Response to Ionizing Radiation. Journal of Biological Chemistry 277, 12491-12494 (2002). 12. Banin, S. et al. Enhanced Phosphorylation of p53 by ATM in Response to DNA Damage. Science 281, 1674-1677 (1998). 13. Khanna, K. K. et al. ATM associates with and phosphorylates p53: mapping the region of interaction. Nat Genet 20, 398-400 (1998). 97 14. Kodama, M. et al. Requirement of ATM for rapid p53 phosphorylation at Ser46 without Ser/Thr-Gln sequences. Molecular and Cellular Biology 30, 1620-1633 (2010). 15. Chehab, N. H. N., Malikzay, A. A., Appel, M. M. & Halazonetis, T. D. T. Chk2/hCds1 functions as a DNA damage checkpoint in G(1) by stabilizing p53. Genes & Development 14, 278-288 (2000). 16. Wahl, G. M. & Carr, A. M. The evolution of diverse biological responses to DNA damage: insights from yeast and p53. Nat Cell Biol 3, E277-E286 (2001). 17. Liu, Y. p53 protein at the hub of cellular DNA damage response pathways through sequence-specific and non-sequence-specific DNA binding. Carcinogenesis 22, 851-860 (2001). 18. Akdemir, F., Christich, A., Sogame, N., Chapo, J. & Abrams, J. M. p53 directs focused genomic responses in Drosophila. Oncogene 26, 5184- 5193 (2007). 19. Brodsky, M. H. et al. Drosophila melanogaster MNK/Chk2 and p53 Regulate Multiple DNA Repair and Apoptotic Pathways following DNA Damage. Molecular and Cellular Biology 24, 1219-1231 (2004). 20. Colombani, J., Polesello, C., Josué, F. & Tapon, N. Dmp53 activates the Hippo pathway to promote cell death in response to DNA damage. Curr. Biol. 16, 1453-1458 (2006). 21. Lee, J. H. et al. In vivo p53 function is indispensable for DNA damageinduced apoptotic signaling in Drosophila. FEBS Letters 550, 5-10 (2003). 22. Vousden, K. H. & Lu, X. Live or let die: the cell's response to p53. Nat. Rev. Cancer. 2, 594-604 (2002). 23. Donehower, L. A. L. et al. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356, 215-221 (1992). 24. Kurzhals, R. L., Titen, S. W. A., Xie, H. B. & Golic, K. G. Chk2 and p53 are haploinsufficient with dependent and independent functions to eliminate cells after telomere loss. PLoS Genet 7, e1002103-e1002103 (2011). 25. Brodsky, M. H. et al. Drosophila p53 Binds a Damage Response Element at the reaper Locus. Cell 101, 103-113 (2000). 26. Ollmann, M. et al. Drosophila p53 is a structural and functional homolog of 98 the tumor suppressor p53. Cell 101, 91-101 (2000). 27. Jin, S. et al. Identification and characterization of a p53 homologue in Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.A. 97, 7301-7306 (2000). 28. Kubbutat, M. H. G., Jones, S. & Vousden, K. H. Regulation of p53 stability by Mdm2. Proc. Natl. Acad. Sci. U.S.A. 387, 299-303 (1997). 29. Momand, J., Zambetti, G. P., Olson, D. C., George, D. & Levine, A. J. The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation. Cell 69, 1237-1245 (1992). 30. Peters, M. et al. Chk2 regulates irradiation-induced, p53-mediated apoptosis in Drosophila. proc Natl Acad Sci USA 99, 11305-11310 (2002). 31. Zhang, Y. et al. Epigenetic Blocking of an Enhancer Region Controls Irradiation-Induced Proapoptotic Gene Expression in Drosophila Embryos. Developmental Cell 14, 481-493 (2008). 32. Rørth, P. P. A modular misexpression screen in Drosophila detecting tissue-specific phenotypes. Proc. Natl. Acad. Sci. U.S.A. 93, 12418-12422 (1996). 33. Hauck, B. B., Gehring, W. J. W. & Walldorf, U. U. Functional analysis of an eye specific enhancer of the eyeless gene in Drosophila. Proc. Natl. Acad. Sci. U.S.A. 96, 564-569 (1999). 34. Fan, Y. & Bergmann, A. Distinct Mechanisms of Apoptosis-Induced Compensatory Proliferation in Proliferating and Differentiating Tissues in the Drosophila Eye. Developmental Cell 14, 399-410 (2008). 35. Brand, A. H. & Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401-415 (1993). 36. Tabata, T., Schwartz, C., Gustavson, E., Ali, Z. & Kornberg, T. B. Creating a Drosophila wing de novo, the role of engrailed, and the compartment border hypothesis. Development 121, 3359-3369 (1995). 37. Ahmad, K. & Golic, K. G. The transmission of fragmented chromosomes in Drosophila melanogaster. Genetics 148, 775-792 (1998). 38. Titen, S. W. A. & Golic, K. G. Healing of euchromatic chromosome breaks by efficient de novo telomere addition in Drosophila melanogaster. Genetics 184, 309-312 (2010). 99 39. Titen, S. W. A., Lin, H.-C., Bhandari, J. & Golic, K. G. Chk2 and p53 regulate the transmission of healed chromosomes in the Drosophila male germline. PLoS Genet 10, e1004130-e1004130 (2014). 40. Shlevkov, E. & Morata, G. A dp53/JNK-dependant feedback amplification loop is essential for the apoptotic response to stress in Drosophila. Cell Death Differ 19, 451-460 (2012). 41. Bailey, T. L. T. & Elkan, C. C. Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proc Int Conf Intell Syst Mol Biol 2, 28-36 (1994). 42. Bailey, T. L. T., Williams, N. N., Misleh, C. C. & Li, W. W. W. MEME: discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Research 34, W369-W373 (2006). 43. Chen, J., Marechal, V. & Levine, A. J. Mapping of the p53 and mdm-2 interaction domains. Mol. Cell. Biol. 13, 4107-4114 (1993). 44. Kussie, P. H. et al. Structure of the MDM2 oncoprotein bound to the p53 tumor suppressor transactivation domain. Science 274, 948-953 (1996). 45. Kulikov, R., Winter, M. & Blattner, C. Binding of p53 to the central domain of Mdm2 is regulated by phosphorylation. J. Biol. Chem. 281, 28575- 28583 (2006). 46. Sogame, N., Kim, M. & Abrams, J. M. Drosophila p53 preserves genomic stability by regulating cell death. Proc. Natl. Acad. Sci. U.S.A. 100, 4696- 4701 (2003). 47. Nordstrom, W. & Abrams, J. M. Guardian ancestry: fly p53 and damageinducible apoptosis. Cell Death Differ 7, 1035-1038 (2000). 48. Manfredi, J. J. The Mdm2-p53 relationship evolves: Mdm2 swings both ways as an oncogene and a tumor suppressor. Genes & Development 24, 1580-1589 (2010). 49. Guruharsha, K. G. et al. A protein complex network of Drosophila melanogaster. Cell 147, 690-703 (2011). 50. Jones, S. N., Roe, A. E., Donehower, L. A. & Bradley, A. Rescue of embryonic lethality in Mdm2-deficient mice by absence of p53. Nature 378, 206-208 (1995). 51. Pant, V. et al. The p53-Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, 100 and longevity. Genes & Development 27, 1857-1867 (2013). 52. Tollini, L. A., Jin, A., Park, J. & Zhang, Y. Regulation of p53 by Mdm2 E3 Ligase Function Is Dispensable in Embryogenesis and Development, but Essential in Response to DNA Damage. Cancer Cell 26, 235-247 (2014). 53. Allton, K. et al. Trim24 targets endogenous p53 for degradation. Proc. Natl. Acad. Sci. U.S.A. 106, 11612-11616 (2009). 54. Chen, S., Wei, H.-M., Lv, W.-W., Wang, D.-L. & Sun, F.-L. E2 ligase dRad6 regulates DMP53 turnover in Drosophila. Journal of Biological Chemistry 286, 9020-9030 (2011). 55. Oikemus, S. R. Drosophila atm/telomere fusion is required for telomeric localization of HP1 and telomere position effect. Genes & Development 18, 1850-1861 (2004). 56. Bilak, A., Uyetake, L. & Su, T. T. Dying cells protect survivors from radiation-induced cell death in Drosophila. PLoS Genet 10, e1004220 (2014). 57. Xie, H. B. & Golic, K. G. Gene Deletions by Ends-In Targeting in Drosophila melanogaster. Genetics 168, 1477-1489 (2004). 58. Rørth, P. Gal4 in the Drosophila female germline. Mechanisms of Development 78, 113-118 (1998). 59. Freeman, M. Reiterative use of the EGF receptor triggers differentiation of all cell types in the Drosophila eye. Cell 87, 651-660 (1996). 60. Bischof, J. J., Maeda, R. K. R., Hediger, M. M., Karch, F. F. & Basler, K. K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007). 61. Clemens, J. C. et al. Use of double-stranded RNA interference in Drosophila cell lines to dissect signal transduction pathways. Proc. Natl. Acad. Sci. U.S.A. 97, 6499-6503 (2000). 62. Somma, M. P., Fasulo, B., Cenci, G., Cundari, E. & Gatti, M. Molecular dissection of cytokinesis by RNA interference in Drosophila cultured cells. Mol Biol Cell 13, 2448-2460 (2002). 63. Goshima, G. & Vale, R. D. The roles of microtubule-based motor proteins in mitosis: comprehensive RNAi analysis in the Drosophila S2 cell line. The Journal of Cell Biology 162, 1003-1016 (2003). 101 64. Kyte, J. & Doolittle, R. F. A simple method for displaying the hydropathic character of a protein. J Mol Biol 157, 105-132 (1982). CHAPTER 4 ROLE OF FS(1)YB AS AN INDUCER OF CELL DEATH FOLLOWING IRREPARABLE DNA DAMAGE 103 Abstract The EP misexpression screen in the BARTL background identified a gene, fs(1)Yb, that severely reduces cell survival following irreparable DNA damage in the form of a telomere loss, leading to the ablation of the whole tissue. fs(1)Yb knockdown, on the other hand, reduces the severity of apoptotic phenotype. fs(1)Yb is an upstream component in the piwi/piRNA pathway that plays an essential role in germline stem cell maintenance by inducing piRNA generation and transposon silencing through the downstream components, armi and piwi. Though the function of armi in suppression of DNA damage response and that of both armi and piwi in maintenance of telomere integrity have been previous reported, the role of fs(1)Yb in response to DNA damage has not been studied. Our results indicate a possible role of fs(1)Yb in the induction of DDR pathway following telomere loss. Introduction The fs(1)Yb gene was originally uncovered by mutations that caused semi-sterility in females of Drosophila melanogaster (Young and Judd, 1978). Later, it was determined that fs(1)Yb plays an essential role in germline stem cell maintenance, particularly during differentiation of ovarian follicle cells. Yb mutants produce few or no eggs (Johnson et al., 1995; King and Lin, 1999; Szakmary et al., 2009). The female sterility caused by fs(1)Yb was partially suppressed by increasing the Notch dosage, while reduction of Notch dosage produced a more severe phenotype, suggesting a possible functional or 104 regulatory interplay between fs(1)Yb and Notch signaling during oogenesis (Johnson et al., 1995). Later, Yb was characterized as a major upstream component of the piwi/piRNA pathway (King et al., 2001; Qi et al., 2011). The complex class of small noncoding RNAs, called piRNAs, that interact with Piwi proteins have been widely implicated for their germline-specific roles in stem cell maintenance, spermiogenesis, and transposon silencing (Cox et al., 1998; Megosh et al., 2006; Szakmary et al., 2009; Thomson and Lin, 2009). Structural analysis revealed that Fs(1)Yb contains a TUDOR domain, which is present in most piRNA pathway proteins (King and Lin, 1999; Shoji et al., 2009). Fs(1)Yb localizes to dense cytoplasmic regions called Yb bodies where it recruits armitage (Armi), a putative RNA helicase involved in the piRNA pathway, and recruits Piwi, another piRNA component, into the nucleus of somatic and germ cells, where Piwi then silences genes by piRNA generation. In Yb mutants, the co-immunoprecipitation of Armi with Yb is disrupted, Piwi fails to enter the nucleus and is freed from piRNAs, which then get drastically diminished, and somatic transposons are desilenced (Qi et al., 2011; Saito et al., 2010). Thus, fs(1)Yb poses to be an upstream piRNA pathway component and plays a crucial role in monitoring the Piwi-piRNA binding and eventual transposon silencing. There are two parallel pathways downstream of fs(1)Yb: the piwi-mediated germline stem cell self-renewal and the hedgehog (hh)-mediated somatic stem cell proliferation. Via these pathways, fs(1)Yb maintains both the germline and somatic stem cell populations. Yb mutants 105 eliminate and Yb+ overexpression overproliferates both stem cell populations (King et al., 2001). Piwi-pathway proteins have been shown to play an important role in maintenance of telomere integrity. This is achieved by silencing the transcription of telomeric repeat sequences and maintaining the telomeric capping complex. In fact, armi mutants have been shown to disrupt HOAP binding to telomere, reduce expression of a subpopulation of telomere-specific piRNAs, and enhance HeT-A copy numbers. armi mutants also lead to extensive fragmentation of the zygotic genome (Khurana et al., 2010), probably due to DNA damage signaling from genome-wide over-transcription. Furthermore, mutations of piRNA pathway proteins, like armi and aub, have developmental implications in the context of DNA damage response. They result in disruption of asymmetric RNA localization along the axes of the oocyte, which is rescued by chk2 mutants (Chen et al., 2007; Klattenhoff et al., 2007), implying that mutation of piRNA pathway proteins triggers DNA damage response at their downstream, which is suppressed by mutating damage response pathway proteins, for example, chk2. All these evidences point to the fact that disruption of piRNA pathway proteins can be the causative agent of DNA damage, which induces the responses downstream to it. However, there has been no report so far on the role of fs(1)Yb in DNA damage response. Here, we demonstrate that fs(1)Yb+ acts as an enhancer of cell-death phenotype in the soma following telomere loss, probably through elimination of cells with telomere loss in a P53-dependent manner. It also 106 eliminates germline cells that have been induced with telomere loss and inhibits transmission of broken-and-healed chromosome through the germline. Results EP misexpression screen identifies fs(1)Yb as an enhancer of apoptosis phenotype following irreparable DNA damage. Through the EP misexpression screen in the BARTL background (Kurzhals et al., 2011), we identified an EP insertion, P{EPgy2}CG2701EY04983, that produced headless pharates in the BARTL assay (Figure 19C). This insertion was ideally placed to drive expression of the fs(1)Yb+ gene (CG2706) (Figure 20A). When we tested RNAi-mediated knockdown of fs(1)Yb in the BARTL assay, an opposite result was obtained: the eyes were significantly larger, though not fully wildtype-like (Figure 19E,F). Similarly, a fs(1)Yb null mutant gave mostly large eyes when tested in the BARTL background (Figure 19D). If EP-fs(1)Yb+ was not induced by Gal4, and eyFLP was instead used to produce dicentric chromosomes in the eye, we found that the EP-fs(1)Yb+ insertion, by itself, had no effect (Figure 19J). This further confirms that fs(1)Yb+ overexpression is necessary to generate the large eye phenotype in the BARTL assay. To determine whether fs(1)Yb has any influence in the absence of DNA damage, we examined wildtype or BS flies carrying EP-fs(1)Yb+, induced or uninduced, but without the induction of dicentric chromosomes. There was mostly no change in eye phenotype in any of these cases, indicating that the effects of altered fs(1)Yb expression are seen only after DNA damage (Figure 107 19G-I). EP-corp+ suppresses the apoptotic phenotype of EP-fs(1)Yb+ following telomere loss. We have previously identified corp as one of the genes in the EP screen that displayed a suppressor effect in the BARTL assay and have demonstrated that corp acts as a negative regulator of the tumor suppressor P53 (Chapter 2 and 3). We wanted to find out if corp and fs(1)Yb act in the same or in a complementary pathway in response to DNA damage. So, we overexpressed both fs(1)Yb+ and corp+, mediated by EP, in the BARTL background. This recovered adults with wildtype-like eyes (Figure 20B-D), suggesting that corp acts downstream of fs(1)Yb following DNA damage to rescue the cell-death phenotype produced by fs(1)Yb. This further implies that it functions upstream of p53, therefore in the DDR pathway. EP-induced fs(1)Yb overexpression inhibits germline transmission of broken and healed chromosomes. Since EP-fs(1)Yb+ produced an apoptotic phenotype in the somatic tissue following telomere loss, we wanted to investigate if it also eliminates cells after telomere loss in the germline. We have previously seen that if a germline cell suffers a telomere loss, that chromosome may be healed by addition of a telomere cap, and then transmitted to progeny (Ahmad and Golic, 1998; Titen and Golic, 2010). In order to find out if EP-fs(1)Yb+ affects the transmission of broken-and-healed chromosome, we induced expression of FLP by heat shock (70FLP10) during the first 24 hours of development and used nanosGal4 to drive germ cell-specific overexpression of EP-fs(1)Yb+. We found 108 that EP-fs(1)Yb+ significantly reduced transmission of broken-and-healed chromosomes (Table 6). Overexpression of telomere cap component, hiphop, rescues the cell-death phenotype produced by EP-induced fs(1)Yb overexpression. Since EP-fs(1)Yb+ reduced transmission of broken-and-healed chromosomes, there is a possibility that it plays a role to inhibit the addition of de-novo telomeres at broken ends of chromosomes. If this holds true, then fs(1)Yb+ would likely disrupt the phenotype produced telomere capping components. In order to test this, we co-overexpressed EP-fs(1)Yb+ with a component of the telomere cap complex, hiphop. We found, as previously seen (R. Kurzhals, personal communication), that induction of UAS-hiphop+ produces near-wildtype eyes following telomere loss (Figure 20E). However, co-expression of fs(1)Yb+ produced no change in the phenotype (Figure 20F). This fails to demonstrate a role of fs(1)Yb+ in inhibition of de novo telomere addition. Knockdown of piwi pathway components induce an apoptotic phenotype independent of DNA damage induction. Since fs(1)Yb is a component of the piRNA pathway, we wanted to test the piwi and armi genes for their role on cell survival following telomere loss. Interestingly, we found that knockdown of piwi and armi induced a cell-death phenotype, as opposed to fs(1)Yb knockdown (Table 7). To determine whether they have a general effect on eye development, we induced piwi and armi knockdown in a wildtype background without induction of telomere loss. We found that knockdown of piwi or armi reduced cell survival in the eye even without any DNA damage induction, 109 implying that their loss hinders normal eye development and that this effect is aggravated after induction of DNA damage to the cells of the eye. Discussion and future directions In the BARTL assay, fs(1)Yb overexpression and knockdown produced drastically opposite phenotypes: fs(1)Yb overexpression ablated the eye completely following telomere loss while the Yb mutant and knockdowns produced significantly enlarged eyes. This suggests that fs(1)Yb normally makes only a small contribution to the elimination of cells with DNA damage, or that the RNA interference is not highly effective; however, its overexpression in the somatic cells is clearly capable of mediating the death of virtually all cells with irreparable DNA damage. Similar to the effect in soma, fs(1)Yb overexpression increases the elimination of cells with broken chromosomes in the germline, seen as reduced transmission of broken-and-healed chromosomes through the germline. This could have suggested a possible role of fs(1)Yb+ in inhibition of de novo telomere addition. However, our finding, that fs(1)Yb+ overexpression does not alter the large eye phenotype produced by hiphop+ overexpression in the BARTL assay, indicates a declined probability of its role in inhibition of de novo telomere capping. The fact that fs(1)Yb+ inhibits broken-and-healed chromosome transmission but not a significant change in sex ratio, compared to the wildtypes carrying a broken chromosome, suggests that fs(1)Yb+ plays a role in controlling the survival of germline cells with a broken chromosome: it aids the elimination of primary spermatocytes with an unhealed damaged chromosome at the 16 cell- 110 stage, but not of the post-meiotic FrY spermatids - that results in the decrease in fragment transmission but not a significant difference in the sex ratio. It was also interesting to note a sharp drop in the average number of progenies produced by each fertile male carrying a broken chromosome and with fs(1)Yb+ overexpression in its germline. This may be due to the fact a large number of primary spermatocytes are eliminated by fs(1)Yb+. However, since the experiment was carried out in different ways (total number of progenies were scored from two vials for each wildtype tester male and the progenies scored for fs(1)Yb+ overexpressing tester males were obtained from one vial), prediction cannot be made based on these numbers. Still, if we halve the average number of progenies produced by the wildtype (that is, 145 progenies on an average), it is still about three folds more than those produced by the fs(1)Yb+ overexpressing testers (50 progenies on an average). Nevertheless, this is not reliable and so, this experiment would be carried out in a similar setup, using UAS-FLP nanosGal4-mediated dicentric formation in the germline. The hypothesis, that fs(1)Yb+ is eliminating cells with broken chromosome at a premeiotic stage, can be tested by dissecting out testes from newly eclosed adult tester males with fs(1)Yb+ overexpression and scoring the population of primary spermatocytes within single cysts over a time course after dicentric induction. I predict to find a decrease in the number of primary spermatocytes in fs(1)Yb+ overexpressing males, compared to wildtype. One way by which fs(1)Yb+ may act is by inducing the DDR pathway at its downstream. In support, we found that corp+ overexpression alleviates the 111 BARTL phenotype produced by fs(1)Yb+ overexpression. This can be interpreted as, fs(1)Yb+ overexpression induces a P53-dependent cell death following DNA damage, which is rescued through corp+ overexpression. Alternatively, it may also suggest that corp acts through a pathway independent of fs(1)Yb, yet interferes, somewhere downstream, with fs(1)Yb-mediated induction of apoptotic phenotype. In order to find out if fs(1)Yb+ induces apoptotic phenotype in a P53dependent manner, a BARTL assay of EP-fs(1)Yb+ in a p535A-1-4 background can be carried out. Here, I would expect to observe a rescue of eye phenotype, producing large to wildtype-like eyes. To further investigate where exactly does fs(1)Yb+ fits in the DDR pathway, a BARTL assay of EP-fs(1)Yb+ can be carried out in a chk2-/- background. Further, to study if EP-fs(1)Yb+-mediated overexpression induces apoptosis, TUNEL or acridine orange staining of imaginal discs of irradiated fs(1)Yb+ overexpressing larvae can be performed. Methods and materials Drosophila stock collections. The Bloomington stocks obtained were: P{EPgy2}CG2701EY04983 (BL15778), RNAi-fs(1)Yb (BL 35301 and BL 35181), RNAi-piwi (BL 34866 and BL 33724), RNAi-armi (BL 34789), P{Gal4-ey.H}4-8 (BL 5535), P{eyFLP.N}5 (BL5576), P{EPgy2}CG1632EY03495 (BL 15650). DcY(H1) (Kurzhals et al., 2011), eGUF4.8JD1, w; 70FLP10, and UAShiphop(HRH008H) were obtained from our laboratory stock collection. The Yb72 stock was kindly gifted by Dr. Haifan Lin. 112 Germline fragment chromosome transmission assay. Flies were allowed to lay eggs and transferred to fresh vials every day. Embryos were collected for 24 hrs, heat-shocked at 38°C for 1 hour in a circulating water bath, and then immediately returned to 25°C. After eclosion, the males were collected and singly mated to 2-3 y w females and their progeny were scored. Graphical methods and statistical analyses. Construction of graphs and calculations of statistical significance were performed using Prism 5.0 (Graphpad). The Mann-Whitney test was used. 113 Figure 19. Overexpression of fs(1)Yb+ suppresses the BARTL phenotype only after telomere loss. (A) The eye phenotype distribution observed in the BARTL assay. The BS phenotype of H1 control males is shown at the left. When FLP is expressed (ey>FLP), the phenotypes can range from headless pharates (category 1) to adults with a fully developed wildtype eye (category 5). The distribution produced (B) in control males following dicentric induction by eGUF4.8JD1; (C) in males carrying P{EPgy2}EY04983 (BL 15778); (D) in fs(1)Yb72 mutants; (E, F) RNAi-mediated knockdowns of fs(1)Yb; (G, H) when EP-fs(1)Yb+ is introduced, uninduced (G) and induced (H) into BS flies without dicentric induction; (I) when EP-fs(1)Yb+ is induced in B+ flies without dicentric induction; (J) when H1 dicentrics are produced in the presence of uninduced EP-fs(1)Yb+. N represents number of eyes or headless pharates scored for each genotype. 114 A. 5 BL 35181 RNAi-fs(1)Yb N= 52 BS 1 2 3 4 5 5 4 3 2 1 3 2 1 5 4 5 3 3 5 5 5 2 5 4 4 4 % of eyes 3 3 1 4 4 J. 2 BS 2 4 5 100 100 80 80 60 60 40 40 20 20 00 1 2 3 BS 2 EP-fs(1)Yb +/Y; eGUF/+ N= 64 3 4 5 EP-fs(1)Yb +/H1; eyFLP/+ N= 96 BS 1 2 3 5 BL 35301 RNAi-fs(1)Yb N= 52 1 1 % of eyes 4 3 100 5 4 2 3 3 100 80 80 60 60 40 40 20 20 00 2 4 I. 2 BS B 5 5 EP-fs(1)Yb +/H1; eyGal4/+ N= 76 s % of eyes 4 80 80 60 60 40 40 20 20 00 1 2 1 B 100 H. 100 s 3 s % of eyes 2 BS B 1 1 B s BS B 80 80 60 60 40 40 20 20 0 0 5 Yb 72 N= 58 B s % of eyes F. 100 100 4 4 EP-fs(1)Yb +/H1 N= 108 s BS s % of eyes % of eyes 100 100 80 80 60 60 40 40 20 20 00 3 EP-fs(1)Yb + N= 38 D. 100 80 80 60 60 40 40 20 20 00 2 80 80 60 60 40 40 20 20 00 B 100 100 E. 1 3 G. 100 100 2 100 80 80 60 60 40 40 20 20 00 BS 1 % of eyes C. 80 60 60 40 40 20 20 00 2 Control N= 1053 80 1 % of eyes B. 100 100 1 1 BS 3 4 5 115 Figure 20. Effect of corp+ and hiphop+ overexpression on fs(1)Yb+mediated apoptotic phenotype in the BARTL assay. (A) The fs(1)Yb genomic region on the X chromosome and fs(1)Yb transcripts, fs(1)Yb-RA (adapted from FlyBase: http://flybase.org/cgibin/gbrowse2/dmel/?Search=1;name=FBgn0000928). Orange shading denotes the protein coding regions and grey shading denotes the 5' and 3' UTR regions on the fs(1)Yb transcript. The blue arrowhead, highlighted by an orange rectangle, indicates the site of the EY04983 EPgy2 insertion. (B) The EP-fs(1)Yb+ produces headless pharates in the BARTL assay (reproduced from Figure 14), while (C) EP-corp+ has the opposite effect, producing flies with wildtype eyes. (D) Co-induction of both is indistinguishable from the EP-corp+-mediated overexpression. (E) hiphop+ overexpression produces and wildtype eyes and (F) co-induction of both fs(1)Yb+ and hiphop+ is indistinguishable from the hiphop+ overexpression alone. N represents the number of eyes or headless pharates scored. 116 A. fs(1)Yb fs(1)Yb-RA P{EPgy2}CG2701[EY04983] E. 2 3 1 2 s BS 1 EP-fs(1)Yb +, EP-corp + N= 102 B % of eyes 100 100 80 80 60 60 40 40 20 20 00 3 4 5 5 5 3 2 3 4 5 2 4 4 D. 100 100 80 80 60 60 40 40 20 20 00 1 4 5 UAS-hiphop+, EP-fs(1)Yb+ N= 68 BS 1 2 3 5 5 3 4 2 4 1 3 B s BS % of eyes EP-corp + N= 256 BS 2 F. 1 5 1 % of eyes 4 s 3 B 2 UAS-hiphop+ N= 94 s 1 100 100 80 80 60 60 40 40 20 20 00 B BS % of eyes C. 100 100 80 80 60 60 40 40 20 20 00 EP-fs(1)Yb + N= 38 2 100 100 80 80 60 60 40 40 20 20 00 1 % of eyes B. 3 4 5 117 Table 6. Effect of fs(1)Yb+ on transmission of broken-and-healed chromosomes through the male germline. Genotype N a Sterili ty (%) y w/H1; 70FLP10/+ y w EPfs(1)Yb+/H1; 70FLP10/+; nosGal4/+ hjky w EPfs(1)Yb+/H1; 70FLP10/+; nosGal4/+ b FrY sons Y sons Fragment c Ratio (P value) Daughters Sex ratio Progenyavg 341 53 6470 14727 0.31 25476 0.83 291 363 26 901 5540 0.14 (P<0.0001) 7208 0.89 50 15 20 0 476 0.0 528 0.90 84 (no heatshock control) a b N, number of males testcrossed. Percentage of tested males that were sterile. c Fragment ratio is calculated as FrY sons/total sons. P values were determined with the Mann-Whitney test using Fragment Ratios of individual males. The P value represents comparison with the row immediately above in this table. d Average number of progenies (male+female) produced by each fertile tester male. d 118 Table 7. Effect of piwi and armi knockdowns/amorphic alleles on BARTL phenotype and on BS eye phenotype without telomere loss. Crossed to y w/H1; eGUF4.8JD1 (telomere loss) Effected RNAi/ gene amorphic allelea piwi BL 34866 BL 33724 armi BL 34789 Nb 40 42 55 BS 0 0 0 BARTL phenotype (%)c 1 2 3 4 100 92 50 0 0 7 0 0 7 0 4 2 5 0 4 34 Crossed to y w/Y; eyGal4-4.8 (without telomere loss) piwi armi a BL 34866 BL 33724 BL 34789 36 52 42 0 0 0 100 0 0 0 0 10 0 0 10 0 50 2 0 50 78 RNAi and amorphic stocks are obtained from Bloomington Stock Center (BL). Numbers of flies scored. c The range of BARTL eye phenotypes are categorized as either BS or from no eye (category 1) to full grown eye (category 5), as depicted in Figure 14A. b 119 References Ahmad, K., and Golic, K.G. (1998). The transmission of fragmented chromosomes in Drosophila melanogaster. Genetics 148, 775-792. Chen, Y.Y., Pane, A.A., and Schüpbach, T.T. (2007). cutoff and aubergine Mutations Result in Retrotransposon Upregulation and Checkpoint Activation in Drosophila. Curr. Biol. 17, 6-6. Cox, D.N., Chao, A., Baker, J., Chang, L., Qiao, D., and Lin, H. (1998). A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal. Genes & Development 12, 3715-3727. Johnson, E., Wayne, S., and Nagoshi, R. (1995). fs( I ) Yb is Required for Ovary Follicle Cell Differentiation in Drosophila melanogaster and Has Genetic Interactions With the Notch Group of Neurogenic Genes. Genetics 140, 207-217. Khurana, J.S., Xu, J., Weng, Z., and Theurkauf, W.E. (2010). Distinct functions for the Drosophila piRNA pathway in genome maintenance and telomere protection. PLoS Genet 6, e1001246-e1001246. King, F.J.F., and Lin, H.H. (1999). Somatic signaling mediated by fs(1)Yb is essential for germline stem cell maintenance during Drosophila oogenesis. Development 126, 1833-1844. King, F.J., Szakmary, A., Cox, D.N., and Lin, H. (2001). Yb Modulates the Divisions of Both Germline and Somatic Stem Cells Through Piwi- And HhMediated Mechanisms in the Drosophila Ovary. Mol. Cell 7, 497-508. Klattenhoff, C.C., Bratu, D.P.D., McGinnis-Schultz, N.N., Koppetsch, B.S.B., Cook, H.A.H., and Theurkauf, W.E.W. (2007). Drosophila rasiRNA Pathway Mutations Disrupt Embryonic Axis Specification through Activation of an ATR/Chk2 DNA Damage Response. Developmental Cell 12, 11-11. Kurzhals, R.L., Titen, S.W.A., Xie, H.B., and Golic, K.G. (2011). Chk2 and p53 are haploinsufficient with dependent and independent functions to eliminate cells after telomere loss. PLoS Genet 7, e1002103-e1002103. Megosh, H.B., Cox, D.N., Campbell, C., and Lin, H. (2006). The role of PIWI and the miRNA machinery in Drosophila germline determination. Curr. Biol. 16, 1884-1894. Qi, H., Watanabe, T., Ku, H.-Y., Liu, N., Zhong, M., and Lin, H. (2011). The Yb body, a major site for Piwi-associated RNA biogenesis and a gateway for Piwi expression and transport to the nucleus in somatic cells. Journal of Biological Chemistry 286, 3789-3797. Saito, K., Ishizu, H., Komai, M., Kotani, H., Kawamura, Y., Nishida, K.M., Siomi, 120 H., and Siomi, M.C. (2010). Roles for the Yb body components Armitage and Yb in primary piRNA biogenesis in Drosophila. Genes & Development 24, 2493- 2498. Shoji, M., Tanaka, T., Hosokawa, M., Reuter, M., Stark, A., Kato, Y., Kondoh, G., Okawa, K., Chujo, T., Suzuki, T., et al. (2009). The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. Developmental Cell 17, 775-787. Szakmary, A., Reedy, M., Qi, H., and Lin, H. (2009). The Yb protein defines a novel organelle and regulates male germline stem cell self-renewal in Drosophila melanogaster. The Journal of Cell Biology 185, 613-627. Thomson, T., and Lin, H. (2009). The biogenesis and function of PIWI proteins and piRNAs: progress and prospect. Annu. Rev. Cell Dev. Biol. 25, 355-376. Titen, S.W.A., and Golic, K.G. (2010). Healing of euchromatic chromosome breaks by efficient de novo telomere addition in Drosophila melanogaster. Genetics 184, 309-312. Titen, S.W.A., Lin, H.-C., Bhandari, J., and Golic, K.G. (2014). Chk2 and p53 regulate the transmission of healed chromosomes in the Drosophila male germline. PLoS Genet 10, e1004130-e1004130. Young, M.W., and Judd, B.H. (1978). Nonessential Sequences, Genes, and the Polytene Chromosome Bands of DROSOPHILA MELANOGASTER. Genetics 88, 723-742. CHAPTER 5 MODULATORS OF IRRADIATION SURVIVAL IN DROSOPHILA MELANOGASTER 122 Abstract Viability to high doses of ionizing radiation was investigated In Drosophila melanogaster. Stocks with comparatively clearer genetic backgrounds, derived from the original wildtype laboratory strain showed variable sensitivity to X-ray dose. Females survived better than males following irradiation. The viability of the organisms decreased significantly in a p53 mutant. Interestingly, a corp mutant exhibited a similar effect to the p53 mutant, that is, decreased organismal viability following irradiation. corp+ overexpression significantly increased their survival rate, particularly in males. Introduction Ionizing irradiation is a widely used method for inducing DNA damage to cells and as a leading anticancer therapy. Organisms are regularly exposed to radiation naturally and thus have evolved mechanisms to survive its detrimental effects. Irradiation causes DNA damage and genomic instability primarily by inducing double-strand breaks, and cells respond to it by activating checkpoints to induce cell cycle arrest and DNA repair, and to trigger apoptosis if the damage is beyond repair (Jackson and Bartek, 2009; Morgan et al., 1996; Sancar et al., 2004; Zhou and Elledge, 2000). These response pathways serve the critical function of maintaining genomic integrity, since widespread genetic instability and abnormality can lead to development of cancer in mammals. It has been reported that DNA repair is extremely essential for surviving irradiation; cell cycle regulation and apoptosis are neither indispensable nor 123 sufficient (Jaklevic et al., 2006; Jaklevic and Su, 2004). mei-41 (DmATR) and okra (DmRad54) mutants that are deficient in DNA repair die as pupae following irradiation, whereas a grp (DmChk1) mutant that can repair DNA damage but cannot regulate the cell cycle does not. This is possibly because, if cells continue to survive and proliferate with unrepaired DNA, the aberrations spread to the daughter cells and is unhealthy for the organism as a whole. To ensure organismal survival following radiation exposure, cell cycle progression is delayed and repair of DNA breaks commences. Unrepaired cells are removed by apoptosis and compensatory proliferation produces additional cells to maintain tissue integrity and organismal viability (Jaklevic and Su, 2004). The p53 tumor suppressor gene is one of the central players that govern adaptive responses to stress and is found to be mutated in most forms of human cancers (Hollstein et al., 1991; Vousden and Lu, 2002). It mediates transcriptional activation of genes that function in DNA repair and apoptosis. p53 mutants have been found to be sensitive to doses of irradiation (Jaklevic et al., 2006; Jaklevic and Su, 2004; Sogame et al., 2003). This may be because, even though cells are escaping apoptosis in a p53 mutant following DNA damage, they ultimately die through other stress pathway activation (McNamee and Brodsky, 2009; Titen and Golic, 2008; van Bergeijk et al., 2012; Wichmann et al., 2006) due to a heavy load of unrepaired DNA damage in these cells. As a result, the tissue integrity is lost and the organisms fail to survive. Here we report that, when tested for their ability to survive a high irradiation dose, stocks with a lesser degree of background genetic variability, 124 derived from original wildtype laboratory strain, exhibited variable rates of sensitivity between themselves. We found that a corp mutant becomes sensitive, similar to the p53 mutant, and that corp+ overexpression induces resistance to irradiation in males. Results and discussion The original wildtype laboratory strain, y w, is extremely sensitive to irradiation. When individuals from our control laboratory strain, y w, were irradiated with 4000 rad of X-ray as third instar larvae and scored for rate of eclosure as adults, we found that they are extremely sensitive to irradiation: only 8% eclose (Figure 21). This outcome was surprisingly different from previous reports on irradiation survival of wildtype laboratory strains: survival rates of wildtype strains are significantly better than our result, nearing 60% survival on an average (Jaklevic et al., 2006; Jaklevic and Su, 2004; Sogame et al., 2003). Moreover, we found that p535A-1-4 mutants exhibited 44% irradiation survival, higher than the y w control (Figure 21). This was again in contrast to that reported before: p53 mutants make flies sensitive to irradiation (Jaklevic and Su, 2004; Sogame et al., 2003). We speculated that these vast differences in the results could be due to unrecognized background mutations that have accumulated over time in the stock. The best way to approach this conflict was to diminish any genetic variability between the individuals of a single stock by building stocks with a genetically uniform background, or at least one closer to uniformity, except for the introduction of desired mutations or transgenes. 125 Background-reduced stocks, built from the original laboratory strain, y w, show significant variation in sensitivity to irradiation. To investigate the high sensitivity of our y w, I generated several lines with reduced background variation, by setting up several single male to single female crosses and maintaining them over generations. These derivative lines were called y wBR, where BR stands for background reduced. I tested the y wBR lines individually for survival rates following exposure to irradiation. Interestingly, I found that the irradiation survival rates of all the tested y wBR lines improved over that of the original y w stock, and also vary significantly between themselves (Figure 22). Of these, y wBR3 line showed a median effect and so, I chose y wBR3 line for further experimental procedures. Males were found to be more sensitive than females to irradiation in all y wBR3 lines, a well-known phenomenon that can be accounted for by the hemizygosity of the X chromosome in males. Background-reduced p535A-1-4 is more sensitive to irradiation. We next introgressed p535A-1-4 mutant strain into the y wBR3 background in order to give it a genetic background equivalent to that of y wBR3, except for the deletion of the p53 gene region (henceforth referred to as y wBR3; p535A-1-4). When tested for irradiation survival, we found that y wBR3; p535A-1-4 homozygous mutants become sensitive to irradiation, similar to previous reports (Figure 23). However, the rate of survival of y wBR3; p535A-1-4/+ heterozygotes is not significantly different from that of y wBR3 wildtype controls, suggesting that losing a single copy of the p53 gene does not sensitize them to irradiation (Figure 23). Since ubiquitous p53 126 overexpression by Actin-Gal4 or heat-shock inducible Gal4 kills the organism, they could not be used for testing irradiation survival. Thus, by reducing unrecognized background effects, our results of irradiation survival of wildtype and p53 mutant strains become comparable with previously reported data. corp+ promotes survival of males after exposure to irradiation. We next tested whether corp alters survival rates following irradiation. Since we have previously shown that corp is a negative regulator of p53, we thought that the corp mutant might produce an opposite effect to that of p53 on organismal viability following irradiation. Interestingly, we found that the corp95B mutant, like the p53 mutant, is sensitive to irradiation (Figure 24A,B). However, another corp mutant, corp1A, failed to reproduce the result produced by corp95B: it did not change survival rate, compared to wildtype (Figure 24B). This can be explained by the possibility that corp1A may not be a mutant at all, as verified by mapping for deletion of the genomic region in corp1A by PCR. My PCR results indicate that virtually no part of corp is missing in corp1A (Figure 24C-E). So, the corp1A irradiation survival result cannot be trusted with regard to accounting for how a corp null allele behaves. Further, it is to be noted that the two corp mutants were not introgressed into the y wBR3 background. So, the possible effect of background variability between the control and the mutants on irradiation survival cannot be overlooked. One way to address this problem is to construct a corp mutant in a y wBR3 background. This project is currently underway by others in the lab. 127 In order to verify the effects of corp95B on irradiation survival, I next wanted to see if corp+ overexpression produces an opposite effect to that produced by corp95B. I ubiquitously overexpressed EP-corp+ by the Actin-Gal4 driver and tested for organismal viability following irradiation. The EP-corp+ and the Actin-Gal4 lines were introgressed into the y wBR3 background to maintain the homogeneity of the genetic background of all the lines that were being tested. I found that corp overexpression makes the males significantly more resistant to irradiation and enhances their survival rate, compared to the controls (Figure 25, Table 8). In females, however, it does not show any effect (Figure 25, Table 8). This leads to the question of why corp+ helps only the males to survive better to irradiation. Is there a possibility of background suppressors that are playing a role here affecting female survival? Or, does it unveil an unknown characteristic feature of corp? These questions necessitate the generation of an isogenic background where all the genes would have a single allele and no variation, unless otherwise introduced. Nevertheless, the disparate effects of p53 and corp+, at least in males, on survival rate following irradiation-induced DNA damage may be explained in a number of ways. p53 mutants are sensitive to irradiation because the DNA repair pathway is blocked in them and the DNA repair pathway genes have been reported to be essential for irradiation survival (Jaklevic et al., 2006; Jaklevic and Su, 2004). Interestingly, it has been found in mammalian cells that UV-radiation exposure induces P53 expression in a dose-dependent manner and a lower P53 expression level correlates with transcription of DNA damage repair genes while 128 a higher dose of P53 is required for transcription of pro-apoptotic genes (Latonen et al., 2001; Li and Ho, 1998). In this vein, it can be reasoned that corp+ overexpression-mediated downregulation of P53 significantly reduces its levels so that it cannot induce apoptosis; however, the residual level of P53 that still persists may be adequate to induce DNA repair. That may lead to an increased survival rate. Another possible explanation of the corp+- mediated increased organismal viability is that the corp+- mediated P53 downregulation delays apoptosis that gives the DNA repair machinery extra time to repair the damaged genome and save the cells, thus enhancing adult eclosure rate. Alternatively, it can also be hypothesized that corp has other targets besides p53 and that the role of corp in irradiation survival may be mediated through these targets, for example, through downregulation of inhibitors of the DNA repair pathway. Future experiments 1. Generate an isogenic y w stock, introgress all transgenes and mutants tested in that background, and recheck irradiation survival data. 2. If corp+-induced irradiation resistance result still holds true, then test if corp+ overexpression can still enhance organismal survival in a p53 mutant background: EP-corp+; UAS-GFP Actin-Gal4; p535A-1-4. 3. Test if corp+ induces DNA repair: Irradiate EP-corp+ overexpressing larvae at 200 rads, dissect their wing and eye imaginal discs over a time-course after irradiation, and stain with H2AγX, marker of DNA damage. I would expect to find a decrease in H2AγX staining in corp+ overexpressing discs. Verify if a 129 decrease in staining is displayed by the corp95B mutant. Next, this experiment can be performed in a p53 mutant background, to check if corp+ induces DNA repair in a P53-independent way. 4. To find out genes that are upregulated or downregulated by corp induction without and after DNA damage: Generate a RNAseq data of corp+ overexpressing and corp95B lines with and without irradiation treatment. I would expect to find many targets of corp other than p53. Materials and methods Drosophila stock collections. Construction of p535A-1-4 has been described previously (Xie and Golic, 2004).The Bloomington stock used was P{EPgy2}CG1632EY03495 (BL 15650). The following lines were obtained from our laboratory collection: y w, y w; UAS-GFP Actin-Gal4/CyO and y w; Sb/TM6, Ubx. Constructing lines with lesser background variability. 11 batches of single male to single female crosses from the original y w laboratory stock were carried out to build up y w lines with lesser degree of background variability (referred to as y wBR1-11) and were maintained thereafter. Then, y w EP-corp+, y w; UAS-GFP Actin-Gal4/CyO, and y w; p535A-1-4 strains were introgressed into the y wBR3 reduced background strain in a manner similar to making recombinant inbred lines. Briefly, y w EP-corp+, y w; UAS-GFP Actin-Gal4/CyO females were crossed to y wBR3/Y males; from the progenies, y w EP-corp+/ y wBR3, y w/ y wBR3; UAS-GFP Actin-Gal4/+, and y w/ y wBR3; +/CyO virgins were collected and were crossed to y wBR3/Y males repeatedly for 5 generations. The undisrupted 130 presence of the transgenes in successive generations was verified by the w+ eye color marker for EP-corp+ and the GFP fluorescence for UAS-GFP Actin-Gal4. The transgenic lines, introgressed into the isogenic background, were henceforth referred to as y wBR3 EP-corp+ and y wBR3; UAS-GFP Actin-Gal4/CyO. Since y w; p535A-1-4 is not phenotypically marked, it could be directly introgressed into y wBR3. So, y w; Sb/TM6, Ubx was first introgressed into y wBR3 line for 3 generations in the same way as described above, and then y w; p535A-1-4 was further introgressed into y wBR3; Sb/TM6, Ubx for another three generations. In each generation, y w/y wBR3; p535A-1-4/TM6, Ubx virgins, marked by Sb+ Ubx were collected and then crossed to y wBR3/Y; Sb/TM6, Ubx males. Irradiation. 15-18 wandering third instar larvae were collected in clean 10 mm petri plates and irradiated at 4000 rads in a TORREX120D X-ray generator (Astrophysics Research Corp, CA), set at 110kV and 5mA. The base of the petri plates was either covered with a moistened Whatmann or construction paper (to ensure that the larvae are not drying up quickly) or was without a cover. These larvae were returned to fresh food and incubated at 25°C until further experimental treatments. Calculating irradiation viability. Irradiated larvae were returned to food and incubated at 25°C and allowed to eclose. All the eclosed individuals were counted, including the ones that got stuck to the food and died. Since the flies had spread-out wings as a result of irradiation exposure and could not fly well, getting stuck to the food was a commonly observed phenomenon. Rate of irradiation viability and sex ratios were calculated. 131 PCR. Deletions of the genomic region in the corp mutants were mapped by PCR amplification of genomic DNA isolated from the adult flies of homozygous mutants. Primer sets used: FW 1: 5'CCAAGCGAACGCATCGCTG3', FW 2: 5'GAAGAGGTCATCTCCCAAGG3', RV1: 5'CTTAGGAACAATGGTTCAACC3' and RV2: 5'GCAGCCGAGGTATGGAAATC3'. Graphical methods and statistical analyses. Construction of graphs and calculations of statistical significance were performed using Prism 5.0 (Graphpad). The contingency test was used in all cases. 132 Figure 21. p535A-1-4 null mutant survives better than original laboratory y w strain following irradiation. Rate of irradiation survival was measured as the ratio of eclosed adults to total number of irradiated larvae. The graph represents percentage of viability of y w laboratory strain and p535A-1-4, with (pink) and without (yellow) irradiation (IR). The larvae were irradiated at 4000 rads. L3, number of larvae irradiated. Irradiation was performed in empty petriplates without a moistened paper. 133 134 Figure 22. y wBR stocks differ in irradiation sensitivity. The graph represents the percent viability of five background-reduced (BR) stocks in males to females, with and without irradiation exposure. Color-coding for individual categories are shown in the inset. L3, total number of larvae irradiated; N, total number of adults eclosed. P values are presented for variability of viability rates between the irradiated y wBR stocks, only where statistically significant. Larval irradiation was performed in petriplates coated with a moistened Whatmann paper. 135 136 Figure 23. The y wBR3; p535A-1-4 null mutation sensitizes organisms to irradiation. Percent viability of males (black) to females (white) in ywBR3 and ywBR3; p535A-1-4 homozygotes and heterozygotes is presented in graph. L3, total number of larvae irradiated; N, total number of adults eclosed. Larval irradiation was performed in petriplates coated with a moistened Whatmann paper. 137 138 Figure 24. corp95B mutants are sensitive to irradiation. (A) Percent viability of corp95B with and without larval exposure to irradiation (IR), in empty petriplates without a moistened paper. (B) In a second set of experiments, sex ratio of eclosed male to female progenies from four different crosses is presented in the graph. In this set, irradiation of larvae was performed on moistened paper coated petriplates. Two corp mutant lines, corp95B and corp1A, the EP-corp+ and the y wBR3 males were individually crossed to C(1)Dx/Y females, such that all the male progenies inherit the X chromosome from their dad and the female progenies receive the C(1)Dx chromosome from their mom, ensuring that any effect on irradiation viability due to the mutant or the transgenic backgrounds would remain confined only to the male progenies. Sex ratio from the nonirradiated control cross, corp95B x C(1)Dx/Y is also presented. L3, total number of larvae irradiated; N, total number of adults eclosed. Statistical significance calculated is presented in Table 8. (C-E) Identifying deleted genomic regions of corp mutants. Genomic regions of corp and its neighboring gene, CG1632, are denoted along the length of the DNA. Black rectangles: exons, black connecting line: intron. Arrow denotes the direction of transcription of the genes. corp is located within the intron of CG1632. Genomic deletions of 95B and 1A corp mutants are identified by PCR amplification of corp genomic region. Primer pairs used: FW1, RV1, and FW2, RV2. Amplified products were run on the four lanes of a gel, marked 1 through 4: (1) y w; (2) corp1A; (3) corp95B; and (4) a third corp mutant. Both primer sets fail to detect any amplicon in corp95B, while presence of an amplicon, similar in size to that of y w wildtype control, is detected in corp1A by FW2, RV2. M1 is a 1 kb ladder and M2 is the 100 bp ladder. The horizontal red arrowhead points to the size expected in the y w control. 139 P<0.0001 A. B. C. FW2 3' 5' RV1 FW1 5' RV2 3' CG1632 corp EY95B D. Fwd1, Rev1 M1 1 2 3 4 M2 E. Fwd2, Rev2 M1 1 2 3 4 M2 140 Figure 25. corp+ overexpression helps males to survive irradiation exposure. Percent viability of all the progeny classes from three different crosses (color-coded in the inset) are presented in the graph. The crosses are(1) y wBR3/Y; UAS-GFP Actin-Gal4/CyO x y wBR3 (Column 1: blue), (2) y wBR3/Y; UAS-GFP Actin-Gal4/CyO x y wBR3 EP-corp+ (Column 2: yellow), and (3) y wBR3 EP-corp+/Y x y wBR3; UAS-GFP Actin-Gal4/CyO (Column 3: pink), where corp+ is overexpressed in none of the blue progeny classes, both yellow Cy+ males and females and only pink Cy+ females. L3, total number of larvae irradiated from each cross; N, total number of adults eclosed from each cross. Data are represented as mean + SEM. Statistical significance calculated is presented in Table 8. 141 142 Table 8. Statistical significance of corp mutant or corp+ overexpressionmediated variation of irradiation survival. A. Experiment: corp mutant irradiation survival (Figure 19) Parameter compared: Proportion of eclosed males of the total larvae irradiated Crosses + IR corp95B/Y x C(1)Dx EP-corp+/Y x C(1)Dx corpiA/Y x C(1)Dx + IR EP-corp+/Y x C(1)Dx y wBR3/Y x C(1)Dx - IR corp95B/Y x C(1)Dx P<0.0001 P<0.0004 P<0.0001 P<0.0001 P>0.05 - P>0.05 - B. Experiment: corp+ overexpression irradiation survival (Figure 20) 1. Parameter compared: Proportion of eclosed Cy+ to Cy males Parameters Column 1 Column 3 Column 2 P<0.0001 P<0.0001 Column 3 P>0.05 + 2. Parameter compared: Proportion of eclosed Cy to Cy females Parameters Column 1 Column 3 Column 2 P>0.05 P>0.05 Column 3 P>0.05 + 3. Parameter compared: Proportion of Cy eclosed males of the total larvae irradiated Parameters Column 1 Column 3 Column 2 P<0.0001 P<0.0002 Column 3 P>0.05 + 4. Parameter compared: Proportion of Cy eclosed females of the total larvae irradiated Parameters Column 1 Column 3 Column 2 Column 3 P>0.05 P>0.05 P>0.05 - Note. Statistical significance is calculated between two classes of crosses or parameters, as indicated row-wise and column-wise. 143 References Hollstein, M., Sidransky, D., Vogelstein, B., and Harris, C.C. (1991). p53 mutations in human cancers. Science 253, 49-53. Jackson, S.P., and Bartek, J. (2009). The DNA-damage response in human biology and disease. Nature 461, 1071-1078. Jaklevic, B., Uyetake, L., Lemstra, W., Chang, J., Leary, W., Edwards, A., Vidwans, S., Sibon, O., and Tin Su, T. (2006). Contribution of Growth and Cell Cycle Checkpoints to Radiation Survival in Drosophila. Genetics 174, 1963-1972. Jaklevic, B.R., and Su, T.T. (2004). Relative contribution of DNA repair, cell cycle checkpoints, and cell death to survival after DNA damage in Drosophila larvae. Curr. Biol. 14, 23-32. Latonen, L., Taya, Y., and Laiho, M. (2001). UV-radiation induces dosedependent regulation of p53 response and modulates p53-HDM2 interaction in human fibroblasts. Oncogene 20, 6784-6793. Li, G., and Ho, V.C. (1998). p53-dependent DNA repair and apoptosis respond differently to high- and low-dose ultraviolet radiation. British Journal of Dermatology 139, 3-10. McNamee, L.M., and Brodsky, M.H. (2009). p53-Independent Apoptosis Limits DNA Damage-Induced Aneuploidy. Genetics 182, 423-435. Morgan, W.F., Day, J.P., Kaplan, M.I., McGhee, E.M., and Limoli, C.L. (1996). Genomic Instability Induced by Ionizing Radiation. Radiat Res 146, 247-258. Sancar, A.A., Lindsey-Boltz, L.A.L., Unsal-Kaçmaz, K.K., and Linn, S.S. (2004). Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Biochemistry 73, 39-85. Sogame, N., Kim, M., and Abrams, J.M. (2003). Drosophila p53 preserves genomic stability by regulating cell death. Proc. Natl. Acad. Sci. U.S.a. 100, 4696-4701. Titen, S.W.A., and Golic, K.G. (2008). Telomere Loss Provokes Multiple Pathways to Apoptosis and Produces Genomic Instability in Drosophila melanogaster. Genetics 180, 1821-1832. van Bergeijk, P., Heimiller, J., Uyetake, L., and Su, T.T. (2012). Genome-Wide Expression Analysis Identifies a Modulator of Ionizing Radiation-Induced p53Independent Apoptosis in Drosophila melanogaster. PLoS ONE 7, e36539. Vousden, K.H., and Lu, X. (2002). Live or let die: the cell's response to p53. Nat. Rev. Cancer. 2, 594-604. 144 Wichmann, A., Jaklevic, B., and Su, T.T. (2006). Ionizing radiation induces caspase-dependent but Chk2- and p53-independent cell death in Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.a. 103, 9952-9957. Xie, H.B., and Golic, K.G. (2004). Gene Deletions by Ends-In Targeting in Drosophila melanogaster. Genetics 168, 1477-1489. Zhou, B.-B.S., and Elledge, S.J. (2000). The DNA damage response: putting checkpoints in perspective. Nature 408, 433-439. 145 CHAPTER 6 DEFINED GENETIC PATHWAYS TO SURVIVE IRREPARABLE DNA DAMAGE: MAKING SENSE OF IT 146 Chromosomal rearrangements may promote mutation or loss or altered regulation of essential genes at or near the breakpoints and duplication or deletion would alter the gene dosage. If any of these events hinder the checkpoint or apoptotic pathway components, it would heighten the probability of survival of cells with unrepaired damage, thus precipitating the event of carcinogenesis. For example, by blocking the downstream effectors in the apoptotic pathways, the cells survive better (Colombani et al., 2006; Kurzhals et al., 2011; Peters et al., 2002; Titen and Golic, 2008). Our findings suggest that fs(1)Yb+ plays a role in eliminating cells that have lost a telomere (Chapter 4). So, if fs(1)Yb is mutated, cells with a damaged genome may continue to survive, eventually enhancing genomic instability in the organism. On the other hand, there are components that directly promote suppression of cell death and upregulation of their levels would also increase cell survival and potentiate genome instability. For instance, we demonstrated that corp+ overexpression exhibits anti-apoptosis by downregulating P53 levels (Chapter 3). We have demonstrated the existence of two distinct pathways under p53 with opposite modes of function: the hid-, reaper-mediated pro-apoptotic pathway and corp-mediated anti-apoptotic pathway. Thus, it is intriguing that p53 can induce two apparently opposing functions. Previous works have reported that the different isoforms of p53 differentially regulate apoptosis and apoptosis-induced proliferation (Dichtel-Danjoy et al., 2012). It is yet to be found out if the proapoptotic (for example, hid) and anti-apoptotic (for example, corp) effectors of p53 are also differentially regulated by the isoforms of p53. The different 147 functional consequences of P53 may also emerge from the multiple posttranslational modifications of P53, including phosphorylation, acetylation, sumoylation that participate in controlling its function (Gatz and Wiesmüller, 2006; Mauri et al., 2008). It is important to note that merely allowing cells to survive withstanding DNA damage by blocking the death inducers would not propagate a healthy living environment at the systemic level; it would affect the survival of the organism eventually through causing widespread genomic aberrations. In support, we found, similar to that reported previously (Jaklevic et al., 2006; Jaklevic and Su, 2004), that p53 mutants are more sensitive to exposure to irradiation (Chapter 5). Even though p53+-mediated apoptosis is blocked in these organisms, the load of an unstable genome, produced by blocking p53+-mediated DNA repair, drives them to eventually die through aneuploidy-mediated and other p53-independent cell-death mechanisms (McNamee and Brodsky, 2009; Titen and Golic, 2008; van Bergeijk et al., 2012; Wichmann et al., 2006). So, some mode of permanently stemming the damaged DNA is desired to survive the loss. This can be achieved by a third way where cells add a new telomere complex to the broken end, which cannot be otherwise repaired. Irreparably broken ends in the germline have been previously shown to be fixed by means of this mechanism in the male germline of Drosophila (Ahmad and Golic, 1998; Titen and Golic, 2010). In fact, seminal works by Barbara McClintock in the germline of maize showed that when a broken chromosome was delivered by the sperm to the egg, the breakage-fusion-bridge cycle continued in the endosperm 148 but ceased in the zygote, where it behaved as though it was healed at the broken end (McClintock, 1941). De novo telomere addition was also reported as a mechanism to rescue cells in yeast induced with dicentric-mediated chromosome break (Jager and Philippsen, 1989). The analogy between McClintock's findings in plant with that in yeast and Drosophila is quite obvious and a parallel to these phenomena is observed in mammals in the context of functional telomerase expression in the germline, suggesting that a telomere can be reconstituted at the broken end (Gao et al., 2008; Shay and Wright, 2001). The intervening steps between generation of a broken chromosome in the germline and recovery of a healed chromosome in the progeny are only partially characterized. Unpublished work from our lab by Dr. Rebeccah Kurzhals characterized a gene, hiphop, that plays a distinct role in inducing de novo telomere addition, resulting in suppression of apoptotic phenotype in the BARTL assay and highly increasing the rate of broken-and-healed chromosome transmission through the germline. As for the existence of the chromosome healing pathway in the soma, initial works reported the addition of new telomeres at the end of double-strand breaks in mouse embryonic stem cells and terminally deleted chromosomes in human lymphoblastoid cells lines (Flint et al., 1994; Sprung et al., 1999). However, telomerase was active in both the stem cells and tumor-derived cell line, which played a role in reconstituting the telomeric end. Some preliminary works in Drosophila show the possibility of somatic existence of chromosome healing (Sergio Pimpinelli, personal communication). Moreover, the fact that hiphop+ produces wildtype-like eyes in the BARTL assay also supports the theory of 149 somatic de novo telomere addition. However, chromosome healing in the soma has not yet been well established or documented. Nevertheless, aberrant addition of de novo telomeres at broken, nontelomeric ends of chromosomes can also be proved deleterious by hindering DNA repair and leading to aneuploidy. Studies in yeast have shown that ATR mediates repression of telomerase function in response to DNA DSBs (Makovets and Blackburn, 2009; Zhang and Durocher, 2010). Following extensive cell death, tissue recovery can also be mediated through compensatory proliferation of the neighboring cells triggered by the apoptotic cells, so that the organism can survive without compromising development. The longer that dying cells persist, the greater is the signal for compensatory proliferation to the surrounding cells. To date, multiple groups have reported the phenomenon of apoptosis-induced compensatory proliferation (Fan and Bergmann, 2008; Huh et al., 2004; Ryoo et al., 2004; Warner et al., 2010; Wells et al., 2006), although it is mostly the surrounding unaffected cells that proliferate to make up for the dead cells. Recent results demonstrated that dying cells signal other cells at their vicinity to become resistant to radiationinduced cell death by activation of an anti-apoptotic microRNA (Bilak et al., 2014). All these processes preserve tissue integrity and hence organismal survival. 150 Cell fate decisions: an important juncture At the end, our findings, together with those previously reported by others, point to the fact that there are defined pathways that control the cell fate decisions following irreparable damage, both towards living and towards dying. So now the question is what are the deciding factors of a cell's ultimate destiny? The answer appears to lie in the tight control of a very complex gene regulatory network. My results can be encompassed to implicate multiple genes and levels of control in the regulation of recovery from tissue damage (Figure 26). Following telomere loss, the ATM and Chk2 activate p53 to induce apoptosis. P53 also induces corp that acts on it in a negative feedback loop to protect the tissue from the deleterious effect of excessive cell death. The fs(1)Yb+ plays a role in transposon silencing by ensuring the precise localization of Piwi and Armi proteins and piRNA generation. Telomere integrity has been found to be disrupted, probably through transposon desilencing in piwi pathway mutants, which also activates DDR genes (Chen et al., 2007; Khurana et al., 2010; Klattenhoff et al., 2007). Thus, it might look intriguing that being an upstream component, fs(1)Yb+, when overexpressed induces DDR phenotype, like piwi pathway mutants. This can be explained by the hypothesis that an optimum level of Fs(1)Yb is necessary for correct localization and function of Armi and Piwi, and that both an upregulation and a downregulation would disrupt the protein localization process and produce similar disintegrated chromosome ends to trigger DDR. This possibility is open to investigation. It is also yet to be found out where exactly does the fs(1)Yb feed into the DDR pathway. Since we found that 151 corp+ is epistatic to fs(1)Yb+, fs(1)Yb should be somewhere upstream to it, probably inducing a p53-dependent cell death. The apoptotic delay caused by corp may provide a window for allowing de novo telomere addition (for instance, by hiphop activation) or triggering compensatory cell proliferation pathway. Thus, putting in a nutshell, it is essential that all these components must interact properly to ensure that healthy cells are encouraged and allowed to proliferate, and cells with damaged genomes are eliminated. An integral part of recovering from tissue injury is a tight balance: the intrinsic capability to repair and regenerate without succumbing to massive cell death, but not totally blocking cells from dying and accumulating damaged genome at the same time. For example, downstream of P53, upregulation of hid-, reaper-mediated apoptosis will lead to decreased survival and upregulation of corp-mediated anti-apoptosis will lead to over-proliferation and may sustain cells with an unstable genome. Thus, fine-tuning of closely controlled pathways with opposite functional consequences is essential. This limits the accumulation of defective cells and helps maintain the tissue homeostasis. 152 Figure 26. A model of pathways that determine cell fate following irreparable DNA damage. Following induction of a single telomere loss, ATM phosphorylates and activates, which in turn, activates P53. P53 transcriptionally activates genes (grim, hid, reaper, sickle) that induce apoptosis and corp that inhibits apoptosis, by acting on P53 in a negative feedback loop. The proapoptotic and anti-apoptotic are finely balanced, and their over-activation (denoted by two red-arrows) can respectively lead to decreased organismal survival due to massive cell-death and over-proliferation of genes with an unrepaired genome, probably leading to oncogenic transformation. corpmediated inhibition and delay of apoptosis gives the cells an extended duration for triggering compensatory proliferation and de novo telomere addition (as mediated by hiphop). A second aneuploidy-driven, P53-independent JNKmediated pathway also triggers apoptosis. The fs(1)Yb gene plays a role in recruitment and proper localization of piwi pathway proteins (piwi and armi) for transposon silencing, that is important for maintenance of telomere integrity. It is yet to be found out where exactly it feeds into the DDR pathway. As our results indicate, it acts upstream of p53, probably inducing ATM or Chk2 or p53 itself, or even acting as an inducer of DNA damage by disrupting telomere integrity. 153 Telomere loss Causes DNA damage? fs(1)Yb ? ATM Aneuploidy ? armi and piwi localization Chk2 JNK ? Transposon silencing p53 Telomere maintenance hid, reaper, grim, sickle corp Anti-apoptosis Apoptosis Delay in apoptosis, Cell survival Reduces organismal survival Overproliferation Compensatory cell proliferation De novo telomere addition (hiphop) 154 References Ahmad, K., and Golic, K.G. (1998). The transmission of fragmented chromosomes in Drosophila melanogaster. Genetics 148, 775-792. Bilak, A., Uyetake, L., and Su, T.T. (2014). Dying cells protect survivors from radiation-induced cell death in Drosophila. PLoS Genet 10, e1004220. Chen, Y.Y., Pane, A.A., and Schüpbach, T.T. (2007). cutoff and aubergine Mutations Result in Retrotransposon Upregulation and Checkpoint Activation in Drosophila. Curr. Biol. 17, 6-6. Colombani, J., Polesello, C., Josué, F., and Tapon, N. (2006). Dmp53 activates the Hippo pathway to promote cell death in response to DNA damage. Curr. Biol. 16, 1453-1458. Dichtel-Danjoy, M.-L., Ma, D., Dourlen, P., Chatelain, G., Napoletano, F., Robin, M., Corbet, M., Levet, C., Hafsi, H., Hainaut, P., et al. (2012). Drosophila p53 isoforms differentially regulate apoptosis and apoptosis-induced proliferation. 19, 451-460. Fan, Y., and Bergmann, A. (2008). Distinct Mechanisms of Apoptosis-Induced Compensatory Proliferation in Proliferating and Differentiating Tissues in the Drosophila Eye. Developmental Cell 14, 399-410. Flint, J.J., Craddock, C.F.C., Villegas, A.A., Bentley, D.P.D., Williams, H.J.H., Galanello, R.R., Cao, A.A., Wood, W.G.W., Ayyub, H.H., and Higgs, D.R.D. (1994). Healing of broken human chromosomes by the addition of telomeric repeats. Am J Hum Genet 55, 505-512. Gao, Q., Reynolds, G.E., Wilcox, A., Miller, D., Cheung, P., Artandi, S.E., and Murnane, J.P. (2008). Telomerase-dependent and -independent chromosome healing in mouse embryonic stem cells. DNA Repair (Amst) 7, 17-17. Gatz, S.A., and Wiesmüller, L. (2006). p53 in recombination and repair. Cell Death Differ 13, 1003-1016. Huh, J.R., Guo, M., and Hay, B.A. (2004). Compensatory Proliferation Induced by Cell Death in the Drosophila Wing Disc Requires Activity of the Apical Cell Death Caspase Dronc in a Nonapoptotic Role. Current Biology 14, 1262-1266. Jager, D., and Philippsen, P. (1989). Stabilization of dicentric chromosomes in Saccharomyces cerevisiae by telomere addition to broken ends or by centromere deletion. The EMBO Journal 8, 247-254. Jaklevic, B., Uyetake, L., Lemstra, W., Chang, J., Leary, W., Edwards, A., Vidwans, S., Sibon, O., and Tin Su, T. (2006). Contribution of Growth and Cell Cycle Checkpoints to Radiation Survival in Drosophila. Genetics 174, 1963-1972. 155 Jaklevic, B.R., and Su, T.T. (2004). Relative contribution of DNA repair, cell cycle checkpoints, and cell death to survival after DNA damage in Drosophila larvae. Curr. Biol. 14, 23-32. Khurana, J.S., Xu, J., Weng, Z., and Theurkauf, W.E. (2010). Distinct Functions for the Drosophila piRNA Pathway in Genome Maintenance and Telomere Protection. PLoS Genet 6, e1001246. Klattenhoff, C.C., Bratu, D.P.D., McGinnis-Schultz, N.N., Koppetsch, B.S.B., Cook, H.A.H., and Theurkauf, W.E.W. (2007). Drosophila rasiRNA Pathway Mutations Disrupt Embryonic Axis Specification through Activation of an ATR/Chk2 DNA Damage Response. Developmental Cell 12, 11-11. Kurzhals, R.L., Titen, S.W.A., Xie, H.B., and Golic, K.G. (2011). Chk2 and p53 are haploinsufficient with dependent and independent functions to eliminate cells after telomere loss. PLoS Genet 7, e1002103-e1002103. Makovets, S., and Blackburn, E.H. (2009). DNA damage signalling prevents deleterious telomere addition at DNA breaks. Nat Cell Biol 11, 1383-1386. Mauri, F., McNamee, L.M., Lunardi, A., Chiacchiera, F., Del Sal, G., Brodsky, M.H., and Collavin, L. (2008). Modification of Drosophila p53 by SUMO Modulates Its Transactivation and Pro-apoptotic Functions. Journal of Biological Chemistry 283, 20848-20856. McClintock, B. (1941). The Stability of Broken Ends of Chromosomes in Zea Mays. Genetics 26, 234-282. McNamee, L.M., and Brodsky, M.H. (2009). p53-Independent Apoptosis Limits DNA Damage-Induced Aneuploidy. Genetics 182, 423-435. Peters, M., DeLuca, C., Hirao, A., Stambolic, V., Potter, J., Zhou, L., Liepa, J., Snow, B., Arya, S., Wong, J., et al. (2002). Chk2 regulates irradiation-induced, p53-mediated apoptosis in Drosophila. Proc Natl Acad Sci USA 99, 11305- 11310. Ryoo, H.D., Gorenc, T., and Steller, H. (2004). Apoptotic cells can induce compensatory cell proliferation through the JNK and the Wingless signalingpathways. Developmental Cell 7, 491-501. Shay, J.W., and Wright, W.E. (2001). Telomeres and Telomerase: Implications for Cancer and Aging. Radiat Res 155, 188-193. Sprung, C.N.C., Reynolds, G.E.G., Jasin, M.M., and Murnane, J.P.J. (1999). Chromosome healing in mouse embryonic stem cells. Proc. Natl. Acad. Sci. U.S.a. 96, 6781-6786. Titen, S.W.A., and Golic, K.G. (2008). Telomere Loss Provokes Multiple 156 Pathways to Apoptosis and Produces Genomic Instability in Drosophila melanogaster. Genetics 180, 1821-1832. Titen, S.W.A., and Golic, K.G. (2010). Healing of euchromatic chromosome breaks by efficient de novo telomere addition in Drosophila melanogaster. Genetics 184, 309-312. van Bergeijk, P., Heimiller, J., Uyetake, L., and Su, T.T. (2012). Genome-Wide Expression Analysis Identifies a Modulator of Ionizing Radiation-Induced p53Independent Apoptosis in Drosophila melanogaster. PLoS ONE 7, e36539. Warner, S.J., Yashiro, H., and Longmore, G.D. (2010). The Cdc42/Par6/aPKC Polarity Complex Regulates Apoptosis-Induced Compensatory Proliferation in Epithelia. Current Biology 20, 677-686. Wells, B.S., Yoshida, E., and Johnston, L.A. (2006). Compensatory Proliferation in Drosophila Imaginal Discs Requires Dronc-Dependent p53 Activity. Current Biology 16, 1606-1615. Wichmann, A., Jaklevic, B., and Su, T.T. (2006). Ionizing radiation induces caspase-dependent but Chk2- and p53-independent cell death in Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.a. 103, 9952-9957. Zhang, W., and Durocher, D. (2010). De novo telomere formation is suppressed by the Mec1-dependent inhibition of Cdc13 accumulation at DNA breaks. Genes & Development 24, 502-515. APPENDIX A EP SCREEN DATASHEET 158 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 14818 14 0 0 1 0 0 14821 0 0 0 0 18 0 14830 8 0 5 10 0 0 14833 4 0 0 3 0 0 14841 8 0 0 2 0 0 14846 8 0 1 5 0 0 14851 5 0 1 8 0 0 14854 - - - - - - 14862 5 0 2 7 0 0 14865 - - - - - - 14866 7 - - - - - 14995 18 0 2 0 0 0 15002 8 0 5 1 0 0 15004 - - - - - - 15008 - - - - - - 15037 - - - - - - 15038 8 0 7 43 - - 15044 6 0 0 5 0 0 15049 - - - - - - 15058 28 0 0 1 0 0 suppressor 159 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 15060 5 0 1 1 0 0 15065 8 1 0 0 0 0 15083 14 0 0 0 0 0 15087 18 0 2 3 0 0 15299 10 0 2 0 0 0 15300 12 0 1 7 0 0 15305 35 0 2 3 0 0 15318 18 0 4 0 0 0 15324 9 0 6 2 0 0 15347 17 0 0 7 0 0 15349 5 0 2 10 0 0 15361 17 0 1 8 0 0 15368 6 0 0 0 0 0 15386 9 0 2 8 0 0 15388 10 0 0 0 0 0 15389 8 0 10 12 0 0 15392 19 0 1 2 0 0 15393 5 0 2 0 0 0 15394 4 0 1 0 0 0 15395 4 0 2 14 0 0 160 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 15397 9 0 2 1 0 0 15398 24 0 0 0 0 0 15400 7 0 3 8 0 0 15401 6 0 0 8 0 0 15407 4 0 2 7 0 0 15410 9 0 0 0 0 0 15411 12 0 0 4 0 0 15412 13 0 2 10 0 0 15414 15 0 1 3 0 0 15416 8 0 0 4 0 0 15419 11 0 3 5 0 0 15425 - - - - - - 15431 7 0 4 6 0 0 15432 18 0 3 5 0 0 15434 11 0 0 3 0 0 15436 11 0 2 4 0 0 15438 12 0 7 4 0 0 15439 11 1 0 0 0 0 15444 12 0 4 1 0 0 15445 15 0 7 3 0 0 161 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 15448 11 0 2 2 0 0 15449 11 0 1 0 0 0 15450 12 0 4 2 0 0 15459 4 0 0 0 0 0 15472 - - - - - - 15490 20 - - 5 - - 15492 11 0 5 1 0 0 15497 11 0 1 2 0 0 15500 14 0 4 1 0 0 15528 7 0 0 2 0 0 15529 7 0 2 5 0 0 15541 12 0 10 2 0 0 15543 15 0 0 3 0 0 15544 8 0 12 8 0 0 15577 19 0 2 4 0 0 15592 10 0 2 4 0 0 15595 8 0 4 7 0 0 15623 16 0 7 1 0 0 15634 14 0 0 3 0 0 15637 8 0 11 29 0 0 162 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 15646 8 0 0 0 0 0 15647 22 0 4 2 0 0 15650 0 0 0 0 0 18 15653 5 0 0 6 0 0 15662 8 0 12 18 0 0 15669 14 0 3 3 0 0 15673 8 0 4 2 0 0 15675 6 0 5 0 0 0 15677 5 0 3 0 0 0 15679 18 0 1 8 0 0 15681 6 0 5 7 0 0 15688 12 0 2 5 0 0 15689 1 0 1 3 0 0 15690 12 0 2 5 0 0 15701 12 0 0 2 0 0 15702 4 0 0 10 0 0 15703 15 0 10 12 0 0 15704 5 0 0 5 0 0 15705 18 0 7 6 0 0 15713 - - - - - - suppressor 163 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 15715 9 0 12 16 0 0 15724 20 0 6 2 0 0 15725 - - - - - - 15726 22 0 4 9 0 0 15734 8 0 10 2 0 0 15742 1 0 0 0 15 0 15744 7 0 0 4 0 0 15748 14 0 4 2 0 0 15755 19 0 9 3 0 0 15765 0 0 2 6 0 0 15769 22 0 2 4 0 0 15778 0 18 9 2 0 0 15779 16 0 3 7 0 0 15783 16 0 7 0 0 0 15784 12 0 8 11 0 0 15788 25 0 6 5 0 0 15790 19 0 1 2 0 0 15791 - - - - - - 15795 16 0 16 1 0 0 15806 12 0 0 1 0 0 suppressor enhancer 164 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 15811 21 0 9 4 0 0 15829 7 0 5 6 0 0 15830 6 0 9 1 0 0 15836 34 0 9 2 0 0 15844 25 0 7 6 0 0 15862 22 0 1 7 0 0 15870 22 0 15 1 0 0 15872 - - - - - - 15876 - - - - - - 15877 - - - - - - 15879 15 0 2 6 0 0 15881 2 0 1 0 0 0 15883 35 0 7 22 0 0 15885 19 - 4 0 0 0 15886 8 0 0 5 0 0 15887 12 0 3 2 0 0 15888 31 0 6 3 0 0 15894 0 12 1 0 0 0 15896 12 0 0 3 0 0 Females also have small, rough eyes 165 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 15898 11 0 1 1 0 0 15899 - - - - - - 15901 - - - - - - 15920 - - - - - - 15934 11 0 0 1 0 0 15937 18 0 0 4 0 0 15939 7 0 5 2 0 0 15941 12 0 17 0 0 0 15945 5 0 6 9 0 0 15954 9 0 5 1 0 0 15977 11 0 4 3 0 0 16003 7 0 0 3 0 0 16008 11 0 6 3 0 0 16363 8 0 2 5 0 0 16373 12 0 10 11 0 0 16374 5 0 7 7 0 0 16381 8 0 3 1 0 0 16383 14 0 8 2 0 0 16384 7 0 0 1 0 0 16385 7 0 8 3 0 0 166 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 16388 34 0 5 4 0 0 16393 0 0 15 0 0 0 16394 28 0 16 4 0 0 16400 10 0 0 0 0 0 16404 5 0 0 0 0 0 16443 - - - - - - 16537 12 0 8 10 0 0 16538 7 0 0 2 0 0 16617 5 29 18 0 0 0 16626 8 0 2 2 0 0 16633 8 0 2 1 0 0 16635 6 0 9 0 0 0 16640 7 0 0 0 0 0 16642 - - - - - - 16645 8 0 2 4 0 0 16648 11 0 0 5 0 0 16650 12 0 0 4 0 0 16660 10 0 7 2 0 0 16670 14 0 1 0 0 0 Females also have small eyes enhancer 167 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 16684 9 0 0 2 0 0 16685 9 0 1 2 0 0 16686 24 0 5 1 0 0 16691 9 0 0 1 0 0 16693 20 0 6 0 0 0 16708 9 0 0 4 0 0 16719 4 0 4 38 0 0 16726 10 0 0 0 0 0 16733 9 0 0 0 0 0 16734 15 0 3 8 0 0 16739 21 1 4 0 0 0 16752 9 0 1 4 0 0 16763 0 0 0 0 0 0 16771 9 0 0 0 0 0 16772 8 0 1 2 0 0 16779 12 0 0 4 0 0 16781 15 0 0 6 0 0 16782 21 0 6 3 0 0 16785 10 1 0 0 0 0 15 Cy+ males, 8 Cy+ and 9 Cy females 168 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 16786 3 0 1 2 0 3 16789 3 0 1 0 0 0 16796 15 0 5 2 0 0 16803 14 0 5 1 0 0 16809 7 0 1 2 0 0 16811 16 0 3 0 0 0 16813 6 0 0 0 0 0 16817 22 0 3 2 0 0 16824 14 0 1 2 0 0 16827 11 0 5 1 0 0 16835 7 0 0 0 0 0 16836 18 0 3 2 0 0 16858 0 18 0 0 0 0 16859 16 0 1 0 0 0 16862 16 0 6 1 0 0 16866 10 0 2 2 0 0 16877 7 0 22 0 0 0 16884 11 0 4 1 0 0 16889 12 0 3 2 0 0 16891 5 0 0 4 0 0 No Cy+ females 169 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 16892 14 0 5 1 0 0 16897 15 0 0 4 0 0 16907 10 0 6 2 0 0 16912 11 0 3 1 0 0 16913 14 0 2 1 0 0 16915 12 0 2 0 0 0 16918 9 0 3 4 0 0 16923 16 0 2 4 0 0 16926 5 0 3 7 0 0 16939 18 0 3 2 0 0 16940 3 0 0 1 0 0 16945 6 0 0 0 19 0 16946 8 0 2 6 0 0 16955 10 0 2 2 0 0 16959 15 0 1 0 0 0 16963 9 0 5 2 0 0 16965 7 0 0 1 0 0 16976 17 0 4 0 0 0 16977 5 0 1 0 0 0 17303 9 0 0 5 0 0 suppressor 170 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 17319 8 0 0 0 0 0 17330 10 0 2 4 0 0 17331 14 0 6 1 0 0 17338 19 0 8 1 0 0 17343 10 0 1 2 0 0 17347 2 0 0 3 0 0 17348 12 0 2 0 0 0 17353 17 0 4 0 0 0 17354 - - - - - - 17355 14 0 3 0 0 0 17357 12 0 9 0 71 0 17358 18 0 9 6 0 0 17361 23 0 16 14 0 0 17363 - - - - - - 17373 11 0 5 8 0 0 17376 9 0 7 4 0 0 17377 15 0 11 7 0 0 17378 16 0 11 12 0 0 17380 0 - 0 0 0 0 17381 6 0 18 2 0 0 suppressor ? ?? 171 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 17386 14 0 12 0 0 0 17395 19 0 15 0 0 0 17397 15 0 17 14 0 0 17403 8 0 2 5 0 0 17411 7 0 11 9 0 0 17416 19 0 5 1 0 0 17420 16 0 18 21 0 0 17439 7 0 8 9 0 0 17440 12 0 10 9 0 0 17443 4 0 7 9 0 0 17445 19 0 14 9 0 0 17447 10 0 8 2 0 0 17453 22 0 3 2 0 0 17455 19 0 13 8 0 0 17458 19 0 9 11 0 0 17477 17 0 16 20 0 0 17478 12 0 7 9 0 0 17482 11 0 8 9 0 0 17491 27 0 22 0 0 0 17494 16 0 5 2 0 0 172 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 17496 5 0 3 32 0 0 17497 15 0 4 0 0 0 17507 16 0 0 24 0 0 17509 14 0 14 3 0 0 17512 8 0 1 0 6 0 17529 17 0 4 0 0 40 17535 10 0 12 5 0 0 17541 12 0 9 6 0 0 17544 17 0 4 7 0 0 17545 - - - - - - 17549 11 0 10 2 0 0 17557 8 0 3 6 0 0 17560 10 0 5 0 0 0 17563 51 0 1 8 0 0 17565 10 0 0 2 0 0 17566 8 0 5 2 0 0 17571 11 0 3 0 0 0 17585 12 0 0 3 0 0 17590 15 0 11 0 33 0 17592 22 0 0 15 0 0 suppressor ? suppressor ? suppressor ? 173 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 17596 11 0 7 9 0 0 17598 2 0 4 2 0 0 17602 8 0 0 6 0 0 17604 21 0 18 12 0 0 17606 12 0 0 8 0 0 17608 - - - - - - 17609 18 0 9 11 0 0 17613 19 0 8 9 0 0 17616 - - - - - - 17631 12 0 11 9 0 0 17648 4 0 12 0 0 0 17674 0 0 0 0 0 104 19646 22 0 14 12 0 0 19666 16 0 0 0 0 0 19685 19 0 11 14 0 0 19689 24 0 0 0 0 0 19697 18 0 0 0 0 0 19717 19 0 6 2 0 0 19730 8 0 11 4 0 0 19731 12 0 4 1 0 0 suppressor 174 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 19732 22 0 0 0 0 0 19733 21 0 18 11 0 0 19744 11 0 7 2 0 0 19773 31 0 12 11 0 0 19779 25 0 0 0 0 0 19797 17 0 3 8 0 0 19802 3 0 4 1 0 0 19817 8 0 5 1 0 0 19822 22 0 11 9 0 0 19823 15 0 8 2 0 0 19833 11 0 4 0 0 0 19839 18 0 8 6 0 0 19866 13 0 7 2 0 0 19892 16 0 8 2 0 0 19898 2 0 1 9 0 0 19900 14 0 11 5 0 0 19902 6 0 4 0 0 0 19934 15 0 8 2 0 0 19942 16 0 1 0 27 0 19943 11 0 5 2 0 0 suppressor ? 175 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 19947 17 0 12 9 0 0 19949 5 0 7 2 0 0 19950 12 0 8 9 0 0 19954 - - - - - - 19957 17 0 8 7 0 0 19963 24 0 0 0 0 0 19964 19 0 13 11 0 0 19969 7 0 9 2 0 0 19976 8 0 12 6 0 0 19990 15 0 11 8 0 0 20005 12 0 7 5 0 0 20006 0 0 8 0 0 0 20010 32 0 0 14 0 0 20011 19 0 0 0 0 0 20024 23 0 17 14 0 0 20044 15 0 8 0 12 0 20065 0 0 0 2 0 0 20069 7 0 9 3 0 0 20074 12 0 9 6 0 0 20077 7 0 1 4 0 0 inducer? 176 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 20101 5 0 1 1 0 0 20116 3 0 1 1 0 0 20118 14 0 12 10 0 0 20126 13 0 0 9 0 0 20144 19 0 14 12 0 0 20177 9 0 0 2 0 0 20194 21 0 16 0 0 0 20197 12 0 4 7 0 0 20216 7 0 1 4 0 0 20217 17 0 0 12 0 0 20218 24 0 21 0 0 0 20256 22 0 0 21 0 0 20257 18 0 11 14 0 0 20258 9 0 5 0 58 0 20269 18 0 8 3 0 0 20294 13 0 11 9 0 0 20295 9 0 4 3 0 0 20297 12 0 0 14 0 0 20299 17 0 `5 0 0 0 20317 6 0 0 1 0 0 suppressor ? 177 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 20318 19 0 0 23 0 0 20320 6 0 12 9 0 0 20325 13 0 0 11 0 0 20337 8 0 0 9 0 0 20340 18 0 12 14 0 0 20348 8 0 7 0 0 0 20628 6 0 0 0 17 0 20635 7 0 0 0 0 0 20642 - - - - - - 20654 19 0 14 08 0 0 20666 17 0 0 0 0 0 20667 9 0 4 3 0 0 20668 16 0 0 7 0 0 20674 5 0 2 0 0 0 20682 12 0 8 0 0 0 20687 8 0 6 8 0 0 20693 12 0 9 0 0 0 20697 9 0 0 0 0 0 20705 19 0 6 9 0 0 20717 12 0 0 14 0 0 178 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 20718 11 0 3 1 0 0 20720 12 0 5 9 0 0 20721 12 0 5 0 0 0 20723 12 0 11 8 0 0 20733 15 0 9 8 0 0 20742 8 0 0 9 0 0 20745 21 0 0 9 0 0 20786 17 0 16 4 0 0 20792 9 0 2 5 0 0 20793 24 0 0 0 0 0 20798 23 0 3 2 0 0 20807 14 0 4 8 0 0 20816 17 0 0 8 0 0 20817 17 0 10 0 0 0 20827 3 0 3 0 0 0 20833 3 0 2 0 0 0 20847 14 0 6 5 0 0 20849 8 0 0 1 0 0 20856 - - - - - - 20857 12 0 9 6 0 0 179 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 20858 14 0 5 8 0 0 20861 - - - - - - 20881 6 0 0 4 0 0 20884 4 0 0 0 0 0 20885 14 0 4 38 0 0 20917 8 0 9 14 0 0 20923 12 0 3 0 0 0 20924 12 0 0 9 0 0 20936 11 0 0 7 0 0 20940 21 0 0 18 0 0 20944 15 0 0 9 0 0 20948 6 0 0 2 0 0 20951 10 0 0 8 0 0 20952 9 0 0 5 0 0 20961 12 0 0 14 0 0 20963 9 0 1 0 0 0 20964 14 0 6 2 0 0 21081 17 0 0 12 0 0 21084 3 0 4 2 0 0 21097 10 0 0 0 0 0 180 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 21098 18 0 14 0 0 0 21100 6 0 3 2 0 0 21102 11 0 3 1 0 0 21103 15 0 0 5 0 0 21105 0 - 0 0 0 0 21111 - - - - - - 21112 21 0 17 12 0 0 21113 14 0 8 9 0 0 21131 15 0 0 5 0 0 21133 17 0 5 3 0 0 21142 0 0 0 1 0 0 21146 11 0 0 0 0 0 21151 4 0 0 5 0 0 21153 12 0 6 5 0 0 21169 6 0 11 0 0 0 21170 2 0 14 1 0 0 21184 12 0 5 8 0 0 21189 9 0 5 8 0 0 21192 0 12 8 2 0 0 21198 8 0 7 9 0 0 No Cy males too 181 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 21199 - - - - - - 21202 12 0 7 0 0 0 21210 8 0 2 5 0 0 21211 14 0 7 0 0 0 21222 15 0 12 0 0 0 21230 8 0 4 5 0 0 21233 12 0 9 0 0 0 21235 18 0 0 0 0 0 21353 23 0 19 3 0 0 21368 24 0 19 0 0 0 21375 18 0 6 0 0 0 21377 16 0 1 0 0 0 21380 11 0 0 0 0 0 21387 12 0 9 0 0 0 21388 11 0 8 0 0 0 21404 11 0 1 0 0 0 21419 9 0 0 4 0 0 21420 10 0 5 4 0 0 21423 12 0 7 16 0 0 21424 18 0 11 9 0 0 182 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 21426 15 0 8 6 0 0 21427 7 0 0 0 0 0 21428 8 0 9 7 0 0 21429 - - - - - - 21430 9 0 0 8 0 0 21436 11 0 8 0 0 0 21438 12 0 0 0 0 0 21451 17 0 12 13 0 0 21955 11 0 5 0 0 0 22137 12 0 5 0 0 0 22151 3 0 7 12 0 0 22288 22 0 12 9 0 0 22292 9 0 6 2 0 0 22294 14 0 0 6 0 0 22295 - - - - - - 22321 12 0 6 0 0 0 22324 17 0 0 17 0 0 22326 3 0 1 0 0 0 22337 12 0 9 7 0 0 22338 9 0 7 5 0 0 183 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 22339 4 0 11 3 0 0 22351 3 0 0 5 0 0 22353 8 0 1 2 0 0 22354 11 0 0 3 0 0 22355 20 0 2 1 0 0 22356 10 0 1 9 0 0 22365 14 0 10 1 0 0 22371 12 0 0 2 0 0 22372 4 0 2 1 0 0 22402 7 0 5 8 0 0 22403 6 0 0 1 0 0 22410 0 5 2 0 0 0 22412 11 0 4 2 0 0 22432 11 0 2 8 0 0 22433 9 0 3 3 0 0 22434 - - - - - - 22439 1 0 0 5 0 0 72 Cy males, 24 Cy+ females (smaller rough eyes): Gene seems to effect eye and bristle. 184 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 22450 11 0 5 4 0 0 22457 5 0 6 4 0 0 22458 24 0 5 6 0 0 22463 6 0 8 3 0 0 22465 10 0 0 0 0 0 22483 6 0 1 2 0 0 22488 5 0 5 2 0 0 22490 - - - - - - 22492 14 0 4 0 0 0 22494 16 0 3 0 0 0 22519 14 0 8 10 0 0 22524 9 0 0 1 0 0 22534 - - - - - - 22536 8 0 0 4 0 0 22549 - - - - - - 22552 - - - - - - 22571 19 0 2 1 0 0 22572 6 0 6 3 0 0 22573 9 0 0 1 0 0 22576 1 0 8 0 0 0 inducer? 185 Cy+ male eye phenotype Stock Notes BS 1 2 3 4 5 22593 9 0 2 2 0 0 22594 10 0 9 7 0 0 22596 22 0 9 2 0 0 22627 - - - - - - 22634 9 0 0 6 0 0 22637 16 0 5 4 0 0 22643 11 0 0 1 0 0 22645 4 0 4 1 0 0 22646 6 0 0 1 0 0 22647 6 0 4 2 0 0 22660 4 0 1 3 0 0 23105 15 0 0 0 0 0 23109 10 0 1 1 0 0 23119 15 0 1 1 0 0 24091 7 0 2 1 0 0 24093 10 0 0 1 0 0 24095 10 0 4 0 0 0 24458 0 0 8 28 0 0 24795 15 0 0 0 0 0 17506 - - - - - - suppressor ? 186 Cy+ male eye phenotype Stock 21079 Notes BS 1 2 3 4 5 5 0 2 2 0 0 APPENDIX B CONSTRUCTED STOCKS 188 y w/H1; P{Gal4-ey.H}4.8 P{UAS-FLP1.D}JD1 or eGUF4.8JD1/SM1, Cy y w/Y; P{Gal4-ey.H}4.8 P{UAS-FLP1.D}JD1 or eGUF4.8JD1/SM1, Cy y w/H1; P{Gal4-ey.H}4.8 {UAS-FLP}2B or eGUF4.82B/SM1, Cy y w EP-corp+; Sco/s2CyO y w EP-corp+; Sb/TM6, Ubx y w EP-corp+; 70FLP10/s2CyO y w EP-corp+; EP-Chk2+/s2CyO y w EP-corp+; {UAS-p53}2/s2CyO y w EP-corp+; {GMR-Gal4}/s2CyO y w EP-corp+; p535A-1-4/TM6, Ubx y w; UAS-corpA1 y w; Sp/SM1, Cy; UAS-corpA1/TM3, Sb corp95B; Sco/s2CyO corp95B; UAS-corpA1/TM6, Ubx corp95B; nanos-Gal4 UAS-FLP95/TM6, Ubx EP-fs(1)Yb+; Sco/s2CyO EP-fs(1)Yb+; 70FLP10/s2CyO EP 15778; HRH00A1/s2CyO EP 16617; Sb/TM6, Ubx y w UAS-hid; Sco/s2CyO y w; UAS-rpr/SM1, Cy; p535A-1-4/TM6B, Tb y w; GMR-Gal4/SM1, Cy; p535A-1-4/TM6B, Tb y wBR3 189 y wBR8 y wBR9 y wBR3, EP-corp+ y wBR3; Actin5C-Gal4 UAS-GFP/SM1, Cy y wBR3; p535A-1-4