Multilocus Mitochondrial Mutations Do Not Directly Affect the Efficacy of Gene Therapy for Leber Hereditary Optic Neuropathy

Purpose: Clinical trials of gene therapy for Leber hereditary optic neuropathy (LHON) were conducted in 9 volunteers with the mitochondrial mutation, G11778A in ND4. The purpose of this study was to investigate whether multilocus mitochondrial mutations directly influence the efficacy of gene therapy for LHON. Methods: Nine volunteers with LHON participated in a clinical trial with intravitreal injection of an adenoviral vector expressing wild-type ND4. Patients were subsequently divided into 2 groups: according to the differences in therapy efficacy and based on improvements in visual acuity. Full mitochondrial DNA sequences of the 2 groups of patients were generated and compared using PubMed, PolyPhen, and PROVEAN. Furthermore, the association between the detected mutations and clinical effects of gene therapy was analyzed. Results: Best-corrected visual acuity (BCVA) significantly improved (≥0.3 log of minimum angle of resolution [logMAR]) in 7 patients 6 months after gene therapy, whereas there was no significant change in BCVA (<0.3 logMAR) of the remaining 2 patients. All 9 patients carried the G1178A mutation in addition to other nonsynonymous mutations. Among these mutations, some were predicted to be neutral and deleterious. Meanwhile, different mitochondrial mutations in the group in which treatment was ineffective, compared with those in responders, were at nucleotide positions 6569 (CO1; Patient 3), 9641 (CO3; Patient 3), and 4491 (ND2; Patient 5). Conclusions: Detection of the 3 primary mitochondrial mutations causing LHON is sufficient for screening before gene therapy; sequencing of the entire mitochondrial genome is unnecessary before treatment. Patients with LHON can respond to targeted gene therapy irrespective of additional multilocus mitochondrial mutations.

Original Contribution Multilocus Mitochondrial Mutations Do Not Directly Affect the Efficacy of Gene Therapy for Leber Hereditary Optic Neuropathy Shuo Yang, MD, PhD, Chen Chen, PhD, Jia-Jia Yuan, MD, Shuai-Shuai Wang, MD, Xing Wan, MD, Heng He, MD, Si-Qi Ma, MD, Bin Li, MD, PhD Purpose: Clinical trials of gene therapy for Leber hereditary optic neuropathy (LHON) were conducted in 9 volunteers with the mitochondrial mutation, G11778A in ND4. The purpose of this study was to investigate whether multilocus mitochondrial mutations directly influence the efficacy of gene therapy for LHON. Methods: Nine volunteers with LHON participated in a clinical trial with intravitreal injection of an adenoviral vector expressing wild-type ND4. Patients were subsequently divided into 2 groups: according to the differences in therapy efficacy and based on improvements in visual acuity. Full mitochondrial DNA sequences of the 2 groups of patients were generated and compared using PubMed, PolyPhen, and PROVEAN. Furthermore, the association between the detected mutations and clinical effects of gene therapy was analyzed. Results: Best-corrected visual acuity (BCVA) significantly improved ($0.3 log of minimum angle of resolution [logMAR]) in 7 patients 6 months after gene therapy, whereas there was no significant change in BCVA (,0.3 logMAR) of the remaining 2 patients. All 9 patients carried the G1178A mutation in addition to other nonsynonymous mutations. Among these mutations, some were predicted to be neutral and deleterious. Meanwhile, different mitochondrial mutaDepartment of Ophthalmology (SY, J-JY, S-SW, XW, HH, S-QM, BL), Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; Eye Center (SY), Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China; and Center of Genetic Diagnosis (CC), Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China. Supported by the National Natural Science Foundation of China (Grants #81271015, #30872823, and #30801260) and the LHON Special Research Foundation of the Wuhan Phoebus Biological Technology Limited Company. Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions of this article on the journal’s Web site (www. jneuro-ophthalmology.com). S. Yang and C. Chen are the co-first authors. Address correspondence to Bin Li, MD, PhD, Department of Ophthalmology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1095 Jie‐fang Road, Wuhan, Hubei Province, China; E-mail: [e-mail] 22 tions in the group in which treatment was ineffective, compared with those in responders, were at nucleotide positions 6569 (CO1; Patient 3), 9641 (CO3; Patient 3), and 4491 (ND2; Patient 5). Conclusions: Detection of the 3 primary mitochondrial mutations causing LHON is sufficient for screening before gene therapy; sequencing of the entire mitochondrial genome is unnecessary before treatment. Patients with LHON can respond to targeted gene therapy irrespective of additional multilocus mitochondrial mutations. Journal of Neuro-Ophthalmology 2020;40:22–29 doi: 10.1097/WNO.0000000000000797 © 2019 by North American Neuro-Ophthalmology Society L eber hereditary optic neuropathy (LHON) is a mitochondrial genetic disease of the eye that results in optic nerve degeneration. It is a main cause of hereditary blindness in young people. LHON pathogenesis is associated with mitochondrial mutations that cause serious damage to the activity and function of the mitochondrial respiratory chain, thereby affecting mitochondrial ATP production and resulting in neuronal damage (1–3). The major known mitochondrial mutations that cause LHON are G3460A (ND1), G11778A (ND4), and T14484C; these account for approximately 85%–95% of all disease-related mutations (1,4–8). The G1178A mutation is reported in approximately 90% of LHON cases in China and other Asian regions (5,6,8). In addition, secondary mutations in mitochondrial DNA (mtDNA) that contribute to high penetrance are usually synergized with m.11778G.A, m.14484T.C, or m.3460G.A (9). The 7444G.A mutation in COI/ tRNAser (UCN) gene can decrease the activity of cytochrome c in the respiratory chain and affect the outline rate of families carrying primary loci of LHON. Mitochondrial tRNA Met 4435G.A and tRNA Thr 15951A.G mutations can affect tRNA metabolism, reduce protein Yang et al: J Neuro-Ophthalmol 2020; 40: 22-29 Copyright © North American Neuro-Ophthalmology Society. Unauthorized reproduction of this article is prohibited. Original Contribution TABLE 1. Clinical data for patients with LHON Patient Gender Age at Onset of LHON (yrs) Age at Gene Therapy (yrs) Duration (yrs) 1 2 3 4 5 6 7 8 9 *Average Male Male Male Male Male Female Female Male Male 14 8 7 13 16 8 9 13 43 14.6 18 10 9 21 17 9 26 17 46 19.2 4 2 2 8 1 1 17 4 3 4.7 LHON, Leber hereditary optic neuropathy. expression, and further aggravate mitochondrial respiratory dysfunction (10,11). At present, innovative gene therapy is being used to alleviate this condition, and we have performed a series of studies focusing on gene therapy for LHON (12–20). During followup examination after a previous clinical trial, we screened the 3 major mtDNA loci mutated in LHON and selected volunteers carrying the G1178A mutation for gene therapy. This was performed using an adenoviral vector expressing wild-type ND4 (AAV-ND4). The efficacy and safety of LHON gene therapy has been demonstrated previously (16,17); however, postoperative follow-up suggested that the clinical efficacy of this treatment was inconsistent among patients. In this study, we aimed to determine the reason for this inconsistency regarding the clinical effects of LHON gene therapy. LHON patients may have numerous mitochondrial gene point mutations; about 5.9%–11.8% of them are secondary mutations that could affect their clinical phenotype (11,21). We hypothesized that there is a correlation between multilocus mitochondrial mutations and differences in treatment outcomes. To test this hypothesis and to explore reasons underlying the variability of treatment efficacy, we performed complete sequence analysis of mtDNA samples from volunteers who received gene therapy. To determine treatment efficacy, best-corrected visual acuity (BCVA) was measured 6 months after gene therapy. The relation between multilocus mutations and gene therapy outcomes was assessed. METHODS All clinical data, gene therapy design, vector types, and follow-up clinical results have been reported previously (15– 17). The LHON gene therapy clinical trial was registered with clinicaltrials.gov (number: NCT01267422) and approved by the ethics committee of Ezhou Central Hospital (Ezhou, China). Informed consent was obtained from adult patients and from guardians of minors. All experiments followed the provisions of the Declaration of Helsinki. This was an open-label study. Yang et al: J Neuro-Ophthalmol 2020; 40: 22-29 To focus on the treatment responses, and to exclude long-term factors (such as carrier effects, continuity, and transduction efficiency) associated with the efficacy and safety of the LHON gene therapy trial (16,17), 6 months post-treatment was selected as the optimal time point for BCVA. To exclude any possible interaction between the injected and uninjected eyes (13–17), we have only analyzed and discussed the treated eye of each patient. Patients Initially, patients were confirmed to have LHON using a polymerase chain reaction (PCR)-based test, the amplification refractory mutation system. This was performed to analyze the 3 primary mutations: G3460A, G11778A, and T14484C. All patients with LHON included in this study were diagnosed as carriers of the primary mitochondrial point mutation at locus 11778. Genetic analysis was performed by the Genetic Diagnosis Center at Tongji Hospital (Wuhan, China). In total, 7 men and 2 women volunteered to participate in the clinical trial (Table 1). Patients 1, 2, and 3 received intravitreal injection of AVVND4 in 2011; patients 4–9 received the injection in 2012. The detailed gene therapy protocol has been described previously (16,17). Post-treatment follow-up data, including BCVA, visual field (VF), optical coherence tomography (OCT), and pattern-reversal visual evoked potential (PR-VEP), were collected at the Department of Ophthalmology, Tongji Hospital (Wuhan, China) by the same physicians and technicians. Patients were divided into a treatment-effective group (in injected eyes, BCVA improvement $0.3 log of minimum angle of resolution [logMAR]) and a treatment-ineffective group (BCVA , 0.3 logMAR). To exclude the effects of bilateral therapy for Patient 1 (the only patient who underwent therapy for both eyes), we only analyzed the first injected eye. The inclusion criteria for patients in this study were the same as those used previously (16,17). In this study, subjects carrying the G11778A mutation were voluntarily enrolled in our gene therapy clinical trial; therefore, no control group was included. All patients were able to follow the physician’s advice and met all the requirements of follow-up–related testing. 23 Copyright © North American Neuro-Ophthalmology Society. Unauthorized reproduction of this article is prohibited. Original Contribution TABLE 2. Primers used for complete mitochondrial DNA sequencing Primer Name Primer Sequence (from 59 to 39 ) 1F.611 1R.1411 2F.1245 2R.2007 3F.1854 3R.2669 4F.2499 4R.3346 5F.3169 5R.3961 6F.3796 6R.4654 7F.4485 7R.5420 8F.5255 8R.6031 9R.6642 10F.6469 10R.7315 11F.7148 11R.8095 12F.7937 12R.8797 13F.8621 14F.9230 15F.9989 15R.10837 16F.10672 16R.11472 17F.11314 17R.12076 18F.11948 18R.12772 19F.12571 19R.13507 20F.13338 20R.14268 21F.14000 21R.14998 22F.14856 22R.15978 23F.15811 23R.765 24F.16420 24R.775 CTCCTCAAAGCAATACACTG TGCTAAATCCACCTTCGACC CGATCAACCTCACCACCTCT TGGACAACCAGCTATCACCA GGACTAACCCCTATACCTTCTGC GGCAGGTCAATTTCACTGGT AAATCTTACCCCGCCTGTTT AGGAATGCCATTGCGATTAG TACTTCACAAAGCGCCTTCC ATGAAGAATAGGGCGAAGGG TGGCTCCTTTAACCTCTCCA AAGGATTATGGATGCGGTTG ACTAATTAATCCCCTGGCCC CCTGGGGTGGGTTTTGTATG CTAACCGGCTTTTTGCCC ACCTAGAAGGTTGCCTGGCT ATTCCGAAGCCTGGTAGGAT CTCTTCGTCTGATCCGTCCT AGCGAAGGCTTCTCAAATCA ACGCCAAAATCCATTTCACT CGGGAATTGCATCTGTTTTT ACGAGTACACCGACTACGGC TGGGTGGTTGGTGTAAATGA TTTCCCCCTCTATTGATCCC CCCACCAATCACATGCCTAT TCTCCATCTATTGATGAGGGTCT AATTAGGCTGTGGGTGGTTG GCCATACTAGTCTTTGCCGC TTGAGAATGAGTGTGAGGCG TCACTCTCACTGCCCAAGAA GGAGAATGGGGGATAGGTGT TATCACTCTCCTACTTACAG AGAAGGTTATAATTCCTACG AAACAACCCAGCTCTCCCTAA TCGATGATGTGGTCTTTGGA ACATCTGTACCCACGCCTTC AGAGGGGTCAGGGTTGATTC GCATAATTAAACTTTACTTC AGAATATTGAGGCGCCATTG TGAAACTTCGGCTCACTCCT AGCTTTGGGTGCTAATGGTG TCATTGGACAAGTAGCATCC GAGTGGTTAATAGGGTGATAG CACCATTCTCCGTGAAATCA AGGCTAAGCGTTTTGAGCTG Exclusion criteria were as follows: refusal to undergo complete mtDNA sequencing, and local or common ocular diseases or abnormalities that affected results of testing. After injection, none of the patients received any other treatment. No patient met the exclusion criteria. Ophthalmologic Examination Changes in BCVA were defined as the primary endpoint of LHON gene therapy. BCVA was detected using a 2.5-m standard logMAR chart (Star Kang Medical Technology 24 Co, Ltd, Wen Zhou, China). VF was analyzed using a Humphrey field analyzer (Carl Zeiss 740i; Carl Zeiss, Shanghai, China). OCT was determined using a Spectralis HRA + OCT (Heidelberg Engineering, Heidelberg, Germany) and PR-VEP using a DV-100 instrument (Shanghai Dikon Medical, Shanghai, China). The procedures used were similar to those described previously (15–17). Additional Examinations Other tests included systemic function and immune response, intraocular pressure, fundus, and other safety checks. General examinations included routine blood and urine tests and liver, kidney, and immune function tests. Immune response examination included levels of human T-lymphocyte subsets, as follows: CD3+ (normal range, 50%–84%); CD3+/CD4+ (normal range, 27%–51%); and CD3+/CD8+ (normal range, 15%–44%). DNA Extraction DNA was extracted from whole blood cells collected in K3EDTA tubes, using a nucleic acid extraction automatic analyzer (Lab-Aid 820, ZeeSan Biotechnology; Xiamen City, China), according to the manufacturer’s instructions. DNA was quantified and diluted to a final concentration of 10 ng/mL. Mutation Analysis After gene therapy, the mtDNA of patients was analyzed using direct sequencing by a PCR-based method; the protocol has been described previously (20). By comparing with the SNP database (PubMed, PolyPhen, and PROVEAN), we speculated the amino acids that might change at secondary sites and selected the adjacent sites when the loci were not available in the database. Screening of Complete Mitochondrial DNA Sequences In total, 24 pairs of primers (Table 2) were designed, to amplify mtDNA from total DNA, using Primer Premier 5.0 software. PCRs were performed using 100 ng of DNA as the template in 40-mL reactions consisting of 1.0 mL of 20 mM stock solution for each primer, 1 unit of Taq polymerase, 0.1 mM of each dNTP, and 4 mL of 10· PCR buffer containing 15-mM MgCl2. PCR products were directly sequenced using BigDye terminator v3.1 on a 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA). The program used for PCRs was as follows: initial denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 60 seconds, with final extension at 72°C for 5 minutes. The complete mtDNA genome was sequenced, except for the 1.1-kb noncoding D-loop region (involved in mtDNA transcription and replication). All fragments were sequenced in the forward and reverse directions to confirm nucleotide variations. Yang et al: J Neuro-Ophthalmol 2020; 40: 22-29 Copyright © North American Neuro-Ophthalmology Society. Unauthorized reproduction of this article is prohibited. Original Contribution FIG. 1. Visual acuity (logMAR) in treated eyes with LHON before and 6 months after gene therapy. A. Seven patients showed an improvement of $0.3 logMAR (the treatment-effective group). B. Two patients had changes ,0.3 logMAR (the treatmentineffective group). BCVA, best-corrected visual acuity; LHON, Leber hereditary optic neuropathy; logMAR, log of minimum angle of resolution. Data Analyses Data are presented as mean ± standard deviation (SD). Sequencing data were analyzed using Chromas and DNAMAN programs (Technelysium Pvt. Ltd, Helensvale, Australia). RESULTS improvement of more than 0.3 logMAR, whereas Patients 3 and 5 showed no improvement in visual acuity (improvement of less than 0.3 logMAR) (Figs. 1, 2). Other detailed results (VF, OCT, and PR-VEP) are presented in Table 3; these have also been reported previously (15–17). The ophthalmologic results of uninjected eyes are presented in Table 4. Primary and Secondary Mutation Spectrum General Observations Systemic immunity and general examination results have been reported previously (16,17). None of the patients had any obvious immune abnormalities or other adverse events. Outcomes of Visual Function Tests Improvement in BCVA was the primary indicator used to monitor the effect of LHON gene therapy. In this study, we focused on BCVA results of the treated eyes 6 months after gene therapy. For BCVA, the treated eyes of Patients 1, 2, 4, 6, 7, 8, and 9 showed an Complete mtDNA sequence analysis confirmed that the primary mutation in all patients was G11778A. We compared complete mtDNA sequences of the 9 patients; the data demonstrated that Patients 3 and 5, who did not show significant improvement in visual acuity, had some mutations in common with other patients. These mutations were in addition to other characteristic mutations; two specific mutations were detected only in Patient 3 at nucleotides 6569 (CO1) and 9641 (CO3), whereas one was detected in Patient 5 at nucleotide 4,491 (ND2) (See Supplemental Digital Contents 1 and 2, Tables S1 and S2, http://links.lww.com/WNO/A370 and http://links.lww.com/WNO/A371, respectively). FIG. 2. Visual acuity (logMAR) in untreated eyes with LHON before and 6 months after gene therapy. A. BCVA of untreated eyes in the treatment-effective group. B. BCVA of untreated eyes in the treatment-ineffective group. BCVA, best-corrected visual acuity; LHON, Leber hereditary optic neuropathy; logMAR, log of minimum angle of resolution. Yang et al: J Neuro-Ophthalmol 2020; 40: 22-29 25 Copyright © North American Neuro-Ophthalmology Society. Unauthorized reproduction of this article is prohibited. Original Contribution TABLE 3. Test results of injected eyes for patients before and 6 months after intravitreal injection Patient 1 2 3 4 5 6 7 8 9 Eye Left Right Left Left Right Right Left Right Left BCVA (logMAR) VEP (P100, ms) VEP (amp, nV) Before After Before After Before After 1.3 1.4 1.0 1.1 2.3 0.4 0.9 1.2 1.7 169 116 119 139 144 116 125 128 132 115 120 143 112 107 118 101 115 98 1,210 86.1 303 1,090 2,320 152 146 763 618 2,870 380 1,180 1,310 2,910 2,850 792 2,760 890 2 1.7 1.2 2 2.3 1.1 1.2 1.7 2 MD of Visual Field (dB) Before 218.51 N/A 219.47 230.02 233.01 234.92 232.41 226.45 229.36 After 218.34 N/A 213.04 225.26 233.93 221.99 230.59 224.12 225.60 VFI of Visual Field (dB) Before 45% N/A 42% 8% 2% 0% 3% 16% 9% After 51% N/A 66% 17% 1% 34% 7% 19% 19% BCVA, best-corrected visual acuity; blank cells, no data available; logMAR, log of minimum angle of resolution; MD, mean deviation, a value close to 0 considered as normal; P100 wave, a value of ,105 ms considered as normal; VEP, visual evoked potential; VFI, visual field index, a value close to 100% is considered normal. Additional nonsynonymous mutations in gene coding regions were found in all 9 patients. The mitochondrial mutations of all patients are detailed in Supplemental Digital Content 2 (see Table S2, http://links.lww.com/WNO/A371). By comparing the PubMed-SNP, PolyPhen, and PROVEAN databases, we predicted the pathogenic significance of mutations in other loci in the volunteers. Results suggested both neutral and deleterious pathogenic significance of these mutations (Table 5). Taken together, mitochondrial inheritance in patients with LHON include the fact that additional mutations, even at secondary sites, with specific biochemical consequences, may be carried by many patients. DISCUSSION In addition to mutations at primary sites, secondary mutations, mitochondrial haplotypes, and epigenetic factors can influence the occurrence and development of LHON (21–24). Currently, information on secondary sites is limited to their collaborative effects, which increase LHON pathogenesis (25–30). In our study, the visual function of 2 patients did not improve after gene therapy. We speculated that unidentified point mutations might have affected their clinical progression. Furthermore, differences in individual and environmental factors could also have been responsible for the ineffectiveness of the gene therapy. At present, LHON is diagnosed based on the analysis of primary mitochondrial disease loci (mtDNA loci 11778, 14484, and 3460). In other studies, patients with LHON harboring the G11778A mutation were also identified by the presence of three primary mitochondrial mutations before being enrolled for gene therapy (31,32). The threshold effect of mitochondrial inheritance, whereby secondary mutations in mtDNA can increase pathogenic effects, may affect the clinical phenotype of LHON. Many mitochondrial genome sequencing studies have found that mutations at secondary sites are primarily responsible for LHON pathogenesis (25–30). To better understand the association between secondary mutations at multiple loci and gene therapy, we performed complete mtDNA sequencing for all 9 patients. TABLE 4. Test results of uninjected eyes for patients before and 6 months after intravitreal injection Patient 1 2 3 4 5 6 7 8 9 BCVA (logMAR) VEP (P100, ms) VEP (amp, nV) Eye Before After Before After Before After Before After Before After Right Left Right Right Left Left Right Left Right 2.0 0.9 1.0 1.1 2.3 1.0 0.9 1.4 2.0 2.0 0.9 1.0 1.0 2.3 0.5 0.7 1.2 1.7 127 124 113 130 125 124 145 100 134 122 117 119 103 107 98 97 127 88 1990 347 158 849 2,320 456 113 681 521 370 1,140 1,370 535 2,910 760 737 2,310 1,270 224.93 N/A 223.51 225.81 232.42 231.71 232.90 226.87 227.69 225.22 N/A 214.89 226.28 232.54 222.28 232.27 225.86 223.53 26% N/A 24% 18% 3% 9% 4% 13% 13% 24% N/A 88% 17% 3% 34% 5% 18% 23% MD of Visual Field (dB) VFI of Visual Field (dB) BCVA, best-corrected visual acuity; blank cells, no data available; logMAR, log of minimum angle of resolution; MD, mean deviation, a value close to 0 considered as normal; P100 wave, a value of ,105 ms considered as normal; VEP, visual evoked potential; VFI, visual field index, a value close to 100% is considered normal. 26 Yang et al: J Neuro-Ophthalmol 2020; 40: 22-29 Copyright © North American Neuro-Ophthalmology Society. Unauthorized reproduction of this article is prohibited. Original Contribution TABLE 5. The amino acid sequences that are influenced by the secondary mutations Chr. Clinical Position Protein Significance* Function* Mutation 3394 4048 4491 5178 5460 7853 8414 ND1 ND1 ND2 ND2 ND2 COX2 ATP8 Pathogenic Pathogenic Pathogenic Pathogenic Pathogenic Pathogenic Pathogenic Missense Missense Missense Missense Missense Missense Missense T.C G.A G.A C.A G.A G.A C.T Tyr [Y] Asp [D] Val [V] Leu [L] Ala [A] Val [V] Leu [L] His [H] Asn [N] Ile [I] Ile [I] Thr [T] Ile [I] Phe [F] 8654 ATP6 Pathogenic Missense T.C Ile [I] Thr [T] 8701 8860 8584 9540 10398 11969 12358 12811 14318 ATP6 Pathogenic ATP6 Pathogenic ATP6 Pathogenic COX3 Pathogenic ND3 Pathogenic ND4 Pathogenic ND5 Pathogenic ND5 Pathogenic ND6 Likely pathogenic Missense Missense Missense Missense Missense Missense Missense Missense Missense A.G A.G G.A G.A A.G G.A A.G T.C T.A Thr [T] Thr [T] Ala [A] Val [V] Thr [T] Ala [A] Thr [T] Tyr [Y] Asn [N] Ala [A] Ala [A] Thr [T] Ile [I] Ala [A] Thr [T] Ala [A] His [H] Ile [I] 14502 14766 14978 15043 15071 15204 ND6 CYTB CYB CYB CYB CYB T.C C.T A.G G.A T.C T.A Ile [I] Thr [T] Ile [I] Gly [G] Tyr [Y] Ile [I] Val [V] Ile [I] Val [V] His [H] Asn [N] Benign Possibly damaging 15301 15326 CYB Benign Synonymous G.A CYB Likely pathogenic Missense A.G Leu [L] Thr [T] Ala [A] Benign Likely pathogenic Missense Likely pathogenic Missense Likely pathogenic Missense Benign Synonymous Likely pathogenic Missense Likely pathogenic Missense Original Amino Mutant Amino Acids Acids PROVEAN Prediction‡ Unknown Benign Benign Benign Benign Benign Probably damaging Possibly damaging Benign Benign Benign Unknown Benign Benign Unknown Unknown Possibly damaging Benign Benign Benign PolyPhen Prediction† Unknown Neutral Neutral Neutral Neutral Neutral Neutral Neutral Neutral Neutral Neutral Unknown Neutral Neutral Unknown Unknown Deleterious Neutral Neutral Neutral Neutral Deleterious Neutral *Analysis based on PubMed database (SNP). † These mutations were predicted with a score based on PolyPhen database. ‡ These mutations were predicted with a score based on PROVEAN database. First, we determined whether multiple mitochondrial mutations directly affected or limited gene therapy of specific target genes; however, the results of our mtDNA sequence analysis led us to reject this preliminary hypothesis. In fact, we found that all 9 patients who underwent gene therapy had some secondary-site mutations (See Supplemental Digital Contents 1 and 2, Tables S1 and S2, http://links.lww.com/WNO/A370 and http://links.lww.com/WNO/A371, respectively); however, after 6 months of gene therapy, visual function improved in 7 patients. Thus, the presence of multiple mutation sites was not the primary factor responsible for the lack of improvement in visual function. The 2 patients, who did not show improved visual function after gene therapy, had one or two different mutations that were not found in the other 7 patients (6,569 [CO1], 9,641 [CO3], and 4,491 [ND2]); owing to the limited number of samples included, and influence of unavoidable individual factors, we could not confirm a direct relations between these multilocus mutations and treatment. In the future, multicenter clinical trials of patients with late-stage disease need to be performed to understand Yang et al: J Neuro-Ophthalmol 2020; 40: 22-29 the relation between secondary mutations and outcomes of gene therapy for LHON clearly. The findings of our current study suggest that the visual function of some patients with multisite mutations may be improved by gene therapy. Not all mutations are associated with the development of LHON. If a patient only has a mutation at the 11,778 site, in theory, he/she may be expected to have the most favorable prognosis in response to gene therapy; however, in our study, most patients with LHON carry multisite mutations. The causes and pathogenesis of such patients, who exhibited poor outcomes after gene therapy, remain unclear. Nonetheless, patients with G11778A, along with other secondary mutated sites, responded well to gene therapy. This study, however, has several limitations. Because the patients with LHON, included in this trial were only tested for the 3 primary-site mutations before gene therapy, the inclusion criteria were limited to patients carrying the G11778A mutation; hence, no patient carrying the G11778A mutation alone could be included as a control participant. After administration of gene therapy, we 27 Copyright © North American Neuro-Ophthalmology Society. Unauthorized reproduction of this article is prohibited. Original Contribution explored the differences in treatment outcomes among the patients; the effect, duration, and other prognostic factors in patients carrying the G11778A mutation may also be associated with response to therapy. During follow-up evaluation of the patients, who underwent gene therapy, further analysis was performed by classifying them into subgroups to test our hypothesis. In conclusion, mitochondrial inheritance in patients with LHON includes the fact that some patients carry additional multilocus mutations at secondary sites that may have biochemical consequences. Our results indicate that patients with LHON with multilocus mutations can respond to the targeted gene therapy. Analysis of complete mtDNA could allow for the prediction of patient prognosis; however, for economic and practical reasons, detection of the 3 primary mtDNA mutations is sufficient for screening patients with LHON before gene therapy. STATEMENT OF AUTHORSHIP Category 1: a. Conception and design: B. Li and S. Yang; b. Acquisition of data: S. Yang, C. Chen, J.-J. Yuan, S.-S. Wang, X. Wan, H. He, and S.-Q. Ma; c. Analysis and interpretation of data: S. Yang. Category 2: a. Drafting the manuscript: S. Yang; b. Revising it for intellectual content: S. Yang and J.-J. Yuan. Category 3: a. Final approval of the completed manuscript: S. Yang, C. Chen, J.-J. Yuan, S.-S. Wang, X. Wan, H. He, S.-Q. Ma, and B. Li. ACKNOWLEDGMENTS The authors express their gratitude to the 9 patients and their family members for agreeing to receive gene therapy and for participating in this research. REFERENCES 1. Jurkute N, Yu-Wai-Man P. Leber hereditary optic neuropathy: bridging the translational gap. Curr Opin Ophthalmol. 2017;28:403–409. 2. Carelli V, Ross-Cisneros FN, Sadun AA. Mitochondrial dysfunction as a cause of optic neuropathies. Prog Retin Eye Res. 2004;23:53–89. A. Investigating Leber’s 3. Jankauskaite_ E, Bartnik E, Kodron hereditary optic neuropathy: cell models and future perspectives. Mitochondrion. 2017;32:19–26. 4. Karanjia R, Chahal J, Ammar M, Sadun AA. Treatment of Leber’s hereditary optic neuropathy. Curr Pharm Des. 2017;23:624–628. 5. Mackey DA, Oostra RJ, Rosenberg T, Nikoskelainen E, BronteStewart J, Poulton J, Harding AE, Govan G, Bolhuis PA, Norby S. Primary pathogenic mtDNA mutations in multigeneration pedigrees with Leber hereditary optic neuropathy. Am J Hum Genet. 1996;59:481–485. 6. Guo H, Li S, Dai L, Huang X, Yu T, Yin Z, Bai Y. Genetic analysis in a cohort of patients with hereditary optic neuropathies in Southwest of China. Mitochondrion. 2018;7:S1567–S7249. 7. Carelli V, Carbonelli M, de Coo IF, Kawasaki A, Klopstock T, Lagrèze WA, La Morgia C, Newman NJ, Orssaud C, Pott JWR, Sadun AA, van Everdingen J, Vignal-Clermont C, Votruba M, YuWai-Man P, Barboni P. International consensus statement on the clinical and therapeutic management of Leber hereditary optic neuropathy. J Neuroophthalmol. 2017;37:371–381. 28 8. Mashima Y, Yamada K, Wakakura M, Kigasawa K, Kudoh J, Shimizu N, Oguchi Y. Spectrum of pathogenic mitochondrial DNA mutations and clinical features in Japanese families with Leber’s hereditary optic neuropathy. Curr Eye Res. 1998;17:403–408. 9. Dai Y, Wang C, Nie Z, Han J, Chen T, Zhao X, Ai C, Ji Y, Gao T, Jiang P. Mutation analysis of Leber’s hereditary optic neuropathy using a multi-gene panel. Biomed Rep. 2018;8:51– 58. 10. Brown MD, Torroni A, Reckord CL, Wallace DC. Phylogenetic analysis of Leber’s hereditary optic neuropathy mitochondrial DNA’s indicates multiple independent occurrences of the common mutations. Hum Mutat. 1995;6:311–325. 11. Qu J, Li R, Zhou X, Tong Y, Lu F, Qian Y, Hu Y, Mo JQ, West CE, Guan MX. The novel A4435G mutation in the mitochondrial tRNAMet may modulate the phenotypic expression of the LHON-associated ND4 G11778A mutation. Invest Ophthalmol Vis Sci. 2006;47:475–483. 12. Pei H, Wan X, Hu W, Dong X, Li B. Construction and detection of a novel type of recombinant human rAAV2/2-ND4. Eye Sci. 2013;28:55–59. 13. Yang S, He H, Zhu Y, Wan X, Zhou LF, Wang J, Wang WF, Liu L, Li B. Chemical and material communication between the optic nerves in rats. Clin Exp Ophthalmol. 2015;43:742–748. 14. Shi H, Gao J, Pei H, Liu R, Hu WK, Wan X, Li T, Li B. Adenoassociated virus-mediated gene delivery of the human ND4 complex I subunit in rabbit eyes. Clin Exp Ophthalmol. 2012;40:888–894. 15. Yang S, Yang H, Ma SQ, Wang SS, He H, Zhao MJ, Li B. Evaluation of Leber’s hereditary optic neuropathy patients prior to a gene therapy clinical trial. Medicine (Baltimore). 2016;95:e5110. 16. Wan X, Pei H, Zhao MJ, Yang S, Hu WK, He H, Ma SQ, Zhang G, Dong XY, Chen C, Wang DW, Li B. Efficacy and safety of rAAV2ND4 treatment for Leber’s hereditary optic neuropathy. Sci Rep. 2016;6:21587. 17. Yang S, Ma S, Wan X, He H, Pei H, Zhao MJ, Chen C, Wang D, Dong X, Yuan J, Li B. Long-term outcomes of gene therapy for the treatment of Leber’s hereditary optic neuropathy. EBioMedicine. 2016;10:258–268. 18. Yuan JJ, Zhang Y, Wang LL, Cheng MS, Ma SQ, Gao Q, Li B. Visual field variability after gene therapy for Leber’s hereditary optic neuropathy. Ophthalmic Res. 2018;60:176–184. 19. Yuan J, Zhang Y, Liu H, Tian Z, Li X, Zheng Y, Gao Q, Song L, Xiao X, Sun J, Wang Z, Li B. Clinical observation of patients with Leber’s hereditary optic neuropathy before gene therapy. Curr Gene Ther. 2018;18:386–392. 20. Cui G, Ding H, Xu Y, Li B, Wang DW. Applications of the method of high resolution melting analysis for diagnosis of Leber’s disease and the three primary mutation spectrum of LHON in the Han Chinese population. Gene. 2013;512:108–112. 21. Yum HR, Chae H, Shin SY, Kim Y, Kim M, Park SH. Pathogenic mitochondrial DNA mutations and associated clinical features in Korean patients with Leber’s hereditary optic neuropathy. Invest Ophthalmol Vis Sci. 2014;55:8095–8101. 22. Gueven N, Nadikudi M, Daniel A, Chhetri J. Targeting mitochondrial function to treat optic neuropathy. Mitochondrion. 2017;36:7–14. 23. Jiang P, Liang M, Zhang J, Gao Y, He Z, Yu H, Zhao F, Ji Y, Liu X, Zhang M, Fu Q, Tong Y, Sun Y, Zhou X, Huang T, Qu J, Guan MX. Prevalence of mitochondrial ND4 mutations in 1281 Han Chinese subjects with Leber’s hereditary optic neuropathy. Invest Ophthalmol Vis Sci. 2015;56:4778–4788. 24. Jia X, Li S, Xiao X, Guo X, Zhang Q. Molecular epidemiology of mtDNA mutations in 903 Chinese families suspected with Leber hereditary optic neuropathy. J Hum Genet. 2006;51:851–856. 25. Zhang Y, Tian Z, Yuan J, Liu C, Liu HL, Ma SQ, Li B. The progress of gene therapy for Leber’s optic hereditary neuropathy. Curr Gene Ther. 2017;17:320–326. 26. Zhang J, Jiang P, Jin X, Liu X, Zhang M, Xie S, Gao M, Zhang S, Sun YH, Zhu J, Ji Y, Wei QP, Tong Y, Guan MX. Leber’s hereditary optic neuropathy caused by the homoplasmic Yang et al: J Neuro-Ophthalmol 2020; 40: 22-29 Copyright © North American Neuro-Ophthalmology Society. Unauthorized reproduction of this article is prohibited. Original Contribution ND1 m.3635G.A mutation in nine Han Chinese families. Mitochondrion. 2014;18:18–26. 27. Li R, Qu J, Zhou X, Tong Y, Hu Y, Qian Y, Lu F, Mo JQ, West CE, Guan MX. The mitochondrial tRNA Thr A15951G mutation may influence the phenotypic expression of the LHON-associated ND4 G11778A mutation in a Chinese family. Gene. 2006;376:79–86. 28. Zhang M, Zhou X, Li C, Zhao F, Zhang J, Yuan M, Sun YH, Wang J, Tong Y, Liang M, Yang L, Cai W, Wang L, Qu J, Guan MX. Mitochondrial haplogroup M9a specific variant ND1 T3394C may have a modifying role in the phenotypic expression of the LHON-associated ND4 G11778A mutation. Mol Genet Metab. 2010;101:192–199. 29. Zhang J, Zhou X, Zhou J, Li C, Zhao F, Wang Y, Meng Y, Wang J, Yuan M, Cai W, Tong Y, Sun YH, Yang L, Qu J, Guan MX. Mitochondrial ND6 T14502C variant may modulate the phenotypic expression of LHON-associated G11778A mutation in four Chinese families. Biochem Biophys Res Comm. 2010;399:647–653. 30. Wong A, Cavelier L, Collins-Schramm HE, Seldin MF, McGrogan M, Savontaus ML, Cortopassi GA. Differentiation-specific effects of LHON mutations introduced into neuronal NT2 cells. Hum Mol Genet. 2002;11:431–438. 31. Feuer WJ, Schiffman JC, Davis JL, Porciatti V, Gonzalez P, Koilkonda RD, Yuan H, Lalwani A, Lam BL, Guy J. Gene therapy for Leber hereditary optic neuropathy: initial results. Ophthalmology. 2016;123:558–570. 32. Guy J, Feuer WJ, Davis JL, Porciatti V, Gonzalez PJ, Koilkonda RD, Yuan H, Hauswirth WW, Lam BL. Gene therapy for Leber hereditary optic neuropathy: low- and medium-dose visual results. Ophthalmology. 2017;124:1621–1634. Images in Neuro-Ophthalmology Spontaneous haematoma of varicose superior ophthalmic vein secondary to indirect carotid-cavernous sinus fistula A. Spontaneous left superior eyelid hematoma as clinical debut. B. Angio-CT 3D Reconstruction of left orbit. Varicose superior ophthalmic vein is seen beneath the orbit roof. Dilated left angular/facial vein is also seen. C. Angio-CT axial scan: Early arterial enhancement of the left cavernous sinus (arrowhead) associated with enlarged and dilated left superior ophthalmic vein passing through the superior orbital fissure. (Courtesy of Maria del Mar Schilt-Catafal MD, Félix PastorEscartín DO, Paulina Neira-Ibáñez MD, Laura Manfreda-Dominguez MD, and Antonio Duch-Samper MD, PhD, València, Spain). Yang et al: J Neuro-Ophthalmol 2020; 40: 22-29 29 Copyright © North American Neuro-Ophthalmology Society. Unauthorized reproduction of this article is prohibited.