Journal of Neuro-Ophthalmology, June 2002, Volume 22, Issue 2

Spontaneous Direct Carotid-Cavernous Fistula in Ehlers-Danlos Syndrome Type IV

Two unrelated adults with Ehlers-Danlos syndrome type IV developed acute unilateral ophthalmoplegia and ipsilateral headache as a consequence of spontaneous (nontraumatic) direct carotid-cavernous fistulas. Because the interventional radiologist suspected the diagnosis of Ehlers-Danlos syndrome type IV, the carotid-cavernous fistulas were closed via the venous rather than the more standard arterial route in an attempt to avoid arterial dissection or rupture. In any patient presenting with a spontaneous direct carotid-cavernous fistula, family history and clinical examination should be targeted toward a diagnosis of Ehlers-Danlos syndrome type IV because of risks attendant to angiography and repair of the fistula. For these patients, ancillary medical care must be approached cautiously to avoid hollow viscus rupture. Molecular tests can be used to confirm the diagnosis and provide family members with accurate genetic counseling and predictive genetic testing.

ORIGINAL CONTRIBUTION Spontaneous Direct Carotid- Cavernous Fistula in Ehlers- Danlos Syndrome Type IV: Two Case Reports and a Review of the Literature Hideki Chuman, MD, Jonathan D. Trobe, MD, Elizabeth M. Petty, MD, Ulrike Schwarze, MD, Melanie Pepin, MS, Peter H. Byers, MD, and John P. Deveikis, MD Two unrelated adults with Ehlers- Danlos syndrome type IV developed acute unilateral ophthalmoplegia and ipsilateral headache as a consequence of spontaneous ( nontraumatic) direct carotid- cavernous fistulas. Because the interven­tional radiologist suspected the diagnosis of Ehlers- Danlos syndrome type IV, the carotid- cavernous fistulas were closed via the venous rather than the more standard arterial route in an attempt to avoid arterial dissection or rupture. In any patient presenting with a spontaneous direct carotid-cavernous fistula, family history and clinical examination should be targeted toward a diagnosis of Ehlers- Danlos syndrome type IV because of risks attendant to angiography and repair of the fistula. For these patients, ancillary medi­cal care must be approached cautiously to avoid hollow vis-cus rupture. Molecular tests can be used to confirm the di­agnosis and provide family members with accurate genetic counseling and predictive genetic testing. ( JNeuro- Ophthalmol 2002; 22: 75- 81) Direct carotid- cavernous fistulas ( CCFs) are abnormal communications between the intracavernous carotid artery and the venous plexus of the cavernous sinus. Head trauma is the most common cause. Spontaneous ( nontrau­matic) direct CCFs develop in patients with intracavernous aneurysms, and in individuals who have connective tissue diseases that cause vascular wall fragility, especially the vascular type of Ehlers- Danlos syndrome, Ehlers- Danlos syndrome type IV ( EDS IV) ( 1- 4). Departments of Ophthalmology ( HC, JDT), Neurology ( JDT), Internal Medicine ( EMP), Human Genetics ( EMP), Neurosurgery ( JDT, JPD) and Radiology ( Neuroradiology) ( JPD), University of Michigan Medical Cen­ter, Ann Arbor, Michigan, USA, and Departments of Pathology ( MP, PHB) and Medicine ( PHB), University of Washington, Seattle, Washing­ton, USA. Supported in part by funding from the National Institutes of Health ( AR21557). Address correspondence to Jonathan D. Trobe, MD, Kellogg Eye Center, 1000 Wall Street, Ann Arbor, MI 48105, USA; E- mail: jdtrobe@ umich. edu EDS IV is a highly penetrant, dominantly inherited connective tissue disorder that results from mutations in type III collagen gene, COL3A1. It is clinically character­ized by easy bruisability, translucent skin, acrogeria, distal joint hyperextensibility, and early mortality due to arterial andhollow organ ruptures ( 1,2). Unlike other types of EDS, EDS IV does not usually cause large joint laxity, delayed skin wound healing, or paper thin scars that lead to early medical diagnosis. Individuals without a known family his­tory may not be recognized to have EDS IV, even when they present with a major vascular or hollow organ rupture or a spontaneous direct CCF. If the clinical diagnosis is not rec­ognized, angiography and repair of the CCF may be under­taken without the special precautions that help to avoid the complications associated with these interventions in EDS IV ( 4). We present two patients with EDS IV who developed spontaneous direct CCFs. Although there was a genetically confirmed diagnosis of EDS IV in the son of one patient, and a history of a spontaneous CCF in the sister of the other patient, in neither patient was the diagnosis of EDS IV con­firmed when angiography took place. However, the inter­ventional radiologist suspected the diagnosis and under­took fistula closure via the less conventional transvenous route to try to avoid the risk of arterial dissection and rup­ture in EDS IV. CASE REPORTS Case 1 A 57- year- old man developed sudden pain behind his OS and diplopia. The following day, he noted weakness on the left side of his face. Examination disclosed normal vi­sual fields, partial left adduction, supraduction, and infra-duction deficits, mild left upper lid ptosis, and left mydria­sis with a sluggish pupillary reaction to light. Intraocular pressures were 15 mm Hg OU. The ocular adnexal, biomi-croscopic, and fundus examinations were normal. He had incomplete weakness of all muscles of facial expression on the left, but preservation of remaining cranial nerves nJNeuro- OpMiqlwol,. Vol. 22, No„ 2, 2002 „ . , DOI: 1Q. 1097/ 01. WNO. 0000019665.92684.6A ., 75 , Copyright © Lip pincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited. JNeuro- Ophthalmol, Vol. 22, No. 2, 2002 Chuman et al. ( including trigeminal). The rest of the neurologic examina­tion was normal. He was referred to our institution for fur­ther evaluation and management. A brain computed tomography ( CT) scan was nor­mal. Catheter cerebral angiography demonstrated a direct left carotid- cavernous fistula with predominant drainage through the petrosal sinus ( Fig. I A). Multiple aneurysms and dissections were present in abdominal and pelvic arter­ies ( Fig. IB). Following the angiogram, he developed a groin hematoma that did not resolve for several weeks. The radiologist performing the diagnostic angiogram did not know that the patient was suspected of having EDS IV on the basis of clinical features and the fact that the di­agnosis had been confirmed in his son some months earlier ( Fig. 2). But with the discovery of the abdominal and pelvic aneurysms, a clinical diagnosis of EDS IV was made. Be­cause of concern about arterial fragility in the region, platinum microcoils were placed via the inferior petrosal sinus into the cavernous sinus ( Figure lc), rather than using the usual transarterial placement of balloons. Once the coils were placed, a soft 4 French catheter was used for arterial injections of contrast to confirm that the fistula was occluded. Postoperatively, he was treated with prednisone 60 mg/ d to reduce inflammation in the thrombosed portion of the cavernous sinus. Within hours of the procedure, peri­ocular pain was gone. Six days later, his third nerve palsy had completely resolved; 10 days later, his facial palsy had " 4 , j FIG. 1. Case 1: arteriogram. A: Left internal carotid arteriogram, lateral view, early arterial phase shows high- flow, direct carotid- cavernous fistula. B: Pelvic arteriogram, frontal view, shows aneurysmal dilata­tion of the common and external iliac arteries bilater­ally, likely representing dissecting aneurysms ( arrows). C: Left common carotid arteriogram, lateral view, shows complete closure of the carotid- cavernous fis­tula after transvenous deposition of microcoils in the cavernous sinus. _ 76 . „ . © 2002 Lippincott Williams & Wilkins , Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited. SPONTANEOUS CCF IN EDS IV JNeuro- Ophthalmol, Vol. 22, No. 2, 2002 50s /^ S80s 80s 32 1 early, 2 midterm Mild scoliosis Arterial aneurysms with splenic blood clot No joint hypermobility No easy bruising COL3A1 mutation Myocardial infarction 2 strokes ' Thin skin' that cut and bruised very easily 57 Club feet at birth s/ p surgery Multiple dislocations and subluxations of shoulders Subluxable patella Skin tears easily with peeling and increased bleeding Varicosities s/ p pneumonia with pulmonary embolus and pneumothorax, s/ p Greenfield filter placement for lower extremity blood clots CCF, colon rupture COL3A1 mutation Confirmed EDS IV Probable EDS IV FIG. 2. Case 1: pedigree. The son of the propositus ( arrow) was known to have a COL3A1 mutation of Ehlers- Danlos Type IV prior to his father's development of a spontaneous ( nontraumatic) carotid-cavernous fistula. The father's diagnosis was suspected from clinical features and family history, and later confirmed by DNA diagnosis. disappeared. Perhaps because of the corticosteroid treat­ment and increased constipation related to hospitaliza­tion, he ruptured his descending colon on the third postop­erative day and required a colostomy. One year after the neurovascular procedure, there were no further complica­tions. As anticipated, DNA testing later confirmed that the patient had the same COL3A1 mutation that caused EDS IV in his son. The patient was born with bilateral equinovarus de­formities requiring tendon release. From early childhood, he had experienced easy bruisability and easily torn skin following mild abrasions or minimal bumping. He had had multiple right shoulder dislocations that ultimately required surgical repair and had a long history of adequately con­trolled essential hypertension. In 1998, he developed chest pain and a pleural effusion, was diagnosed with a pulmo­nary embolus, and had a Greenfield filter placed in his in­ferior vena cava. The patient's mother had a history of early strokes and fragile skin but lived into her mid 80s ( Fig. 2). His 32- year- old son had no significant joint hypermobility or skin abnormalities, but had developed a splenic infarct and an­giographic evidence of multiple small aneurysms in ab­dominal arteries. On that basis, he was suspected clinically of having EDS IV. The diagnosis was confirmed by the analysis of type III procollagen produced by cultured skin fibroblasts ( 4). A splice site mutation in intron 8 of one al­lele of the COL3A1 gene ( IVS8+ 5G^ A) was found to be the causative mutation ( Fig. 3). This mutation resulted in skipping exon 8 in the products of that allele and the en­coded protein was then not properly functional. Prior to his presentation with a CCF, the patient was notified that his son had a confirmed diagnosis of EDS IV, but he elected to defer his own genetic investigation be­cause of reimbursement issues. He had undergone a normal Duplex scan of his abdominal vessels. Case 2 A 48- year- old woman developed left periocular pain, blurred vision in the OS, and diplopia on left gaze. Two days later, she noted pulsatile tinnitus and left periocular swelling. A brain CT scan showed enlargement of extraocu­lar muscles in the left orbit and she was treated with intra­venous corticosteroids for a presumed diagnosis of inflam­matory orbitopathy. Within 2 days of the onset of her ophthalmic mani­festations, the patient's visual acuity had worsened to no light perception in the OS. Examination that day disclosed 20/ 20 visual acuity in the OD, no light perception in the OS, a complete left ophthalmoplegia, left mydriasis with a slug­gish pupillary reaction to light, and a left afferent pupil de­fect. Intraocular pressures were 18 mm Hg OD and 60 mm Hg OS. She had 9mm of left axial proptosis with marked left lid and conjunctival swelling and exposure keratopathy. Fundus examination disclosed a central retinal artery occlu­sion in the OS. The ocular adnexal, biomicroscopic, and fundus examinations were normal in the right. The rest of the neurologic examination was normal. Her skin was soft and velvety to touch but not translucent. Some history of excessive bruising was noted and was clinically observed in areas associated 77 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited JNeuro- Ophthalmol, Vol. 22, No. 2, 2002 Chuman et al. A Case 1 Normal allele pre- mRNA Mutant allele mRNA B Case 2 7 8 9 7 9 COL3A1 Exon 32 544 Proal( lll) G} Y Ala AlaGly Pro Pro GTy_ Pro Pro GJv_ Gly AspLys Normal allele 5'- GGTGCTGCTGGTCCTCCTGGGCCACCTGGT GGTGACAAG - 3' Mutant allele 5'- GGTGCTGCTAGTCCTCCTGGGCCACCTGGT GGTGACAAG - 3' Proal( lll) GJy Ala Ala Sejr Pro Pro Gly Pro Pro G[ y GJ^ Asp Lys FIG. 3. Schematic representation of the alterations in the COL3A1 gene in Case 1 ( A) and Case 2 ( B). In Case 1, the mutant COL3A1 allele ( right) harbors a donor splice site mutation in intron 8 ( IVS8+ 5G-> A) that abolishes normal splicing and results in skipping of exon 8 in the mRNA from that allele. In Case 2, there is a single nucleotide substitution in exon 32 of one allele that results in substitution of the glycine at position 544 of the triple helix by serine ( G544S, with reference to the first glycine of the triple helix). The substitution interrupts the Gly- Xaa- Yaa repeat pattern in the triple helix, which is needed to allow proper folding of prootl ( III) chains into the functional homotrimers of type III procollagen. with venipuncture. She had mild distal hand and foot fibroblasts using previously described methods ( 5). A mu-joint hyperextensibility. tation was identified in one COL3A1 allele that resulted in Catheter cerebral angiography demonstrated a direct substitution of the glycine at position 544 of the triple helix left CCF from rupture of a small cavernous carotid aneu- by serine ( G544S). This mutation disrupts the formation of rysm ( Fig. AA). The fistula was successfully closed with the collagen triple helix and interferes with the secretion of transvenous deposition of microcoils in the cavernous the protein, sinus ( Fig. AE). Within 2 days of the procedure, the patient's left DISCUSSION periocular pain was gone, intraocular pressures had These two cases illustrate the importance of early in-normalized, and lid swelling, conjunctival chemosis, and tervention in CCF associated with EDS IV to preserve vi-ocular ductions had markedly improved. However, visual sion, and emphasize the possibility of using the venous acuity in the OS did not recover and the left afferent pupil route to close the fistula. Spontaneous ( nontraumatic) CCF defect persisted. is one of the most common CNS vascular complications of The patient's 43- year- old sister had developed a EDS IV ( 3,7); although, as in both our patients, the diagno-spontaneous direct CCF five years earlier, but neither the sis may not be known at the time of presentation. Case 1 ' s patient's sister nor any family members had been evaluated son had had the diagnosis of EDS IV confirmed but the for EDS IV ( Fig. 5). patient was not recognized to have EDS IV until visceral The diagnosis of EDS IV was confirmed by analysis angiography identified multiple aneurysms. This diagnosis of the type III procollagen synthesized by cultured dermal prompted the use of the venous approach to occlude the ~. 7o . , . © 2002 Lippincott Williams & Wilkins , Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited. SPONTANEOUS CCF IN EDS IV JNeuro- Ophthalmol, Vol. 22, No. 2, 2002 FIG. 4. Case 2: arteriogram. A: Left in­ternal carotid arteriogram, lateral view, early arterial phase, shows direct carotid-cavernous fistula. B: Left carotid arterio­gram, lateral view, shows successful closure of the fistula by transvenous deposition of microcoils in the caver­nous sinus. fistula because of concerns that the catheters used to place balloons could induce arterial tears. The subsequent angi­ography to confirm closure of the fistula was done using a small- diameter soft catheter to try to minimize the risk of additional vascular injury. The hazards of delayed intervention are illustrated in Case 2. Within days of developing ophthalmoplegia, she proceeded to infarct her optic nerve and retina. It is possible that earlier intervention would have restored appropriate flow and diminished the likelihood of visual loss. Both pa­tients had large volume cerebral venous drainage from the cavernous sinus, which, if left alone, could result in cerebral venous thrombosis and stroke. No consensus on the best endovascular approach to closure of an EDS IV CCF has been reached. Almost 30 affected patients have been described ( 6- 13), but fewer than a dozen cases have been reported in sufficient detail to evaluate the efficacy of different approaches. General an­esthesia is recommended for patient comfort and safety be­cause catheterization of the cavernous sinus can be painful, and catheters and embolic agents can be visualized better and placed more precisely in an immobile patient. About 80% of the attempts to use an endovascular approach have involved transarterial balloon embolization, with higher than 50% success rate and one death ( 8- 11) related to rup­ture of extracerebral vessels ( 12). Transvenous balloon 79 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited JNeuro- Ophthalmol, Vol. 22, No. 2, 2002 Chuman et al. 70s 60s Vascular insufficiency Emphysema ( smoker) with pneumothorax in 60s 50s 48 ' Easy bruising Mild distal joint laxity CCF COL3A1 mutation , 40s Easy bruising, CCF at 43 ,20s Mild joint laxity Bilateral ACL tears 20s Mild joint laxity Bilateral ACL tears 40s 16 Mild joint laxity FIG. 5. Case 2: pedigree. The sister of the propositus ( arrow) had had easy skin bruis-ability and a nontraumatic carotid-cavernous fistula repaired uneventfully five years earlier. However, no diagnosis of EDS IV had been considered previously and di­agnostic confirmation of her suspected di­agnosis has not been done. I Confirmed EDS IV ^ ] Probable EDS IV | ? | EDS IV status unknown embolization, a less popular approach, appears to have had a similar success rate, although only about 20% of the at­tempts used this route. Transvenous coil deposition, the method chosen for our patients, has been reported only once previously, with a successful result ( 8). Coils may be supe­rior to a balloon in this condition because they are softer, easier to control, and exchangeable ( 8). Moreover, they al­low the use of smaller delivery devices for insertion and exert less pressure on the sinus than balloons. One possible advantage of the transvenous route is that iatrogenic injury to a low- pressure vein might be less deleterious than injury to a high- pressure artery. Given the arterial fragility, ectasia, and tortuosity in EDS IV, we think it is appropriate to consider coil deposi­tion via the transvenous route in closing CCFs in these pa­tients. The direct supraorbital and inferior petrosal sinus en­tries are unlikely to be successful ( 12). The difficulties encountered with arterial placement of balloons have al­ready led to the use of detachable coils ( 8, 13). Small caliber delivery devices probably lower the complication rate. These innovations may be, in part, responsible for a reduced morbidity rate in the last 10 years ( 8- 13). The transvenous approach is not without problems, as the venous tree is also fragile, and upstream pressure from the arterial tree may interfere with placement of the occluding devices. EDS IV is called the " vascular type" because of the prevalence of arterial rupture, dissection, and fistula ( 1). Al­though there is significant inter- and intrafamilial variabil­ity in the clinical presentation, the mean age of a major com­plication is 25 to 28 years; the average age of death, most often due to arterial rupture, is 45 to 50 years ( 2). The av­erage age at the time of the first vascular or visceral com­plication is 24 years, with 12% mortality. The risk of a major complication by age 40 is 80% ( 2). In a recent review of 419 patients ( 2), 70% of deaths were the result of arterial rupture, mostly of thoracic and abdominal vessels, but also of cerebral vessels. The most common nonlethal vascular complication in that series was CCF. Other complications included colon rupture and rupture of the uterus during pregnancy. Pregnancy carries an 11% mortality rate from arterial or uterine rupture ( 2). Because EDS IV is uncom­mon, the identification of multiple arterial aneurysms may lead to a tentative diagnosis of vasculitis and treatment with immunosuppressive agents, which could compromise vas­cular integrity. EDS IV is clinically distinct from other types of EDS in that affected individuals usually do not have large joint hyperflexibility or skin hyperextensibility ( 4). However, as illustrated by Case 1, dislocation of large joints can occur. Instead of skin hyperextensibility, patients with EDS IV of­ten have translucent soft skin that bruises easily with mini­mal trauma. Acrogeric ( prematurely aged) features involv­ing the face and distal extremities are seen in some indi­viduals with EDS IV, but were not present in either of our patients. Given the subtlety of clinical features in some indi­viduals, the physician should be alert to a family history of relatives with similar vascular problems or premature deaths due to arterial or hollow organ rupture. The diagno­sis can be confirmed by analysis of type III procollagen pro­duced by cultured fibroblasts, following which the mutation in the COL3A1 gene can be identified readily ( 2). Once a mutation is identified, other family members can be screened. Although no cure is available, confirmation of the diagnosis of EDS IV is critical in advising patients about the risks of pregnancy and in guiding medical and _ oU . „ . © 2002 Lippincott Williams & Wtikins , Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited. SPONTANEOUS CCF IN EDS IV JNeuro- Ophthalmol, Vol. 22, No. 2, 2002 surgical management in the event of an arterial or hollow organ complication. REFERENCES 1. Beighton P, De Paepe A, Steinmann B, et al. Ehlers- Danlos syn­dromes: revised nosology, Villefranche, 1997. Am J Med Genet 1998; 77: 31- 7. 2. Pepin M, Schwarze U, Superti- Furga A, et al. Clinical and genetic features of Ehlers- Danlos syndrome Type IV, the vascular type. N Engl J Med 2000; 342: 673- 80. 3. North KN, Whiteman DA, Pepin MG, et al. Cerebrovascular com­plications in Ehlers- Danlos syndrome Type IV. Ann Neurol 1995; 38: 960- 4. 4. Lach B, Nair SG, Russell NA, et al. Spontaneous carotid- cavernous fistula and multiple arterial dissections in Type IV Ehlers- Danlos syndrome. JNeurosurg 1987; 66: 462- 7. 5. Schwarze U, Schievink WI, Petty E, et al. Haploinsufficiency for one COL3A1 allele of type III procollagen results in a pheno-type similar to the vascular form of Ehlers- Danlos syndrome, Ehlers- Danlos syndrome type IV. Am J Hum Genet 2001; 69: 989- 1001. 6. Farley MK, Clark RD, Fallor MK, et al. Spontaneous carotid-cavernous fistula and the Ehlers- Danlos syndromes. Ophthalmol­ogy 1983; 90: 1337- 42. 7. Schievink WI, Piepgras DG, Earnest F 4th, et al. Spontaneous ca­rotid- cavernous fistulae in Ehlers- Danlos syndrome Type IV. J Neurosurg 1991; 74: 991- 8. 8. Kanner AA, Maimon S, Rappaport ZH. Treatment of spontaneous carotid- cavernous fistula in Ehlers- Danlos syndrome by trans-venous occlusion with Guglielmi detachable coils. Case report and review of the literature. J Neurosurg 2000; 93: 689- 92. 9. Kashiwagi S, Tsuchida E, Goto K, et al. Balloon occlusion of a spontaneous carotid- cavernous fistula in Ehlers- Danlos syndrome type IV. Surg Neurol 1993; 39: 187- 90. 10. Forlodou P, de Kersaint- Gilly A, Pizzanelli J, et al. Ehlers- Danlos syndrome with a spontaneous caroticocavernous fistula occluded by detachable balloon: case report and review of the literature. Neu­roradiology 1996; 38: 595- 7. 11. Debrun GM, Aletich VA, Miller NR, et al. Three cases of sponta­neous direct carotid cavernous fistulas associated with Ehlers- Danlos syndrome type IV. Surg Neurol 1996; 46: 247- 52. 12. Pollack JS, Custer PL, Hart WM, et al. Ocular complications in Ehlers- Danlos syndrome type IV. Arch Ophthal 1997; 115: 416- 9. 13. Jansen O, Dorfler A, Forsting M, et al. Endovascular therapy of ateriovenous fistulae with electrolytically detachable coils. Neuro­radiology 1999; 41: 951- 7. Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.